ID: 920531994

View in Genome Browser
Species Human (GRCh38)
Location 1:206709220-206709242
Sequence TGAAGGAGCAACTGAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920531994_920532000 -5 Left 920531994 1:206709220-206709242 CCAGTCCCTCAGTTGCTCCTTCA 0: 1
1: 0
2: 0
3: 30
4: 361
Right 920532000 1:206709238-206709260 CTTCAGGGTTTCTCTTCTTCCGG 0: 1
1: 0
2: 0
3: 24
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920531994 Original CRISPR TGAAGGAGCAACTGAGGGAC TGG (reversed) Intronic
900322228 1:2090497-2090519 GGAAGGAGCAGCTGAGGGTGAGG - Intronic
900347791 1:2218711-2218733 TGGAGGAGCAAAGGAGGGCCAGG - Intergenic
900803480 1:4752131-4752153 TAAAGGAGGAACAGAGGGAGGGG + Intronic
900902661 1:5527437-5527459 GGAAGGAGCCACGGAGGGAACGG - Intergenic
901202711 1:7475777-7475799 AGAAGAAGAAACTGAGGGTCAGG + Intronic
901217172 1:7561336-7561358 TGATGGAGGGACAGAGGGACAGG + Intronic
902086559 1:13867360-13867382 TGAAGGAGGAACTTATAGACTGG - Intergenic
903769261 1:25753736-25753758 TGATGTAGAAACTGAGGCACAGG + Intronic
904330707 1:29756175-29756197 TGAAAGAGAAACAGAGGGAGGGG + Intergenic
904588451 1:31593438-31593460 TGAAGGTGCAACTGAGGGGAGGG + Intergenic
904761862 1:32811013-32811035 TGAAGGAGATACTGAAGGAGCGG - Exonic
904896956 1:33824691-33824713 GGGAGGAGCAAGTCAGGGACAGG + Intronic
905923418 1:41733710-41733732 GGAAGCAGCAACCAAGGGACTGG + Intronic
906481964 1:46204955-46204977 AGATGGAGAAACTGAGGCACAGG + Intronic
906685251 1:47759011-47759033 TGATGAAGCAACTGAGACACAGG - Intergenic
907140398 1:52181065-52181087 TGAGGGAGAAAGTGAGGGAGAGG - Intronic
907602332 1:55783936-55783958 TGAGGGGGCTACTGAGAGACAGG - Intergenic
907676893 1:56526202-56526224 TGAAGGAACAAATGAAGGAAAGG + Intronic
907786270 1:57616103-57616125 TGAGTGAGCAAATGAGGGAGGGG - Intronic
907873760 1:58466280-58466302 TGAAGGAGCAAGGGAGGGGAGGG - Intronic
909594842 1:77395022-77395044 TGCAGGAACAAATGAGGGAGAGG - Intronic
913010460 1:114677969-114677991 TGTAGGAGCAAGTGAGCTACGGG - Exonic
913530315 1:119729409-119729431 TGAAGCAGTAACTGGGAGACAGG + Intronic
915833372 1:159152316-159152338 AGAAGGAGGGACTGAGGGATAGG - Intergenic
915885936 1:159721110-159721132 TGAAGGAATAACTGAAGGAATGG + Intergenic
916243799 1:162666389-162666411 TGAATGAGCAAATGAAGGACAGG + Intronic
916587604 1:166162280-166162302 TGAAGGAGGAGTAGAGGGACAGG + Intronic
916742611 1:167659735-167659757 TTAAGGAGCAAATGGGGGAGGGG - Intronic
917839922 1:178969467-178969489 TGAGTGAGCCACAGAGGGACTGG - Intergenic
917922017 1:179758646-179758668 GGACGGAGGAACAGAGGGACAGG - Intronic
920342413 1:205284011-205284033 TGAAGCAGCAACGGAGGCAGCGG + Intergenic
920531994 1:206709220-206709242 TGAAGGAGCAACTGAGGGACTGG - Intronic
922175725 1:223195583-223195605 TGATGGAGCAACTGTGGGAGTGG + Intergenic
922354181 1:224760503-224760525 TGAAGGAGCCACTGTCTGACCGG - Intergenic
923337689 1:232984666-232984688 TGAAGCAGCATCTGAGACACAGG + Intronic
924285346 1:242480420-242480442 TGAAGGAGCAACTTTGGGGTAGG + Intronic
1062959654 10:1562912-1562934 TGAAGGAGCAATTGAAGAAGAGG - Intronic
1063114244 10:3063065-3063087 TGAAGGAGTAAGTGAGTGAGTGG - Intergenic
1063114248 10:3063129-3063151 TGAAGGAGTAAATGAGTGAATGG - Intergenic
1064104616 10:12490366-12490388 TGGAGGGGGAACTGGGGGACTGG + Intronic
1064843839 10:19628877-19628899 GGAAAGAAAAACTGAGGGACGGG - Intronic
1065309490 10:24400769-24400791 TGAAAGACCAACTTAGAGACAGG + Intronic
1065813447 10:29463656-29463678 TGAAGGAGCTCCTGATGGTCTGG - Intronic
