ID: 920528602

View in Genome Browser
Species Human (GRCh38)
Location 1:206685641-206685663
Sequence CGCACTCGGCACCGCCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920528602_920528615 24 Left 920528602 1:206685641-206685663 CCGGGCCGGCGGTGCCGAGTGCG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 920528615 1:206685688-206685710 CTCGCCTCCCTGACCGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 77
920528602_920528610 -9 Left 920528602 1:206685641-206685663 CCGGGCCGGCGGTGCCGAGTGCG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 920528610 1:206685655-206685677 CCGAGTGCGGCGCGGGCGGCGGG 0: 1
1: 0
2: 8
3: 27
4: 294
920528602_920528608 -10 Left 920528602 1:206685641-206685663 CCGGGCCGGCGGTGCCGAGTGCG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 920528608 1:206685654-206685676 GCCGAGTGCGGCGCGGGCGGCGG 0: 1
1: 1
2: 4
3: 49
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920528602 Original CRISPR CGCACTCGGCACCGCCGGCC CGG (reversed) Intronic
900349445 1:2227819-2227841 CGCGCTCGGCTCCGCTCGCCCGG - Intergenic
903324760 1:22563526-22563548 CGCTCTCCGCACACCCGGCCGGG - Intergenic
903883690 1:26529575-26529597 CGCGCTCGGCTCCGCCGGAGAGG - Intergenic
914875722 1:151511615-151511637 CCCACTCGGCACCGGTGCCCTGG - Intronic
915446629 1:155978095-155978117 AGCACTCGGTCCCGCCGGCTTGG + Intronic
915489239 1:156242270-156242292 CGCACTTTGCATCGCTGGCCAGG + Exonic
918260277 1:182789642-182789664 CGCGCCCGGAACCGCTGGCCCGG - Intronic
920394188 1:205631858-205631880 CGCACGCGGCAGCGGCGGCGCGG + Exonic
920528602 1:206685641-206685663 CGCACTCGGCACCGCCGGCCCGG - Intronic
922699664 1:227751336-227751358 CGCAGGCCCCACCGCCGGCCAGG + Intronic
1064202832 10:13299487-13299509 CGCCCTGGGCAGCGCCTGCCTGG + Intronic
1072021726 10:91409877-91409899 GGGACTCGGCGCCGCAGGCCAGG + Intergenic
1072757450 10:98030478-98030500 CGCTCTCGGCCCCGCCGCCTAGG + Exonic
1073426475 10:103458322-103458344 CGCACTGGGCAACGGCAGCCTGG - Exonic
1076789367 10:132768508-132768530 GGCACTCGGGACCCCCCGCCAGG - Intronic
1077252650 11:1567396-1567418 CTCACTGGCCCCCGCCGGCCTGG - Intronic
1078534193 11:12160220-12160242 CCCACTGGGCACCACCTGCCAGG - Intronic
1079428211 11:20363816-20363838 CGCGCTCAGCGCCGCAGGCCCGG - Exonic
1082693462 11:56332125-56332147 CTCACCTGGCACCGCTGGCCAGG - Intergenic
1083795474 11:65014316-65014338 GGCGCCCGGCACCGCCTGCCCGG - Intronic
1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG + Exonic
1083997052 11:66277961-66277983 CGCACTCGGCCCCCTCGGGCGGG - Intergenic
1085784910 11:79440418-79440440 CGCCCTCTGCACTGCTGGCCCGG - Intronic
1092270230 12:7018158-7018180 CGCACCCGGCACAGCCCTCCCGG + Intronic
1092727617 12:11500416-11500438 CGCGCTCCCCACCGCCGCCCAGG + Intronic
1096583124 12:52601200-52601222 CGCCTTCGGCAGCGCCGGGCTGG - Exonic
1104747963 12:131221790-131221812 CCCACTCGGCACTGCAGGACTGG - Intergenic
