ID: 920533701

View in Genome Browser
Species Human (GRCh38)
Location 1:206723557-206723579
Sequence ACATGAAGACAAGACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920533701_920533709 12 Left 920533701 1:206723557-206723579 CCTTCCCAGTCTTGTCTTCATGT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 920533709 1:206723592-206723614 CGAGTGGCACATCAGGCCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108
920533701_920533710 18 Left 920533701 1:206723557-206723579 CCTTCCCAGTCTTGTCTTCATGT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 920533710 1:206723598-206723620 GCACATCAGGCCCTGGGTGCCGG 0: 1
1: 0
2: 1
3: 20
4: 268
920533701_920533707 5 Left 920533701 1:206723557-206723579 CCTTCCCAGTCTTGTCTTCATGT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 920533707 1:206723585-206723607 TTGCTGACGAGTGGCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
920533701_920533704 -4 Left 920533701 1:206723557-206723579 CCTTCCCAGTCTTGTCTTCATGT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 920533704 1:206723576-206723598 ATGTCCACCTTGCTGACGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 60
920533701_920533708 11 Left 920533701 1:206723557-206723579 CCTTCCCAGTCTTGTCTTCATGT 0: 1
1: 0
2: 2
3: 23
4: 290
Right 920533708 1:206723591-206723613 ACGAGTGGCACATCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920533701 Original CRISPR ACATGAAGACAAGACTGGGA AGG (reversed) Intronic
900639115 1:3680478-3680500 CCAAGAGGACAAGCCTGGGAAGG - Intronic
900884837 1:5407839-5407861 ACCTGAAGGCAAGCCTAGGATGG + Intergenic
901988330 1:13092789-13092811 AAAGGAAGACAAGACTTGAAAGG - Intergenic
901993482 1:13133978-13134000 AAAGGAAGACAAGACTTGAAAGG + Intergenic
902705735 1:18202947-18202969 ACCCAAAGCCAAGACTGGGATGG - Intronic
903264239 1:22147429-22147451 ACATGTAGACCAGAGTGGCACGG - Intergenic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
903802019 1:25976096-25976118 AAGTGAAATCAAGACTGGGAAGG - Intronic
904153057 1:28459057-28459079 ACATGAAAAGAAGAGAGGGAAGG - Intronic
905327661 1:37169142-37169164 AAATGAAGGCAAGCCTGTGATGG + Intergenic
905607137 1:39311932-39311954 ACCTGAAGAGAAGAGTGAGAGGG + Intronic
906213386 1:44024633-44024655 AAATGAATACCAAACTGGGATGG + Intronic
907315731 1:53570490-53570512 ACACTAAAACAAGACTGGGGTGG + Intronic
911673271 1:100631184-100631206 AGATGAAGACAAACCAGGGAGGG + Intergenic
913454057 1:119013010-119013032 ACATGTAGACAGGATTTGGATGG - Intergenic
913465239 1:119134164-119134186 ACATGAAGATAAGAATGTGAAGG + Intronic
915636463 1:157190291-157190313 GTGTGAAGACAAGACTGAGAAGG + Intergenic
916243080 1:162658965-162658987 ACATGAAGAAAGAACTGGGGAGG + Intronic
916304790 1:163318219-163318241 AAAGGGAAACAAGACTGGGAAGG + Intronic
917750838 1:178051936-178051958 AGCTGAGGACAAGACTGAGAAGG - Intergenic
918342222 1:183577434-183577456 CCTTGAAGAAAAGACTGAGATGG - Intronic
919251307 1:195059816-195059838 ACATAAAGGCAAGACAGGGAAGG + Intergenic
919535856 1:198787029-198787051 AGATGAAGAGAAGACTGGTTTGG + Intergenic
920533701 1:206723557-206723579 ACATGAAGACAAGACTGGGAAGG - Intronic