1065958205 10:30711319-30711341 TGAAGGAGCTCCTGACGGTCGGG + Intergenic
1066128732 10:32368928-32368950 AGAAGAAGAAACTGAGGGTCTGG + Intronic
1067453377 10:46396488-46396510 TGAAGGAGCTACTGAAAGAGTGG - Intergenic
1067583858 10:47463278-47463300 TGAAGGAGCTACTGAAAGAGTGG + Intronic
1067633861 10:47988626-47988648 TGAAGGAGCTACTGAAAGAGTGG + Intergenic
1067913657 10:50373222-50373244 TGTATGAGCAACTGAGACACTGG + Intronic
1069618236 10:69819904-69819926 TCATGGAGCATCTGAGGAACAGG - Intronic
1070350050 10:75583163-75583185 TGTGGGAGCAACTGTGGAACTGG - Intronic
1071133019 10:82417641-82417663 AGAAGGGGAAACTGAGGCACGGG + Intronic
1071355605 10:84790448-84790470 TGAAGGAGGAGATGAGGGAAAGG + Intergenic
1072716103 10:97753595-97753617 AGAAGGGGAAACTGAGGCACGGG - Intronic
1072824065 10:98588346-98588368 AGAAGGAGAAACTGAAAGACAGG + Intronic
1074885075 10:117686856-117686878 TGAAGGAGGAACAGTGGGACAGG + Intergenic
1075626840 10:123969867-123969889 GGAAGGAGGAAATGAGGGAAAGG + Intergenic
1075861327 10:125679252-125679274 CTAAGAAGCAACTGAGGCACGGG - Intronic
1076157707 10:128216238-128216260 TAAAGGAGAAACTGAGGCTCAGG - Intergenic
1076167010 10:128290766-128290788 GGAAGGAGAGACTGAGGGACAGG + Intergenic
1076511317 10:131015705-131015727 TGGAGGGGCAGCTGAGGCACTGG + Intergenic
1079320178 11:19445359-19445381 TGAAGAAGGAGCTGAGGGAGGGG + Intronic
1080957669 11:37119341-37119363 TGAAGGTGCAATTCAGGGGCTGG - Intergenic
1082568982 11:54714604-54714626 TGAATGCCCAACTGAGGTACCGG - Intergenic
1083335272 11:61918229-61918251 GGACAGAGGAACTGAGGGACAGG - Intronic
1083448844 11:62728792-62728814 TGAAGGAGCAAGTGAAGCTCTGG - Exonic
1084471113 11:69359413-69359435 AGAGGGAGAAACTGAGGCACAGG - Intronic
1084532627 11:69737604-69737626 GGAAGCAGAAGCTGAGGGACGGG - Intergenic
1086203465 11:84231470-84231492 TGAAGTAGATACTGAAGGACGGG + Intronic
1086736663 11:90315169-90315191 TGAATGAGTTACTAAGGGACAGG + Intergenic
1086975422 11:93126825-93126847 TGAAGGGGCTACTGTGGGAATGG - Intergenic
1087323463 11:96692319-96692341 AGTAGGAGAAACTGGGGGACGGG - Intergenic
1088183898 11:107142398-107142420 TGAAGGAGGAAAAGAGGGAAAGG - Intergenic
1089451500 11:118601017-118601039 TAAAGGAGCAACTTAGGTAAAGG - Exonic
1089603816 11:119630191-119630213 TGAAGGGGAAACTGAGGCCCTGG - Intronic
1089853283 11:121518399-121518421 TGAAGGAGCATGTGAGGTACAGG + Intronic
1091529929 12:1344427-1344449 TGAAGGAGGAAAGGAGAGACTGG + Intronic
1092406765 12:8227155-8227177 AGCAGCAGTAACTGAGGGACAGG - Intronic
1092979425 12:13778777-13778799 TGAACGATCAAGTGAGGGACAGG - Intronic
1095599756 12:44001451-44001473 TGAAGTAGCAACTGTGGTATAGG + Intronic
1098095243 12:66947428-66947450 TTAAGGAGAAACCAAGGGACTGG - Intergenic
1098987114 12:77024471-77024493 GGAGGAAGAAACTGAGGGACAGG - Intronic
1099648387 12:85391221-85391243 GGAAGGAGCAACCCAGGCACAGG - Intergenic
1100349200 12:93762684-93762706 GGAAAGGGAAACTGAGGGACTGG - Intronic
1101437654 12:104677842-104677864 TGGAACAGCAACTGAGGGACAGG - Intronic
1101758311 12:107638798-107638820 AGAAGGAGAAACTGAGGCATGGG + Intronic
1102035810 12:109769846-109769868 GGAAGGAGGAACAGGGGGACTGG - Exonic
1102425048 12:112837535-112837557 AGATGGAGAAACTGAGGCACAGG - Intronic
1102574691 12:113848996-113849018 TGAATGGGAAACTGAGGCACTGG + Intronic
1102632500 12:114293607-114293629 TCAATGAGAAACTGAGGAACAGG + Intergenic
1104484376 12:129137411-129137433 TAAGGGAGAAACTGAGGGTCAGG + Intronic
1106256247 13:28024424-28024446 AGAAGGAGTAAATGAGGGGCTGG - Intronic
1106473464 13:30077883-30077905 AGAAGGAACAACAGAGGCACTGG + Intergenic
