ID: 920530640

View in Genome Browser
Species Human (GRCh38)
Location 1:206699578-206699600
Sequence GCCTCCTTCGTGACTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920530640_920530643 -3 Left 920530640 1:206699578-206699600 CCAGGAGAAGTCACGAAGGAGGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 920530643 1:206699598-206699620 GGCAAGAAAAAGAAATGGCTGGG 0: 1
1: 0
2: 3
3: 68
4: 735
920530640_920530644 9 Left 920530640 1:206699578-206699600 CCAGGAGAAGTCACGAAGGAGGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 920530644 1:206699610-206699632 AAATGGCTGGGCTAAAGCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 166
920530640_920530641 -8 Left 920530640 1:206699578-206699600 CCAGGAGAAGTCACGAAGGAGGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 920530641 1:206699593-206699615 AAGGAGGCAAGAAAAAGAAATGG 0: 1
1: 3
2: 70
3: 581
4: 3212
920530640_920530642 -4 Left 920530640 1:206699578-206699600 CCAGGAGAAGTCACGAAGGAGGC 0: 1
1: 0
2: 0
3: 9
4: 143
Right 920530642 1:206699597-206699619 AGGCAAGAAAAAGAAATGGCTGG 0: 1
1: 1
2: 53
3: 712
4: 5330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920530640 Original CRISPR GCCTCCTTCGTGACTTCTCC TGG (reversed) Intronic