920570432 1:207012644-207012666 ACATGAAGACAGATCTGAGAAGG + Intronic
920842018 1:209563076-209563098 AAAGGAAGAAAAGACAGGGAAGG + Intergenic
921007519 1:211109304-211109326 AACTGAAGACTAGACTGGGAAGG + Intronic
921409476 1:214819750-214819772 ACTTGAGGGAAAGACTGGGAGGG - Intergenic
921441915 1:215197706-215197728 AAATGAAAACAAGACCGGGTGGG + Intronic
921551126 1:216536894-216536916 ACATGAATACAAAACTATGAGGG + Intronic
922216367 1:223523304-223523326 ATATGAATACAAGACTTAGAAGG - Intergenic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
1064369746 10:14741064-14741086 ACAAGCAGACAGCACTGGGATGG + Intronic
1064714188 10:18159037-18159059 AAAAGAAGACAAAACAGGGAGGG - Intronic
1064849246 10:19692280-19692302 AGATGTAGACAAGGCTGGAAAGG + Exonic
1065145972 10:22768470-22768492 AGATGAAGTCAAGTCTGGGCTGG + Intergenic
1065236514 10:23657954-23657976 CCAGGGAGACAAGACTAGGAAGG - Intergenic
1067359255 10:45562143-45562165 ACATAAAGAATAGACTGAGATGG + Intronic
1067541385 10:47157094-47157116 ACACGAAATCAAGCCTGGGATGG - Intergenic
1068989713 10:63138031-63138053 ATATGAAGGCAAGATTGGGCTGG + Intronic
1069047459 10:63758330-63758352 AGATGAGGACAACACTGTGAAGG + Intergenic
1069360373 10:67634554-67634576 ACTTGAAGACAGCACTGTGATGG - Intronic
1070505794 10:77111607-77111629 AAAGGAAGACAGGCCTGGGATGG - Intronic
1070647412 10:78211341-78211363 ACAGATAGAAAAGACTGGGAGGG - Intergenic
1070796346 10:79219127-79219149 TCAGGAAGACAAGAGTGGAATGG + Intronic
1071172419 10:82882089-82882111 ACATGCAGAAAAGACGGGCATGG - Intronic
1071854145 10:89606513-89606535 ACATGAAAAGAAAAGTGGGAAGG - Intronic
1073645540 10:105298397-105298419 ACATGAAGAAGAGACAGAGAAGG + Intergenic
1074962849 10:118463661-118463683 ACATGATGCCCAGAGTGGGACGG - Intergenic
1075075456 10:119347590-119347612 ACCTGGAGACAAGGCCGGGACGG + Intronic
1076084080 10:127609996-127610018 GCATGAAGGCAAGACTGTCATGG - Intergenic
1079223969 11:18588949-18588971 TTATGAAGAGAAGACTAGGAAGG + Intergenic
1079260278 11:18871935-18871957 ACATGAAGACATGGCTGGGAAGG - Intergenic
1080299259 11:30766506-30766528 GCATGGAGAGAAGACTGGAAAGG - Intergenic
1080553315 11:33393226-33393248 TCATGCAGACAAGGCTGGGAAGG - Intergenic
1080624029 11:34012467-34012489 ACAAGAAGATGAGACAGGGATGG - Intergenic
1083863231 11:65437610-65437632 GCATGAAGACATCACAGGGAAGG - Intergenic
1084225749 11:67713804-67713826 ACATGAAGGTGAGACTGGGCAGG - Intergenic
1084263570 11:67993661-67993683 ACATGAAGGTGAGACTGGGCAGG - Exonic
1084669953 11:70599992-70600014 ACAGGAAGACAACATTGTGAAGG + Intronic
1084809836 11:71605460-71605482 ACATGAAGGTGAGACTGGGCAGG + Intergenic
1088338725 11:108738899-108738921 ACATGGAGACAGGCCTGGGTTGG + Intronic
1089091043 11:115876343-115876365 AGATGAAAACAAGACAAGGATGG - Intergenic
1089512904 11:119011766-119011788 ATATGTGGACAGGACTGGGAGGG + Intronic
1089965739 11:122654020-122654042 GCAAAAAGACAAGACTGGGCTGG - Intergenic
1090465451 11:126929326-126929348 ACAGGGAGTCAAGACAGGGAAGG + Intronic
1091113366 11:132992175-132992197 ACTTGAAGCCAAGCCTTGGAGGG - Intronic
1091533384 12:1382053-1382075 ACAGGAAAACAAGACAGGAATGG - Intronic