1106588096 13:31074465-31074487 TGAAGGAGAAAGGGAAGGACAGG + Intergenic
1108595498 13:51945324-51945346 TGAATGAGCAAATGAGGAACTGG - Intronic
1110182722 13:72636465-72636487 TAAAGGAGAAAGTGAGGGAGGGG - Intergenic
1110436542 13:75482416-75482438 GGAAGGAGCGAGGGAGGGACGGG - Intergenic
1111144957 13:84167568-84167590 TGAGGGAGCAACTTTGGAACTGG - Intergenic
1112209427 13:97361128-97361150 TGAAGGAGTACCTGAGGGTCTGG + Intronic
1112836955 13:103527423-103527445 TGAAGGAACAAATGAGAGAAAGG - Intergenic
1115419041 14:33171425-33171447 TGATGGAGAAGCTGTGGGACAGG - Intronic
1116661675 14:47717633-47717655 TTAAGGAGCCAGTGAGGGATGGG - Intergenic
1117338211 14:54772923-54772945 TGAAGGAAGAACTCAGGGCCAGG - Intronic
1118264167 14:64278619-64278641 GGAGGGAGCAGTTGAGGGACAGG + Intronic
1118326288 14:64783625-64783647 AGAGGGAGAAACTGAGGCACAGG + Intronic
1118462245 14:65997720-65997742 TGAAGGAGCTTCTGTGGGCCAGG + Intronic
1118768692 14:68927507-68927529 TGAAGGAACAAGTGGGGAACTGG + Intronic
1119466030 14:74859429-74859451 TGAAGGAGTAAGTGAGTGAACGG + Intronic
1119508967 14:75196424-75196446 AGAAGGAGCAACAGAGACACAGG - Intergenic
1119857023 14:77908443-77908465 AGAAGCAGAAAGTGAGGGACAGG - Intronic
1122262691 14:100532123-100532145 AGAAGGAGAAACTGAGGAACTGG - Intergenic
1122824478 14:104362927-104362949 AGATGGAGAAACTGAGGCACGGG - Intergenic
1124849462 15:33322345-33322367 AGAAGGAGCAAGAGAGGGAGCGG + Intronic
1125029259 15:35060087-35060109 ACCAGGAGCCACTGAGGGACAGG + Intergenic
1125110326 15:36024666-36024688 TTAAAGAGCAACTGAGTGACAGG - Intergenic
1126257128 15:46640978-46641000 GGAAGGAGAAACAGAGGGAGAGG + Intergenic
1126528268 15:49682835-49682857 TGGAGTTGCAACAGAGGGACAGG - Intergenic
1126719237 15:51559194-51559216 TGAATGAGCAACTAATGGAGTGG + Intronic
1126865701 15:52934581-52934603 TGTAGGAGCATTTGAGGGAAAGG - Intergenic
1127428704 15:58881295-58881317 TGGAGGATCACCTGAGGAACAGG + Intronic
1127692112 15:61407236-61407258 TCAAGGAGCAAGGGAGGGGCTGG + Intergenic
1127884936 15:63190161-63190183 TGAAGGGGGAAATGAGGGATGGG + Intronic
1129517480 15:76165544-76165566 TGAAGGAGCATCTGAGGAGCTGG - Intronic
1129517907 15:76168051-76168073 AGAAGGAGAAACTGAGGCCCAGG + Intronic
1129604487 15:77018227-77018249 TGGAGGAGCTACTGAGGCAGAGG + Exonic
1130377691 15:83344421-83344443 TGAAGGAACAACTGAGAAGCTGG - Intergenic
1130444919 15:83991709-83991731 AGAAAGAGCCACTGAGGAACAGG - Intronic
1132645425 16:997279-997301 TGAAGGGGCCAGTGTGGGACTGG - Intergenic
1132665805 16:1080844-1080866 TGCAGGAGGACCTGAGGGTCAGG + Intergenic
1135186044 16:20316843-20316865 TGGAGGAGGAAAGGAGGGACAGG - Intronic
1135189275 16:20341648-20341670 AGCAGTAGCAAGTGAGGGACTGG - Intronic
1137526985 16:49244952-49244974 AGAAGGAGCAAGAGAGGGAGGGG - Intergenic
1138351925 16:56350659-56350681 TCCAGGAGCACCTGGGGGACTGG - Intronic
1138957938 16:61993658-61993680 GGAAGGAGGAACTGGAGGACAGG - Intronic
1139248809 16:65474712-65474734 TGGAGGAGACACAGAGGGACAGG + Intergenic
1139272901 16:65700095-65700117 TGAATGAGCAACACAGGGAGAGG - Intergenic
1139799539 16:69510591-69510613 GAAAGGAGCAACAGAGGAACAGG + Intergenic
1140897909 16:79341255-79341277 AGATGGAGAAACTGAGGTACAGG - Intergenic
1141254530 16:82388420-82388442 TTGAGGAGCAACTGGGGGAAAGG - Intergenic
1142285454 16:89169791-89169813 ACAAGGAGAAACTGAGGCACGGG + Intergenic
1142486249 17:249338-249360 TGATGAAGAAACTGAGGGCCAGG - Intronic
1143492000 17:7290145-7290167 AGAAGGAGGAACTGAGGGTTGGG - Intronic
