ID: 920532635

View in Genome Browser
Species Human (GRCh38)
Location 1:206715045-206715067
Sequence GCATCCTGGGATGTAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920532629_920532635 15 Left 920532629 1:206715007-206715029 CCAGCAGTGGTTCTGGAATCAAC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 138
920532628_920532635 21 Left 920532628 1:206715001-206715023 CCACTGCCAGCAGTGGTTCTGGA 0: 1
1: 0
2: 2
3: 26
4: 265
Right 920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 138
920532630_920532635 -7 Left 920532630 1:206715029-206715051 CCTGTACTTTCCTTCTGCATCCT 0: 1
1: 0
2: 2
3: 35
4: 345
Right 920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 138
920532626_920532635 27 Left 920532626 1:206714995-206715017 CCTGAACCACTGCCAGCAGTGGT 0: 1
1: 0
2: 3
3: 10
4: 156
Right 920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG 0: 1
1: 0
2: 2
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920532635 Original CRISPR GCATCCTGGGATGTAATTCT GGG Intronic
900862204 1:5241684-5241706 TCTACCTGGGATGTAATTTTCGG + Intergenic
901817821 1:11805163-11805185 GCACCCTGGGTTGTAACTGTGGG + Intronic
907610633 1:55866465-55866487 GCATCTTGGCATCTGATTCTTGG + Intergenic
909417852 1:75427643-75427665 ACAGCCTGGGATTTAATCCTAGG - Intronic
912026416 1:105179946-105179968 ACATGCTGGGATGGAATTCCTGG - Intergenic
913460492 1:119080916-119080938 GCATACTGTGATGGAATTGTAGG - Intronic
914892379 1:151637666-151637688 GCCTCCTGGGATTTAATTTAGGG - Intronic
915119030 1:153617128-153617150 GCTCTCTGGGATGTCATTCTGGG - Intergenic
915381288 1:155443141-155443163 GAATCCTGGGATCAAAATCTTGG + Intronic
917605940 1:176629537-176629559 TTAAGCTGGGATGTAATTCTGGG + Intronic
920532635 1:206715045-206715067 GCATCCTGGGATGTAATTCTGGG + Intronic
923442565 1:234035065-234035087 TCATCCTGGCATCTCATTCTGGG + Intronic
924033018 1:239906471-239906493 GCCTCCAGGGCTGTACTTCTGGG - Intronic
924491537 1:244542787-244542809 GCATGCTGGGATCTAAGGCTAGG - Intronic
1064367665 10:14722582-14722604 GAATCTTGTCATGTAATTCTTGG + Intronic
1069539413 10:69282407-69282429 GCATCCTTGGATGTTACTCCAGG - Intronic
1070161149 10:73867475-73867497 GCTTCCTGGGATGTTTTACTTGG - Intronic
1071095979 10:81975444-81975466 TCATCTTAGGATATAATTCTGGG - Intronic
1074296090 10:112191047-112191069 GCATGCTGGGACCTCATTCTAGG + Intronic
1074473243 10:113746190-113746212 GCATCCTGGGTAGTGATTCCTGG - Intergenic
1074739093 10:116467038-116467060 GGATCCTGGCATTTACTTCTAGG + Intronic
1074989741 10:118693150-118693172 GATTCCTGGGCTGTAATCCTTGG - Intronic
1075001986 10:118805410-118805432 TGATCCTGGGCTGTGATTCTGGG - Intergenic
1078354942 11:10626279-10626301 GCATCCTGGGTTGGACTTCTCGG + Exonic
1079709493 11:23663965-23663987 GCATTTTGTGATGTAATTGTGGG + Intergenic
1079882150 11:25942058-25942080 GCATGATGGGATGGGATTCTGGG - Intergenic
1080617469 11:33957286-33957308 GCTCCCTGGGATGTAATTGCAGG - Intergenic
