ID: 920523888

View in Genome Browser
Species Human (GRCh38)
Location 1:206651177-206651199
Sequence ATGAATAAAGAAGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920523888_920523892 -5 Left 920523888 1:206651177-206651199 CCATCCTCCTCTTCTTTATTCAT No data
Right 920523892 1:206651195-206651217 TTCATCACTGCCTTCTTCAAGGG 0: 1
1: 0
2: 2
3: 30
4: 319
920523888_920523893 -2 Left 920523888 1:206651177-206651199 CCATCCTCCTCTTCTTTATTCAT No data
Right 920523893 1:206651198-206651220 ATCACTGCCTTCTTCAAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 191
920523888_920523891 -6 Left 920523888 1:206651177-206651199 CCATCCTCCTCTTCTTTATTCAT No data
Right 920523891 1:206651194-206651216 ATTCATCACTGCCTTCTTCAAGG 0: 1
1: 0
2: 4
3: 29
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920523888 Original CRISPR ATGAATAAAGAAGAGGAGGA TGG (reversed) Intronic
No off target data available for this crispr