1143854581 17:9839335-9839357 TGGAGTAGAAACTGAGGGACAGG + Intronic
1144371291 17:14594158-14594180 TGGAGGAGAAACTCAGGGGCAGG - Intergenic
1144665942 17:17102374-17102396 TGAAGGGGCAGCAGAGGGATTGG - Intronic
1144769189 17:17749876-17749898 TGAATGAGCAAATGAGTGAATGG + Intronic
1144947839 17:18978846-18978868 TGAAGCTGCAACAGAGGGAGGGG + Exonic
1146330647 17:31924398-31924420 TGAAAGAGGAGATGAGGGACCGG - Intergenic
1146448804 17:32955139-32955161 TGGAGGAAGAACTGAGGAACAGG - Intergenic
1146924885 17:36737315-36737337 AGATGGAGAAACTGAGGCACAGG - Intergenic
1148554431 17:48569789-48569811 TGAAGGGGCAAAAAAGGGACAGG + Intronic
1148610098 17:48959417-48959439 TGAGGGAGCAAATCTGGGACAGG - Intronic
1149152321 17:53582567-53582589 TGAGGGAGCAATTGAGCCACTGG + Intergenic
1151474746 17:74339143-74339165 TACAGGAACTACTGAGGGACAGG + Intronic
1151835721 17:76581494-76581516 TGACGGAGGAGCTGCGGGACAGG + Intronic
1152365702 17:79855157-79855179 GGATGGAGAAACTGAGGCACAGG - Intergenic
1152401367 17:80068420-80068442 TGAAGAAGCAACTTGGAGACAGG + Intronic
1152970631 18:158378-158400 GGAGGGAGCAAGTGAGGGACGGG - Intronic
1153926611 18:9840141-9840163 TGAAGGAGCAGCCAGGGGACAGG + Intronic
1154028358 18:10727322-10727344 TGAAGGAGCACCAAGGGGACAGG - Intronic
1155213249 18:23620515-23620537 TGAAGGAGCTAGAGAGGGAGGGG + Intronic
1156100362 18:33586592-33586614 TAAAGGGGCAACTGAGAGAAGGG - Intronic
1158210214 18:55040599-55040621 TGAAAGAGGATCTGAGAGACAGG - Intergenic
1160935147 19:1591304-1591326 TGCAGGAGGAGCTCAGGGACTGG - Intronic
1161348450 19:3779293-3779315 TCAAGGGGAAACTGAGGCACGGG - Intronic
1161856559 19:6769048-6769070 AGATGGAGAAACTGAGGCACAGG + Intergenic
1162197215 19:8994257-8994279 TGAATGAGTGACTGAGGGTCTGG - Intergenic
1162985119 19:14265014-14265036 AGATGGAGAAACTGAGGCACGGG - Intergenic
1163028264 19:14526812-14526834 TGAAGGAGCAACACATGGATGGG + Intronic
1164456397 19:28411146-28411168 GGCAGGTGCAACTGAGGAACTGG + Intergenic
1164995449 19:32717873-32717895 ACAAGGACCAACTGAGGGCCTGG + Intergenic
1165119425 19:33549526-33549548 TGAGTGAGCAACTGGGGGATGGG - Intergenic
1165193518 19:34083098-34083120 TGAAGGAGAAAATGATGGAAAGG + Intergenic
1165715468 19:38042961-38042983 AGATGGAGAAACTGAGGCACAGG - Intronic
1165894422 19:39132986-39133008 AGAAGGGGAAACTGAGGCACAGG + Intronic
1166007370 19:39916669-39916691 TGATGGGGAAACTGAGGCACGGG - Intronic
1166202738 19:41249006-41249028 TGAAGGAACAACTGGGGGCAGGG + Intronic
1166797394 19:45435333-45435355 AGAGGGAGAAACTGAGGCACAGG + Intronic
1167197768 19:48042506-48042528 TGAAAGAGAAGCTGAGGGAAAGG - Intronic
1167214389 19:48154756-48154778 TGAAGGAGCCACTGGGGGCCGGG - Intronic
1167452522 19:49580529-49580551 TGAAGAAGCGACCGAGGGACTGG - Exonic
1168410809 19:56139209-56139231 TGGAGCAGGAACTGAGGGGCAGG + Intronic
925299878 2:2804185-2804207 GGAAGGAGCAACAGAGGCAAAGG + Intergenic
925338210 2:3114287-3114309 AGATGGAGAAACTGAGGCACAGG - Intergenic
925561883 2:5204852-5204874 TGAAGGAGGAAGTGAGGGTCTGG + Intergenic
926335449 2:11859281-11859303 TGCAGCAGCCACTGAGGGAGGGG + Intergenic
926758693 2:16257185-16257207 TGAAGGACCAGCTGAGGGGGAGG + Intergenic
927454508 2:23237979-23238001 TGAAGCAGGAACCGAGTGACAGG + Intergenic
927457846 2:23272665-23272687 TGAAGAAGGTACGGAGGGACTGG - Intergenic
929782370 2:44965360-44965382 TGAAGGGGAAACTGAGGCAAGGG - Intergenic
931640162 2:64374819-64374841 TGAAGAAGCAGCTGAGGCAAGGG + Intergenic
934110323 2:88736172-88736194 TGAAGGAGCATCTGAGAGCCTGG - Intronic