1080675694 11:34424374-34424396 GCCTCTTTGGATGTAATTCCTGG - Intergenic
1082293542 11:50411764-50411786 GCAACTTAGGATGTAAGTCTGGG + Intergenic
1083113271 11:60432950-60432972 GCATAATGGGTTATAATTCTAGG - Intronic
1083143279 11:60739083-60739105 TCATACTAGGATGGAATTCTGGG - Intronic
1086562102 11:88179444-88179466 GCCTTCTGGGATATCATTCTTGG - Intergenic
1087429154 11:98029578-98029600 TCAACCTGGGATTGAATTCTGGG + Intergenic
1087809578 11:102595870-102595892 TAATCCTGTGAAGTAATTCTGGG - Intronic
1089833662 11:121350999-121351021 GTATCCTGGGTTGTTAATCTTGG + Intergenic
1091856662 12:3746060-3746082 CCAGCCTGGGCTGTACTTCTAGG + Intronic
1091950762 12:4591223-4591245 GGATCCTGGGTTTTAATGCTAGG - Exonic
1094729179 12:33155159-33155181 GCTACCTGGGATGGAATCCTGGG + Intergenic
1095347427 12:41168099-41168121 GCAACCTGAGATTTAAATCTGGG - Intergenic
1096560352 12:52431638-52431660 GCATCCTGCGCTGTCATTCCAGG - Exonic
1098086346 12:66848462-66848484 CCATGCTGGGTTGTAATTGTTGG - Intergenic
1099827780 12:87800290-87800312 CCATCCTAGGCTGTACTTCTAGG + Intergenic
1105828579 13:24144182-24144204 GCCTCTTGGGATGTAACTGTAGG + Intronic
1109437111 13:62317725-62317747 GCTTCAAGGGTTGTAATTCTAGG - Intergenic
1110600085 13:77363139-77363161 GAATCCTGGGATCTGACTCTAGG + Intergenic
1113335177 13:109370417-109370439 TCATCCTGGGAAGTGATTTTTGG - Intergenic
1116237211 14:42295208-42295230 GAATCCTGGGATGAAAGGCTGGG - Intergenic
1118972928 14:70652723-70652745 GCATTTGGGGATGTGATTCTGGG + Intronic
1123152685 14:106198252-106198274 GTAGCCTGGGATGTAATTCCGGG + Intergenic
1123907994 15:24939348-24939370 GCATCTTTGGATGTGCTTCTTGG + Intronic
1127847048 15:62879346-62879368 GCTTCCTTGTATGTGATTCTTGG + Intergenic
1135548347 16:23380333-23380355 GCTTCCTGGGAGGTGATTCTTGG - Intronic
1137376419 16:47955842-47955864 TCATGCTGGGATGGAAATCTGGG - Intergenic
1139126403 16:64083321-64083343 GCATCCTGGAATTTGATTTTAGG + Intergenic
1140773660 16:78229558-78229580 GCAACCTCAGATGTATTTCTAGG + Intronic
1144586527 17:16491216-16491238 GCATCCTGGATTGTAGTTCAAGG - Intronic
1147131427 17:38411863-38411885 GAAACCTGGGATGTAAGCCTAGG - Intergenic
1148660979 17:49332555-49332577 GAATCCTTGGATGGATTTCTGGG - Intronic
1149784926 17:59426553-59426575 GCATCCTTGGAATTGATTCTGGG + Intergenic
1151228048 17:72661291-72661313 TCAGCCTGGGGTGTAGTTCTGGG + Intronic
1156626569 18:38916910-38916932 TCATCCTGGGCTGTAATTTTTGG + Intergenic
1156874665 18:41994567-41994589 GCATACTTGGATGTATTTCTGGG - Intronic
1157109694 18:44808995-44809017 GAATCCTGAAAGGTAATTCTTGG + Intronic
1161837443 19:6657553-6657575 GAAACCTGGAATGTAATTCAGGG + Intergenic
1163929001 19:20370718-20370740 GCAACCTGGGATGTAACTCAGGG - Intergenic
1164796689 19:31039487-31039509 ACAGCCTGAGATGGAATTCTGGG + Intergenic
1165252745 19:34553849-34553871 AAAACCTGGGATGTAATTCAGGG + Intergenic
934916033 2:98301750-98301772 GCCTTCTGGGTAGTAATTCTTGG + Intronic