1107468048 13:40666712-40666734 GGCATGCGGCACCGCCGCCCGGG + Intergenic
1113615790 13:111679860-111679882 CGCACTGGGCTTTGCCGGCCAGG - Intergenic
1113621258 13:111764762-111764784 CGCACTGGGCTTTGCCGGCCAGG - Intergenic
1113956031 13:114100209-114100231 CGCCCTCAGCACCGCGGGCCGGG - Intronic
1115993892 14:39175666-39175688 CGCTCTCGGCCCTGCAGGCCCGG + Intronic
1118306320 14:64658263-64658285 CGCACTTGGAGCCGCCGGCCCGG + Intergenic
1121145366 14:91578053-91578075 CGCACTCGGAGCGGCTGGCCTGG + Intergenic
1122817953 14:104323097-104323119 AGCTCTAGGCACCGCCGGCATGG - Intergenic
1122982191 14:105196863-105196885 GGGACTCGGGACCGCAGGCCGGG + Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123719828 15:23050188-23050210 CCCCCCCGGCACCTCCGGCCAGG - Intergenic
1129424802 15:75455329-75455351 CGCACGCCGCAGCTCCGGCCCGG + Intronic
1129933909 15:79433247-79433269 CGCTCCCCGCACCGCCGGCGAGG - Intronic
1132566852 16:627502-627524 CGCCCCCGGCCCCGCTGGCCAGG - Exonic
1132591493 16:728157-728179 CGCGCCCAGCACCGCCAGCCCGG - Exonic
1132828936 16:1918284-1918306 CGCCCCCGGCCCCGCCGCCCAGG + Exonic
1137692393 16:50438049-50438071 CCCACTCGGCAGTGCCTGCCAGG - Intergenic
1141894793 16:86952504-86952526 GGCACTTGGCACAGCTGGCCTGG - Intergenic
1142136283 16:88453360-88453382 CGCACTCGCCGCCGCCGCCGCGG - Exonic
1142228382 16:88888381-88888403 CCCACTCGGCACCTCCTGTCTGG + Intronic
1142610901 17:1108876-1108898 CACCTTCGGCAGCGCCGGCCCGG + Intronic
1147110440 17:38257360-38257382 CGTGCGCGGCCCCGCCGGCCGGG + Intergenic
1148167040 17:45490802-45490824 CGCGATTGGCACCGCGGGCCGGG - Intergenic
1148419066 17:47531071-47531093 CGTGCGCGGCCCCGCCGGCCGGG - Exonic
1148664080 17:49361863-49361885 CGCACTCGCCACCGCCGCGGCGG - Intronic
1149296234 17:55264890-55264912 CACGCGCGGCACCGCCCGCCTGG - Intergenic
1150398218 17:64837207-64837229 CGCGATTGGCACCGCGGGCCGGG - Intergenic
1152516219 17:80826378-80826400 CGAGCTCTGCACAGCCGGCCGGG - Intronic
1154255330 18:12777130-12777152 CACACTCGGAGCGGCCGGCCGGG - Intergenic
1160966758 19:1750045-1750067 CACACTAGGCACCGGCGGCCGGG + Intergenic
1163820910 19:19496110-19496132 CACACTGGGCACCGACGCCCGGG - Exonic
1166852888 19:45768815-45768837 CGCGCTCGGCTCCGCAGGCAAGG + Exonic
1168343811 19:55641056-55641078 CGTCCCCGGCGCCGCCGGCCCGG + Intronic
927596568 2:24402943-24402965 CGCACTCTGAGCCGCCGGCCAGG + Intergenic
936412793 2:112275507-112275529 CGCGCTCGGCCCCGGCGGGCTGG + Intergenic
937083844 2:119158092-119158114 CGGACCCAGCACCGCCGCCCTGG - Exonic
938728763 2:134130022-134130044 CGCACTCGGAGCGGCCGGCTGGG + Intronic
944058497 2:195547589-195547611 CGCACTAGGCGCGGCCGGCGGGG - Intergenic
944615225 2:201452203-201452225 CGCACCTGGCACGGCCGGCACGG - Intronic
948207959 2:236172878-236172900 GGAACTCGGCTCCCCCGGCCGGG + Intergenic
1171974848 20:31587902-31587924 CGCCCTCGCCCCCGCCCGCCGGG + Intergenic