1092590028 12:9944608-9944630 ACAGGAAGACAAGAAGAGGAAGG - Intergenic
1092976969 12:13754982-13755004 ATAGGAGGACAAGACTGAGAGGG - Intronic
1093050311 12:14496963-14496985 ACATGAAGAAAAATCTGGAAAGG - Intronic
1093766588 12:22970371-22970393 AAATGAAGACAAAACTGGGCTGG - Intergenic
1094601761 12:31915205-31915227 CCATTCAGACAAGACTGGGCAGG - Intergenic
1094667431 12:32534932-32534954 TCACCAAAACAAGACTGGGATGG - Intronic
1095555220 12:43494632-43494654 ACAGTAAGTTAAGACTGGGATGG + Intronic
1095886052 12:47189704-47189726 AAATGAAGACAAGTGTGAGATGG - Intronic
1096740032 12:53686360-53686382 CCATGAAGAACAGAATGGGAAGG + Intergenic
1098021341 12:66159410-66159432 ACATGAAGGCTTGACTGGGCTGG - Intronic
1098508101 12:71278477-71278499 ACATGACTAGAAGACTGAGAAGG - Intronic
1099206805 12:79737853-79737875 AGATGAAAGCAAGACTGAGAAGG - Intergenic
1099891132 12:88589609-88589631 ACTTGAAGACAAGAGTGGGAGGG + Intergenic
1100488322 12:95053262-95053284 AAATGAAGACAAGCCGGGCACGG - Intronic
1100918154 12:99451496-99451518 GCATGAAGAAATGGCTGGGAAGG + Intronic
1101194023 12:102364252-102364274 ACACAAAGACAAAACAGGGATGG + Intergenic
1102546094 12:113656857-113656879 AAATGAGGACAAGCCTGGGCTGG + Intergenic
1103099176 12:118157417-118157439 ACATGAGAACAAGACTGGAGGGG - Intronic
1103172799 12:118836078-118836100 ACAAGAAGGCAGGCCTGGGATGG - Intergenic
1106503752 13:30354086-30354108 ACCTGAAGGCAAGAATGGGGGGG + Intergenic
1107739856 13:43438263-43438285 ACAGGAAGACAAGCCTGAGGAGG + Intronic
1108081511 13:46741937-46741959 AACTGAAGACATGACAGGGATGG - Exonic
1108352364 13:49598960-49598982 AGATGAAGCCAAGATTGGAATGG + Intergenic
1108507496 13:51125805-51125827 AGATGAAGAGAAAACTGTGAAGG - Intergenic
1110497449 13:76185705-76185727 GAATGAAGGCCAGACTGGGAAGG - Intergenic
1110687083 13:78388067-78388089 AGATGAAGACATGACTCAGATGG + Intergenic
1112821990 13:103348395-103348417 AGATGAACACATCACTGGGAGGG - Intergenic
1114728436 14:24964482-24964504 CCATGAAGAAGAGACAGGGAGGG - Intronic
1115176816 14:30572284-30572306 AAAAGAAGACAAAACTGTGAAGG - Intronic
1115195983 14:30799798-30799820 ACCTGAAGACTTGACTGGGCTGG - Intergenic
1116612806 14:47099534-47099556 ATATGAAGAAAAAACTGGCAGGG - Intronic
1117226552 14:53666625-53666647 AATTGAAGATGAGACTGGGAAGG - Intergenic
1117586746 14:57214931-57214953 ACATGAAGAGAAGAATCGGCTGG + Intronic
1118008687 14:61588430-61588452 AAATGAAGACAAGACGGCTAAGG + Intronic
1119602812 14:75988499-75988521 AAAAGATGACAAGCCTGGGAAGG - Intronic
1124495153 15:30181772-30181794 TCATAAAGACAGGACTGAGATGG - Intergenic
1124748414 15:32356873-32356895 TCATAAAGACAGGACTGAGATGG + Intergenic
1126083525 15:44988719-44988741 TCATCATGACAAGACTGTGATGG - Intergenic
1127623482 15:60757373-60757395 AGGGGAAGACAGGACTGGGAAGG - Intronic
1127973344 15:63979270-63979292 TCTTGAAGGCAGGACTGGGAAGG - Intronic
1130084271 15:80764199-80764221 AGAAGAAGACAAGACAGTGATGG + Intergenic
1131204469 15:90430233-90430255 AGATTCAGACAGGACTGGGATGG - Intronic
1131267054 15:90922269-90922291 ACCTAAAGACAAGAGTGAGAGGG + Exonic
1131358393 15:91766561-91766583 ACATGAGCACAAGAGTGGCAGGG - Intergenic