934572732 2:95382877-95382899 AGAGGGAGCAACTGAGTCACAGG - Intronic
934847584 2:97672189-97672211 AGAAGGAGCAACTGGGAGAGTGG + Intergenic
934849348 2:97687605-97687627 AGAAGGAGCAACTGGGAGAGTGG + Intergenic
934865719 2:97808608-97808630 TGAAGGAACAAATGATGGAGAGG - Intronic
935043292 2:99455345-99455367 TGCTGCAGAAACTGAGGGACAGG - Intronic
935855240 2:107266572-107266594 TGAATGAGCAATTGTGGGAAGGG - Intergenic
935975257 2:108572120-108572142 TGAAAGAGGATTTGAGGGACTGG + Intronic
936503525 2:113085777-113085799 GGAAGGAGCCAGTGAAGGACAGG + Intergenic
937466002 2:122133648-122133670 TGAAGCAGCATCTGAGTGAAGGG + Intergenic
938114538 2:128594411-128594433 GGAAGGGGCCACTGAGGGGCAGG - Intergenic
940451393 2:153842622-153842644 TGAAGGATAAACTGAGGTTCTGG - Intergenic
940578941 2:155551064-155551086 TGCAGAAGCAACTGTGGAACTGG - Intergenic
942196125 2:173522035-173522057 TGAAGGAACAGCTGATGGGCAGG + Intergenic
942215755 2:173717760-173717782 AGAAGGAGAGACTGAGGGAGAGG - Intergenic
943130008 2:183842412-183842434 GGATGGAGCAACTGGGGGAAGGG + Intergenic
943478287 2:188385997-188386019 TGTAGAAGCAACTTAGGAACTGG - Intronic
945608467 2:211967182-211967204 TGAATGAGGAAATGAGGGAATGG - Intronic
945783800 2:214208810-214208832 AGAAGAAGTAACTGAGGCACAGG - Intronic
946583872 2:221161494-221161516 TGCAGGAGAAAATGAGGGAAAGG + Intergenic
946921266 2:224584693-224584715 TGAAGGAGCAGCTCCCGGACGGG + Intronic
948171624 2:235908038-235908060 TGAACAAGCAACTGAGAGCCGGG - Intronic
948493435 2:238329200-238329222 AGAAGGAGAGACTGAGAGACAGG + Exonic
948785942 2:240353044-240353066 TGAAGAAGAGACTGAGGGCCAGG + Intergenic
1168829191 20:835320-835342 TCACAGAGCAACTCAGGGACAGG - Intronic
1169748562 20:8967958-8967980 TGAAGGAGCAATTGACTGCCTGG + Intronic
1169864135 20:10181968-10181990 AGAAAGAGAAACTGAGGGGCAGG - Intergenic
1169997249 20:11572134-11572156 TCAGGGAGCTACTGAGGAACAGG - Intergenic
1170459475 20:16563986-16564008 TGGAGGAGCAAGGGAGGGAAGGG - Intronic
1171481003 20:25455661-25455683 TGAAGGAGCAGGTGAGTGATGGG - Exonic
1172860002 20:38041846-38041868 TGAATGAGCAAATGTGGAACAGG - Intronic
1173081179 20:39869108-39869130 TGAAGAAGCAAATGAGAGAATGG + Intergenic
1173579762 20:44138690-44138712 TTAATAAGCAACTGAGGGATGGG + Intronic
1173584761 20:44174266-44174288 TGAAAGAGCAATTGAGGCAAGGG - Intronic
1173748488 20:45456810-45456832 TAAACGAGAACCTGAGGGACAGG - Intergenic
1174188659 20:48724390-48724412 TCAATGAGAAACTGAGGCACAGG + Intronic
1174366000 20:50056856-50056878 TGAAAGGGAAACTGAGGCACAGG + Intergenic
1174529132 20:51197064-51197086 AGAAAGAGCTACTGAGTGACAGG - Intergenic
1174572434 20:51511615-51511637 TAAAGGAGCAACTGAGTGGATGG - Intronic
1175097773 20:56555406-56555428 TGAAAAAACAACTGAGGGAATGG + Intergenic
1175296530 20:57912613-57912635 TGGAGGAGAAACTGAGGCCCAGG + Intergenic
1175652348 20:60736264-60736286 TGCAGGAGCAATGGAGGAACAGG - Intergenic
1176266069 20:64209991-64210013 TGAAGGTGAGACTTAGGGACAGG + Intronic
1177282321 21:18997592-18997614 TAAAGGAGCAACAGAGTGAAAGG - Intergenic
1177722822 21:24929045-24929067 AGCAGGAGCAACAGAGAGACAGG - Intergenic
1178055812 21:28797232-28797254 TGAAGGAACAAAGGAAGGACAGG + Intergenic
1178617100 21:34144134-34144156 GAAAGGAGTAACTGAGGGAATGG - Intergenic
1178823612 21:35997146-35997168 TTCATGAGCAACTGGGGGACTGG + Intronic
1179436778 21:41367854-41367876 GGAGGGAGCTACTGAGGGCCAGG - Intronic
1183065008 22:35356738-35356760 TGAAGAAGTCACTGAGGGAAGGG - Intergenic
1183209644 22:36442985-36443007 TGAAGCAGGAACTGAGGGTGGGG - Intergenic