1172320882 20:33994306-33994328 CCCACTCGGACCCGCCGCCCCGG + Intronic
1172426445 20:34859490-34859512 TGTACTTGGCACCTCCGGCCCGG - Exonic
1176102977 20:63372888-63372910 CGCACTCGTCCCCACCTGCCTGG + Intronic
1177318712 21:19493681-19493703 GGCACTCGGAGCGGCCGGCCGGG + Intergenic
1178922527 21:36747933-36747955 CGCACCCGCCGCCTCCGGCCTGG + Exonic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1184712758 22:46262857-46262879 CGGACCCGGCGCCGCCCGCCCGG - Exonic
1185413431 22:50697578-50697600 CGCCCCCCGCACCGCCGCCCCGG + Intergenic
961359328 3:126357247-126357269 CGCACGCCGGACCGGCGGCCAGG + Exonic
963440394 3:145333477-145333499 CGCACTCGGAGCGGCCGGCAGGG + Intergenic
963511129 3:146250886-146250908 CGCCCTCGGCCCCGCAGCCCGGG + Intronic
973551239 4:52038129-52038151 CGCCCCCCGCACCCCCGGCCAGG + Intronic
979205562 4:118033604-118033626 CGCCCTCGCCACCGCCTCCCGGG - Intronic
986184520 5:5423033-5423055 GGGACTCGGCTCGGCCGGCCGGG + Intronic
991371783 5:65926335-65926357 CGTCCTCGCCCCCGCCGGCCGGG + Intergenic
992431691 5:76716374-76716396 CGCACCCGGGCCCGCAGGCCAGG + Exonic
994239858 5:97407263-97407285 CGCACTCGGAGCCGCCGGCCCGG + Intergenic
995988453 5:118208224-118208246 TGCACTCGGAGCCCCCGGCCAGG - Intergenic
998463275 5:142324655-142324677 CGCCCTCGGCCCGGCCGGCACGG - Intronic
1001506494 5:172284071-172284093 CGCCCTCCGCACCCACGGCCTGG + Exonic
1002590040 5:180284350-180284372 TGCACTCAGCAGCGCCCGCCAGG + Intronic
1003645557 6:7910717-7910739 CGCAGTCAGGGCCGCCGGCCGGG + Exonic
1007738720 6:43998183-43998205 CGCACTCGGAGCAGCCCGCCAGG + Intergenic
1018400659 6:163415709-163415731 CCCACGCCGCGCCGCCGGCCTGG + Intronic
1018686343 6:166307533-166307555 CGCACCCCCCACCGCCGGCCAGG - Exonic
1019607500 7:1917474-1917496 CGCCCTCAGCACCGCCTGGCCGG + Intronic
1020211518 7:6161667-6161689 CGAAGTCGGCACCTTCGGCCAGG + Intergenic
1020253469 7:6487325-6487347 CGCACTCTGCACCCACGCCCAGG + Intergenic
1021085962 7:16421275-16421297 AGGACCCGGCTCCGCCGGCCTGG + Exonic
1030216045 7:107044764-107044786 CGCACTGGGCCCCGGCGGCCCGG - Exonic
1034494063 7:151409809-151409831 CCCACTCGGGACCTCCGCCCTGG + Intronic
1036850050 8:12194653-12194675 CGGACTCGGCCCCGCCTCCCGGG - Intergenic
1036871414 8:12436926-12436948 CGGACTCGGCCCCGCCTCCCGGG - Intergenic
1037807537 8:22066909-22066931 CGCCCTCGGCGGCCCCGGCCCGG - Intronic
1041690085 8:60679355-60679377 CGCCCCCGCCGCCGCCGGCCCGG - Intronic
1042837732 8:73092992-73093014 CGGCCTCGGCGCAGCCGGCCTGG + Exonic
1049575188 8:143386581-143386603 CCCACTCGGCACCCCCGTCCTGG - Intergenic
1049798912 8:144508882-144508904 CGCGCCCAGCACTGCCGGCCGGG - Intergenic
1051549789 9:18315605-18315627 CGCACTCAGAGCGGCCGGCCCGG - Intergenic
1189534606 X:41923528-41923550 CGCAGCCGCCACCGCCCGCCCGG + Intergenic
1194035337 X:88863971-88863993 CGCACTCGGCGCCGCCGGCTGGG + Intergenic