1134329858 16:13240925-13240947 AAATGAAGAGAATACTGGGAGGG + Intergenic
1134480517 16:14614951-14614973 AGAGGAAGACAAGAGTGAGAGGG + Intronic
1137500213 16:49005212-49005234 ACATGGAGAAAACTCTGGGAAGG - Intergenic
1138267377 16:55669500-55669522 ACACGGATCCAAGACTGGGAGGG + Intronic
1139796597 16:69487792-69487814 AGAAGAAGACAAGAATGGGAGGG - Intergenic
1139922630 16:70469476-70469498 AAAGGAAGACAAGAAGGGGAAGG - Intronic
1141008003 16:80371327-80371349 ACGGGAAAACAGGACTGGGAAGG + Intergenic
1141322908 16:83028482-83028504 ACATGAAAACAGGACTGAGCAGG + Intronic
1141504021 16:84462921-84462943 ACCTCCAGGCAAGACTGGGATGG + Intronic
1142315908 16:89344846-89344868 AGATGAAGAGAAAACTTGGAAGG - Intronic
1142907808 17:3057448-3057470 ACTTGGGGAGAAGACTGGGAGGG - Intergenic
1142926755 17:3246815-3246837 ACTTGGGGAGAAGACTGGGAGGG + Intergenic
1144071330 17:11673815-11673837 TGATGAAGAAAAGCCTGGGAAGG - Intronic
1146320940 17:31845933-31845955 ACATGATGACATGACTGGGGAGG - Intergenic
1146579076 17:34021003-34021025 ACATGGAGACAGGAATGGGTGGG - Intronic
1146903050 17:36600673-36600695 ACAAGAAGCCAAGACTGGGCTGG - Exonic
1147428747 17:40358555-40358577 ACAAGAACACAGGATTGGGATGG + Intergenic
1147494402 17:40902175-40902197 ACCTGGAGACAAGGTTGGGAGGG - Intergenic
1147807501 17:43142208-43142230 ACAAGAAGCCAAGACTAGGCTGG - Intergenic
1149567748 17:57651982-57652004 ACACAAAGACAGGAGTGGGAAGG - Intronic
1150724435 17:67640194-67640216 ACTTGATGACATCACTGGGATGG + Intronic
1152430054 17:80243873-80243895 CCATGAAGGCCAGGCTGGGAGGG + Intronic
1152936782 17:83143405-83143427 ACATGAAGACGAGCATGGAAGGG + Intergenic
1155673150 18:28396410-28396432 AAATGTAGAGAAGACTGGGCAGG + Intergenic
1155725926 18:29083068-29083090 ACTTGAGGAGAAGAGTGGGAGGG + Intergenic
1156535557 18:37861368-37861390 ACAAGAAGATAAGTCAGGGAAGG - Intergenic
1157351063 18:46886115-46886137 ACATGGACAGAAGACTGGGGGGG - Intronic
1157362600 18:47033449-47033471 ACAGGAAAACAAAACTTGGAGGG - Exonic
1160123794 18:76152676-76152698 ACATGAAGACCAGCCTCAGAGGG + Intergenic
1160200612 18:76792593-76792615 ACAGGAAGAGAAGGTTGGGATGG + Intergenic
1160200632 18:76792672-76792694 ACAGGAAGAGAAGGTTGGGATGG + Intergenic
1160200652 18:76792751-76792773 ACAGGAAGAGAAGGTTGGGATGG + Intergenic
1160200691 18:76792909-76792931 ACAGGAAGAGAAGGTTGGGATGG + Intergenic
1160200731 18:76793068-76793090 ACAGGAGGAGAAGGCTGGGATGG + Intergenic
1162495301 19:11020031-11020053 ACAGGAGGACAAGACTGGTCTGG - Intronic
1164287726 19:23836145-23836167 ACATGGGGAGAAGAGTGGGAAGG - Intergenic
1165027492 19:32972273-32972295 ACATGATCTCTAGACTGGGACGG + Exonic
1166412061 19:42561904-42561926 ACAAGAAGGCAGGACTGAGAGGG - Intergenic
1167411415 19:49346358-49346380 ACATAAATACAGGACTTGGACGG + Intronic
1168567972 19:57440461-57440483 ACCAGAAAACAGGACTGGGAAGG + Intronic
925827799 2:7867111-7867133 ACATGAACACCTGCCTGGGAGGG + Intergenic
927913036 2:26914985-26915007 AGATTAAGACAAGACCAGGAAGG - Intronic
930380264 2:50619033-50619055 ACATAAAGAGAAGACAGGGAAGG + Intronic
930898860 2:56479994-56480016 ACATGCAGAAAAGAATGAGAGGG - Intergenic