1184297215 22:43532414-43532436 AGAAGGAGAAACTGAGGCCCAGG + Intronic
1203322952 22_KI270737v1_random:86278-86300 AGAAGGAGGAAATGAGGGAAGGG - Intergenic
949246425 3:1930120-1930142 GGAAGGAGCACCTGAGGGAAGGG + Intergenic
951310958 3:21125390-21125412 GGAAAGAGCACCTGAGGGAAGGG + Intergenic
951523062 3:23627210-23627232 TGTAGAAGCAACTTAGGAACTGG - Intergenic
951862916 3:27273855-27273877 TGCAGGAGTCAGTGAGGGACGGG + Intronic
951887981 3:27542682-27542704 TGAAGGAACAACTCCGGGAAAGG - Intergenic
953408178 3:42670575-42670597 TGAAGCAGCAGCAGAGGTACTGG + Intergenic
953681404 3:45041275-45041297 AGAAGAAGAAACTGAGGTACAGG + Intergenic
953751340 3:45610684-45610706 TGATGGGGAAACTGAGGTACAGG - Intronic
954225830 3:49180459-49180481 AGCAGGAGAAACTGAGTGACTGG - Intronic
954370289 3:50166582-50166604 TGATGGAGAAACCGAGGCACAGG - Intronic
954794862 3:53156412-53156434 GGATGGAGCAACTGAGGTCCTGG - Intronic
957027332 3:75197374-75197396 TGAAAGAGCAAGCCAGGGACTGG + Intergenic
957099423 3:75809335-75809357 TGAAGCAGCAAAGGAGGGAGAGG - Intergenic
957403214 3:79743436-79743458 TGAATGAGCCAGTGAGTGACTGG + Intronic
959734369 3:109641127-109641149 TGAAAGGGGAACTGAGCGACAGG + Intergenic
960249586 3:115437376-115437398 TGAAGGAGCAGCTTAGATACTGG + Intergenic
960427496 3:117526977-117526999 AGAAGGAAGAACTGAGGGAAAGG - Intergenic
960515344 3:118596572-118596594 AGAAGCATCACCTGAGGGACAGG + Intergenic
961638427 3:128349498-128349520 TGAAGGAGGAGGTGAGGGTCTGG + Intronic
962347272 3:134627305-134627327 TGAGGGGGAAACTGAGGCACAGG + Intronic
962600116 3:136985114-136985136 TGCAGGGGCAGCTGAGGAACAGG + Intronic
963164284 3:142185002-142185024 TGGGGGAGCAGCTGAGGGAAAGG - Intronic
963307632 3:143670817-143670839 TGTAGGAGCTACTGAGGGAAGGG - Intronic
963824823 3:149941630-149941652 TGAAGGGGCAGCTTATGGACTGG - Intronic
963926547 3:150957372-150957394 TGAAGGAGCTAAGGAGGGACTGG - Intronic
963971274 3:151431888-151431910 TGAGGAAGCAACTGAAGAACGGG + Intronic
964626949 3:158768750-158768772 GGAAGGAGCTACTGTGGGCCTGG - Intronic
964699262 3:159545779-159545801 TGCAGAACCAACAGAGGGACAGG - Intronic
964751928 3:160060910-160060932 TGCAGGCGCAGGTGAGGGACTGG + Intergenic
966112064 3:176414965-176414987 TGTAGGAGTCACTGAGGGATGGG - Intergenic
967427169 3:189340434-189340456 AGAAGAAGGAACTGAGGCACGGG - Intergenic
968761131 4:2443126-2443148 TGAAGAAGAACCTGAGGAACTGG - Exonic
969148278 4:5143452-5143474 AGAAGGAGGAAGTGAGGGGCTGG - Intronic
970602457 4:17651169-17651191 TAAAGGAGAAAATGAGGGACAGG + Intronic
970604401 4:17665895-17665917 AGAAGCAGCAACTGGGGGGCGGG - Intronic
972692929 4:41417362-41417384 TGAAGTAGAAACTGTGTGACTGG + Intronic
974302101 4:60081807-60081829 GGAAAGAGCACCTGAGGGAAGGG + Intergenic
975810879 4:78168323-78168345 TCAAGGAGCAGCTGAGGGAAAGG - Intronic
978778277 4:112523789-112523811 TGAAGGCGTAAATGAGGGAGGGG - Intergenic
979097575 4:116570571-116570593 TGAGGAAGCATCCGAGGGACTGG + Intergenic
980883085 4:138733041-138733063 TGCAGGAGCAGATCAGGGACAGG + Intergenic
981480650 4:145235651-145235673 TGAAGGATCAACTAAGTAACAGG - Intergenic
981541251 4:145848688-145848710 AGAAGGAACAACTTAGGTACTGG + Intronic
982056072 4:151550006-151550028 TGAAAGAACAAGTGAGTGACAGG + Intronic
982069565 4:151683428-151683450 GCAAGGAGCAGCAGAGGGACAGG - Intronic
983454654 4:167947864-167947886 AGAAGGAGGAACTGTGGCACTGG - Intergenic
983515492 4:168651905-168651927 TGTACAACCAACTGAGGGACTGG + Intronic
985670226 5:1203104-1203126 TGGAGGAGAAACTGAGTCACAGG + Intronic