935028891 2:99303382-99303404 GCATCCTGGGAGGTTCTCCTGGG + Intronic
936007112 2:108899298-108899320 GCAACCTGGTATGCAACTCTGGG - Intronic
938194245 2:129312773-129312795 TCATCCTGGGATGAAAACCTAGG + Intergenic
940322936 2:152396445-152396467 GCAGCCTTGGATTTCATTCTAGG - Intronic
940828630 2:158442577-158442599 TCATCCTGGGATGCAAATGTTGG - Intronic
942908276 2:181208981-181209003 GAATCATGTGATGTAATGCTGGG - Intergenic
947127360 2:226883585-226883607 TCATGCTGGGATATAATTGTGGG + Intronic
948447044 2:238040863-238040885 GCATCCAGGGAAATCATTCTAGG + Intronic
1177089617 21:16751182-16751204 GCATACTAGGATTTGATTCTAGG + Intergenic
1177107915 21:16983681-16983703 GCATCCTGCTAGATAATTCTAGG + Intergenic
1183375457 22:37462216-37462238 GCACCCTGGGATCTGATACTGGG - Intergenic
950059474 3:10058051-10058073 TCTTCCAGGGATGTACTTCTTGG + Intronic
950301023 3:11878896-11878918 TCTTCCAGGGATGTACTTCTTGG + Intergenic
953002508 3:38948741-38948763 CCAGCCTGGGTGGTAATTCTAGG - Intronic
954137239 3:48587650-48587672 GCATCATGGGAGGTCATGCTGGG + Intronic
956555460 3:70517275-70517297 GCATTCTGGCTTGTAATTTTGGG + Intergenic
956651190 3:71506133-71506155 GCAACCTGGGATATATTTGTTGG - Intronic
959064232 3:101640876-101640898 GAAACCTGGAATGTAATTCAGGG - Intergenic
965103802 3:164335104-164335126 GCAACCTGGGATGTAATTCCGGG + Intergenic
966345732 3:178977597-178977619 ACATCCTTGTATGTAAATCTTGG + Intergenic
966548453 3:181178448-181178470 ACATACTGGGATGTACTTTTTGG + Intergenic
967354996 3:188559158-188559180 GCATCCTAGACTGGAATTCTAGG + Intronic
969168660 4:5340590-5340612 CCATCTTGGGATGCACTTCTAGG - Intronic
970908609 4:21247481-21247503 GCATATTGGGATTTATTTCTAGG - Intronic
972151558 4:36097692-36097714 GCATCCTAGGATTTATCTCTGGG - Intronic
977865946 4:102027821-102027843 GAATCCTGGAAAGTAATTATCGG + Intronic
986236699 5:5917240-5917262 TCATCCTTGTATGTAATACTTGG + Intergenic
986861799 5:11935453-11935475 GCATCCTGGAATATGCTTCTGGG + Intergenic
989364571 5:40641394-40641416 GAATCCTGTGATGTTATTCAAGG - Intergenic
992545949 5:77813898-77813920 GTCTCCTGGTATGTAAATCTTGG + Intronic
992977097 5:82131853-82131875 GCATCCTGGCATCTGCTTCTGGG + Intronic
993318654 5:86444143-86444165 GCATCCAGTGGAGTAATTCTTGG + Intergenic
995652884 5:114391007-114391029 GCATCCTGGTGGATAATTCTAGG + Intronic
996756206 5:126937980-126938002 GAATCCTGGTATTTAATGCTTGG + Intronic
997631392 5:135371722-135371744 CCACACTGGGATGTCATTCTAGG + Intronic
997717981 5:136056341-136056363 GCCTCCAGGGATATGATTCTGGG - Intronic
998513593 5:142733846-142733868 ACATCCTGAAATGTAATCCTAGG + Intergenic
999343255 5:150792066-150792088 ACATCCTTGTATGTATTTCTTGG + Intronic
1005500974 6:26428979-26429001 GGATCCTGGGATGTAAACCACGG - Intergenic
1010772493 6:79847559-79847581 GCATCTTGGGATGTAAATGAGGG + Intergenic
1011246340 6:85324984-85325006 GAATTCTGGGATAAAATTCTAGG - Intergenic
1011356902 6:86480503-86480525 GCTTCCTGGGATGTAGTTCTGGG - Intergenic