931106444 2:59061815-59061837 ACATGTAAACAAGTCTGGAAGGG - Intergenic
932050534 2:68393681-68393703 GCATGAAGACAACTCTGGGTAGG + Intronic
932321959 2:70828953-70828975 ACATGAATACAGGCCTGGCATGG - Intergenic
933474795 2:82776549-82776571 ACTTGAGGACAAGAGTGGGAGGG + Intergenic
934984531 2:98874718-98874740 AGATGATGACAATACTGGGCTGG - Intronic
935514815 2:104022732-104022754 ACATGAAGACTTGAAGGGGAGGG + Intergenic
935785632 2:106546054-106546076 GTGTGAAGACAGGACTGGGATGG - Intergenic
938052844 2:128190881-128190903 ACATGAAGACAGAACTGGTGTGG - Exonic
940205140 2:151194120-151194142 GCATTAAGACAATAATGGGATGG - Intergenic
941343258 2:164334880-164334902 AAAAGAAGACAAGAATGGAATGG + Intergenic
943428401 2:187766030-187766052 AAATGTAGACAAGGCTGGGCGGG + Intergenic
944651184 2:201831787-201831809 AAATGAAAACATGACAGGGAAGG - Intronic
945755731 2:213844079-213844101 ACATGAGGACAATAATGAGAAGG - Intronic
945862098 2:215135842-215135864 ACTTGAAGACACGTGTGGGAAGG - Intronic
945909687 2:215634904-215634926 GCATGAAGACAATAATTGGAGGG - Intergenic
946179368 2:217940632-217940654 AGATGAAACCAAGACTGTGAGGG + Intronic
948627946 2:239280710-239280732 GCATGGGGACAAGACTTGGATGG - Intronic
1168984595 20:2037321-2037343 AAATGAAGACAAGGCTGGACAGG + Intergenic
1171073215 20:22095407-22095429 AAATGAATGCAAGACTGGAAAGG - Intergenic
1171363030 20:24603577-24603599 ACATGGACACACGCCTGGGATGG + Intronic
1172234321 20:33359766-33359788 ATATGAGAACAAGACAGGGAAGG + Intronic
1172342624 20:34170338-34170360 AGATACAGAGAAGACTGGGAAGG - Intergenic
1172689194 20:36778790-36778812 ACAGGATCACAAGACTGGGAAGG + Exonic
1172763174 20:37336342-37336364 TAAGGAAGGCAAGACTGGGAGGG + Intergenic
1174116573 20:48230554-48230576 ACATCCAGACAAGCCTGGCAGGG - Intergenic
1174520110 20:51122786-51122808 GCAAGAAGACAATACAGGGAAGG + Intergenic
1174653567 20:52151076-52151098 AAATGAAAACAACAGTGGGATGG + Intronic
1175777096 20:61660216-61660238 ACAAGAAGGAAAGACGGGGAGGG - Intronic
1175870092 20:62205149-62205171 ACATGAAGACAGGGCAGGGACGG - Intergenic
1178904723 21:36627108-36627130 CCATGATGCCAAGACTGGGCAGG + Intergenic
1179174250 21:38995911-38995933 ACATGAAGACATGCCAAGGAGGG + Intergenic
1179311074 21:40196619-40196641 AAATGAAGAAAAAATTGGGAGGG - Intronic
1181288273 22:21770681-21770703 ACAGAAATACAAGACTGAGAAGG + Intronic
1181928059 22:26376320-26376342 GCAGGAAGAGAAGGCTGGGAGGG + Intronic
1182242264 22:28925482-28925504 ACTGGAAGGCAAGACTGGAAGGG + Intronic
1183530573 22:38351269-38351291 AAGTGAGGGCAAGACTGGGAAGG - Intronic
1184009893 22:41739646-41739668 ACATGAATTCTAGAGTGGGAGGG + Intronic
1184342718 22:43894743-43894765 ACAGGAAGAGGTGACTGGGAGGG + Intergenic
949198120 3:1337858-1337880 AAATGAAAACAAGACTGACAGGG - Intronic
950145536 3:10647200-10647222 ACAAGAAGGCATGACTGGCAGGG + Intronic
952288089 3:31987651-31987673 CCATGAAAACAAGCCTGGGCTGG - Intronic
953143403 3:40250190-40250212 ACAGAAAGACAAGATTGGCAGGG - Intronic
955529943 3:59862647-59862669 CCCTGAAGACAAGACTTTGAAGG + Intronic
957079011 3:75621612-75621634 ACATGAAGGTGAGACTGGGCAGG - Intergenic