985704146 5:1390985-1391007 TGAGGGAGCAGGTGAGGGAGGGG - Intergenic
985948617 5:3205535-3205557 AGAAGGAGAAACTGAGGCACGGG - Intergenic
986206376 5:5628720-5628742 TGAGGGAGCAAGGGAGGGAGGGG + Intergenic
986725821 5:10595616-10595638 TGAAGGAGTAACTGAAGGAGAGG + Intronic
987943042 5:24566889-24566911 TGAATGAGCAAGTCAGAGACTGG + Intronic
988294120 5:29332758-29332780 AGGGGGAGCAACTGATGGACTGG + Intergenic
988925781 5:35990244-35990266 TGAGAGGGCAACTGAGGGACAGG - Intronic
989199114 5:38746015-38746037 TGAATGAGAAATTGAGAGACAGG + Intergenic
989419157 5:41215684-41215706 TGCAGGAGAAAATGAGGGCCAGG + Intronic
989538879 5:42595914-42595936 TGAAGAGGCAGCTGAGGGATAGG + Intronic
992719465 5:79545895-79545917 TGAAAGAGCAAAGAAGGGACTGG - Intergenic
992912269 5:81407633-81407655 TTAAGGAGTAACTTAGGCACTGG - Intergenic
994533339 5:100994141-100994163 AGAAGGAGCAACTGAATGAGAGG + Intergenic
995690435 5:114819301-114819323 TGCATGACCAACTGAGGTACCGG - Intergenic
998821379 5:146060720-146060742 AAAAGGGGCAACTGAGGCACAGG + Intronic
999278907 5:150351587-150351609 TGATGGCCCTACTGAGGGACTGG + Intergenic
999931921 5:156442924-156442946 TGATGGAGCAAAAGAGGGAGTGG + Intronic
1003488951 6:6604486-6604508 TGAAGGGAGAACTGATGGACTGG + Intronic
1004084363 6:12430162-12430184 TGAATAAGCAATTGAGGGAAAGG - Intergenic
1005250852 6:23944470-23944492 TGAAGGAGCATCTGGAGAACAGG - Intergenic
1006633864 6:35448546-35448568 AGAAGAAGAAACTGAGGGGCTGG + Intergenic
1006783702 6:36650431-36650453 AGAAGCAGCAACTGGGGCACTGG + Intergenic
1007251780 6:40500209-40500231 TGAAGGAGTCTCTGAGGGGCAGG - Intronic
1007476582 6:42123608-42123630 AGAAGAAGAAACAGAGGGACAGG + Intronic
1007481194 6:42151220-42151242 AGATGGAGAAACTGAGGCACAGG - Intergenic
1007658037 6:43464500-43464522 TCAAGGATCAACTCAGGGCCGGG - Intergenic
1009437427 6:63634896-63634918 AAAAGGAGCTACTTAGGGACAGG - Intergenic
1009591686 6:65680903-65680925 TGATGTAGCAACTGAGCCACAGG + Intronic
1010988148 6:82449780-82449802 AGAAGGAGCAAGAGAGGGAGAGG + Intergenic
1012075065 6:94672749-94672771 TGAAGGAGCCCCTGGGGGAGGGG + Intergenic
1012585934 6:100922566-100922588 TAAAGGAGAAACTGAGGCACAGG + Intergenic
1015263463 6:131264852-131264874 AGCAGGAGCAAGAGAGGGACTGG + Intronic
1017862562 6:158412764-158412786 TGAAGGACCATCTGAGAGGCAGG + Intronic
1019615560 7:1958083-1958105 TGCAGGGGACACTGAGGGACAGG + Intronic
1020817224 7:12920525-12920547 TGAAGGAGCAAGGGAGGCATGGG - Intergenic
1021886651 7:25146169-25146191 AGAGGGAGCAAATGAGAGACTGG + Intronic
1022203225 7:28137923-28137945 TGATGGGGAGACTGAGGGACAGG + Intronic
1023325241 7:39048058-39048080 TGAAAGAGCAATTGAAGGATTGG + Intronic
1023553287 7:41391894-41391916 TGAAGGAGCAGCAGAGGACCTGG - Intergenic
1024045225 7:45581129-45581151 TGAGGGAGAAACTGAGGCATGGG - Intronic
1024600163 7:50973622-50973644 TGATAGAGCCACAGAGGGACGGG - Intergenic
1024914001 7:54478109-54478131 TGAACTAGCACCTGATGGACTGG - Intergenic
1026179414 7:68025532-68025554 AGATGGAGCAGCTGAGGGAATGG + Intergenic
1028667600 7:93364634-93364656 TGTAGGAGCCTCTGAGTGACTGG + Intergenic
1029177772 7:98677076-98677098 AGAAGGGGAAACTGAGGCACAGG - Intergenic
1030515818 7:110536419-110536441 TGAAGGAGTAACTTAATGACTGG + Intergenic
1031858318 7:126948531-126948553 TGAAGGAGCCACTAAAAGACAGG + Intronic
1033408522 7:141094132-141094154 TGCAGGAGCAACTGCTGGATAGG + Intronic
1033415938 7:141161304-141161326 TGAGGGAGCCACAGAGGGAGGGG + Intronic
1033777456 7:144628628-144628650 TGAAGAAGCAACTTTGGAACTGG + Intronic