1020536649 7:9406003-9406025 GAATCTTAGAATGTAATTCTAGG - Intergenic
1020895398 7:13932918-13932940 CCATCCTGTGATTTAACTCTAGG + Intronic
1020951668 7:14686771-14686793 GCTTCCTGGGCGATAATTCTTGG + Intronic
1027761041 7:82279032-82279054 GCTTCCTTGGATGAAATGCTGGG - Intronic
1027781140 7:82521821-82521843 GCTTCCTGGAAGGTATTTCTAGG + Intergenic
1030011520 7:105173241-105173263 GCATGGTGGCATGTACTTCTTGG - Intronic
1030961300 7:115926914-115926936 GTTTCCTGGGATGAATTTCTTGG - Intergenic
1033154390 7:138944287-138944309 GCATCCTTCGATGTACTTCTTGG - Intronic
1035138459 7:156731945-156731967 TCATTCTGGTATGTAACTCTTGG - Intronic
1035395996 7:158534963-158534985 GCATACTGAGGTGTAGTTCTGGG - Intronic
1036590852 8:10166830-10166852 GCTTCCAGGGTTGCAATTCTGGG - Intronic
1040558282 8:48500300-48500322 GGATCTTGGGATGGAATCCTGGG - Intergenic
1051803514 9:20964453-20964475 CCATCTTGAGATGTAATACTGGG - Intronic
1052998314 9:34563584-34563606 TCATCTTGGGATCTGATTCTAGG + Intronic
1058788443 9:108416036-108416058 GCATTCTGGGATGGAAGTTTGGG + Intergenic
1061702027 9:132423266-132423288 GCATCCTGTGAGGTGATCCTGGG - Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1189864689 X:45314173-45314195 GCATCTTGTCATATAATTCTTGG + Intergenic
1193124187 X:77853947-77853969 GCTTCCATGGATATAATTCTAGG + Exonic
1193406586 X:81108417-81108439 GCATGGTGGGATCTACTTCTGGG - Intergenic
1194322519 X:92468049-92468071 GCTTCCTGGGAAGTAATGATTGG - Intronic
1200572077 Y:4844091-4844113 GGATCCTGGGAGGCATTTCTAGG + Intergenic
1200630674 Y:5581525-5581547 GCTTCCTGGGAAGTAATGATTGG - Intronic
1200701723 Y:6408171-6408193 TCATCCTGGGATTTCATTCTGGG - Intergenic
1200709509 Y:6470896-6470918 TCATCTTGGGATTTCATTCTGGG - Intergenic
1200846930 Y:7839795-7839817 GTAGCCTGGGATATAATTCCAGG - Intergenic
1200927786 Y:8670024-8670046 TCATCTTGGGATTTGATTCTGGG + Intergenic
1200963389 Y:9015126-9015148 TCATCTTGGGATTTTATTCTGGG - Intergenic
1200984232 Y:9289185-9289207 TCATCCTGGGATTTCATCCTGGG - Intergenic
1200985202 Y:9296257-9296279 CCATCTTGGGATTTCATTCTGGG - Intergenic
1201024603 Y:9693812-9693834 TCATCTTGGGATTTCATTCTGGG + Intergenic
1201032388 Y:9756527-9756549 TCATCCTGGGATTTCATTCTGGG + Intergenic
1202125246 Y:21563928-21563950 TCATCTTGGGATTTCATTCTGGG + Intergenic
1202125928 Y:21568895-21568917 TCATCTTGGGATGTCATCCTGGG + Intergenic
1202130143 Y:21601907-21601929 TCATCTTGGGATTTTATTCTGGG - Intergenic
1202149712 Y:21833659-21833681 TCATCTTGGGATTTCATTCTGGG + Intergenic
1202153076 Y:21860496-21860518 TCATCTTGGGATGTCATCCTGGG - Intergenic
1202153762 Y:21865464-21865486 TCATCTTGGGATTTCATTCTGGG - Intergenic
1202183530 Y:22159466-22159488 TCATCTTGGGATTTCATTCTGGG - Intergenic
1202207829 Y:22426935-22426957 TCATCTTGGGATTTCATTCTGGG + Intergenic
1202338237 Y:23832384-23832406 AAATCCTGGGATGTAATTCAAGG - Intergenic
1202532529 Y:25837687-25837709 AAATCCTGGGATGTAATTCAAGG + Intergenic