1034987169 7:155523543-155523565 TGAAGAGGCCACAGAGGGACCGG + Intronic
1036223109 8:6937401-6937423 TGAAGGGGCGACTGAGGTAATGG + Intronic
1036558668 8:9883476-9883498 TCAAGGAGCAACTGAAGTGCTGG + Intergenic
1037185911 8:16063413-16063435 TGAAGGAGCATATGAGGGTTCGG + Intergenic
1038171079 8:25132978-25133000 TAAAGGATAAACTGAGGGCCGGG + Intergenic
1038962647 8:32538207-32538229 GGAGGGAGCTACTGAGTGACAGG + Intronic
1040017989 8:42715894-42715916 TGGAGCAGGATCTGAGGGACTGG - Intronic
1042605436 8:70541421-70541443 AGCAGGAGCAGCTGAGAGACAGG - Intergenic
1043460111 8:80451237-80451259 TGAATGAGTAATTGAAGGACAGG - Intergenic
1043724488 8:83592044-83592066 TGAAGGAGAATCTGAGAAACAGG - Intergenic
1046097705 8:109580202-109580224 TGAAAGAACAACAGAGGGAGAGG - Intronic
1046925170 8:119779032-119779054 TATAGGAACAACTGAGGGAAAGG + Intronic
1047698862 8:127430417-127430439 AGAAGGAGAAATTGAGGGCCTGG + Intergenic
1048332009 8:133477154-133477176 AGAAGAAGAAACTGAGGGTCAGG - Intronic
1048473829 8:134725464-134725486 CGTAGGAGCAAGAGAGGGACGGG + Intergenic
1052181896 9:25539392-25539414 TGAATTAGCAACTTGGGGACTGG + Intergenic
1053121761 9:35552701-35552723 TTAAGAAGGAACTGAGGAACTGG + Intronic
1056762188 9:89423764-89423786 TGAGGGAGTAGCTGAGGGAGGGG - Intronic
1056762205 9:89423822-89423844 TGAGGGAGTAGCTGAGGGAGGGG - Intronic
1056762232 9:89423926-89423948 TGAGGGAGTAGCTGAGGGAAGGG - Intronic
1057769226 9:97952420-97952442 AGAAGAAGCAACTGAAGCACAGG + Intergenic
1057883128 9:98808110-98808132 TGATGGAGAAACTGAGGCCCGGG - Intronic
1058128343 9:101222152-101222174 TGAAGTAGCACCTGAGAAACTGG + Intronic
1058712540 9:107693279-107693301 TAAAGAAGAAACTGAGGGACAGG - Intergenic
1059123549 9:111662628-111662650 CAAAGGAGAAACTGAGGCACAGG - Intronic
1059623845 9:116039701-116039723 AGAAGGAGCAAACTAGGGACAGG - Intergenic
1060333109 9:122693991-122694013 AGAAGGTGCCTCTGAGGGACAGG - Intergenic
1061373826 9:130212651-130212673 TGAAGGAGAGAGGGAGGGACTGG + Intronic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1186490726 X:9970258-9970280 TGAAGGAGGAACAGAGGGAGGGG - Intergenic
1188726906 X:33596508-33596530 TGAGGGAGCAAGAGAGAGACAGG - Intergenic
1188974894 X:36661524-36661546 AGAAGGGACAACTCAGGGACAGG + Intergenic
1189060822 X:37751899-37751921 AGCAGGAGCAAAAGAGGGACGGG + Intronic
1189393434 X:40598193-40598215 AGATGGAGAAACTGAAGGACAGG - Intronic
1189471923 X:41321525-41321547 TGAAACAGTAACAGAGGGACGGG + Intergenic
1190395317 X:49976207-49976229 TGAAGGAGAAACTCTGGGAATGG + Intronic
1191208145 X:57855520-57855542 GGAAAGAGCACCTGAGGGAAGGG + Intergenic
1191222399 X:58003279-58003301 GGATGGAGCAACTGGGGGAAGGG + Intergenic
1192999575 X:76550050-76550072 GGAAGGAGCACCTGGGGGAACGG - Intergenic
1193466663 X:81855877-81855899 TGAAAGAGCAACTTAGGACCTGG + Intergenic
1195527594 X:105909489-105909511 TGAAGGATCACCTCAGGCACAGG + Exonic
1196593284 X:117513904-117513926 GGAAAGAGCAAATGAGGGAGAGG + Intergenic
1196918129 X:120560591-120560613 AGCAGCAGCAGCTGAGGGACTGG + Exonic
1197841948 X:130757617-130757639 TGAATGACCACCTAAGGGACAGG - Intronic
1198450983 X:136767163-136767185 TGAGGGAGCAGCTGGAGGACAGG - Intronic
1198766089 X:140080484-140080506 TGAGGGGGTTACTGAGGGACAGG + Intergenic
1199164291 X:144651807-144651829 TGAAGGAGTGAGTGAGTGACTGG + Intergenic
1200048772 X:153417307-153417329 TGCAGGACCATCTGAGGGCCAGG + Intergenic
1201705148 Y:16928528-16928550 TGACAGAGCACCTGAGGGAATGG + Intergenic
1201922229 Y:19245842-19245864 GGATGGAGCACCTGAGGGAAGGG + Intergenic