959138422 3:102454436-102454458 ACATCCAGACAAGAAAGGGAAGG - Intronic
959161170 3:102725709-102725731 AGATGTACCCAAGACTGGGAAGG - Intergenic
959458081 3:106588965-106588987 ACATGAAAACAACACTGCCAAGG + Intergenic
960179330 3:114556292-114556314 AAATGTAGATAAGATTGGGAAGG - Intronic
960574806 3:119218926-119218948 GAAAGAAGACAAGACAGGGAAGG - Intronic
960789125 3:121407473-121407495 ACATAAAGGCAAGTCTGAGAAGG - Exonic
961133011 3:124486348-124486370 ATATGAAAATAAGATTGGGAAGG + Intronic
961201617 3:125049981-125050003 CATTGAAGACAAGACTGGAAAGG - Intronic
963322693 3:143826479-143826501 AGATGAAGCCTAGACTTGGATGG - Intronic
963693483 3:148535211-148535233 ACAAGAAAAAAAGACTGGGAAGG - Intergenic
965477936 3:169180751-169180773 ACATAAAGAGAATACTGGAAAGG - Intronic
965600695 3:170451818-170451840 ACATGAAAAAAAGACTGCTATGG + Intronic
966875268 3:184317898-184317920 ACCAGAAGCCAAGCCTGGGAAGG - Intronic
969022088 4:4145568-4145590 ACATGAAGGTGAGACTGGGCAGG - Intergenic
969731777 4:8961825-8961847 ACATGAAGGTGAGACTGGGCAGG + Intergenic
969791374 4:9495932-9495954 ACATGAAGGTGAGACTGGGCAGG + Intergenic
970042690 4:11813771-11813793 ATATGAAGTCAAGATTTGGAAGG - Intergenic
970768636 4:19582973-19582995 ATATGAAGACAAGACAAGGAAGG + Intergenic
970770572 4:19607303-19607325 ACAAGAAAACAATACTGGAAAGG - Intergenic
970868464 4:20785139-20785161 ACATCAAGAGAAGATTAGGATGG + Intronic
971183692 4:24353451-24353473 ACATTAAGGCGAGACTGGCAAGG + Intergenic
971551541 4:27964257-27964279 ACAGACAGACAAGACAGGGAAGG - Intergenic
973772758 4:54221780-54221802 GCAAGAAGACCAGACTGAGAAGG + Intronic
974091173 4:57313110-57313132 ACCTAAAGACAAGTCTGGGTTGG + Intergenic
974152947 4:58033044-58033066 ACAGGAAAAGAAGATTGGGATGG + Intergenic
975948109 4:79733625-79733647 ACATGAAAAGAAGACTTGGATGG + Intergenic
976274588 4:83263332-83263354 ACATGAAGCCAAGTCATGGAGGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979985048 4:127303633-127303655 ACATAATGAGAAGATTGGGAAGG - Intergenic
980085095 4:128382662-128382684 ACAGGAAGCCAAGAGTAGGATGG - Intergenic
981077703 4:140607473-140607495 GCATGAGGAGAAGACTGGGCAGG + Intergenic
982263783 4:153519917-153519939 ACATGAAAACAAAACTGCCAGGG + Intronic
982283962 4:153715376-153715398 ACAGGAAGACTCGACTGGGCTGG + Intronic
984164139 4:176287585-176287607 AAATGAGAACAAGGCTGGGAAGG - Intergenic
986099277 5:4591745-4591767 AAATGAAGGGAAGCCTGGGAAGG - Intergenic
986291073 5:6399117-6399139 ACATGAAGTGGAGACAGGGACGG - Intergenic
986674454 5:10170651-10170673 ATACGAAGACCAGATTGGGAAGG - Intergenic
988465628 5:31488803-31488825 AAATGAAGGGAAGACTGGAAAGG + Intronic
989304488 5:39937273-39937295 ACCTGAAATCAAGTCTGGGAGGG - Intergenic
993553829 5:89310185-89310207 ACTTGGAGAGAAGAGTGGGAGGG - Intergenic
994829458 5:104760208-104760230 ACAGGAAGACTAGAGAGGGATGG - Intergenic
995651731 5:114377221-114377243 AAATGAAAACAAGTCTGGGGAGG - Intronic
997347090 5:133199784-133199806 AGATGAAGCCAAACCTGGGAGGG + Exonic
998435780 5:142107967-142107989 ACATGAAGTCAAAACTTGAAGGG - Intergenic
998602216 5:143596497-143596519 ACAAGGAGATAAGAATGGGAGGG - Intergenic
999368737 5:151039927-151039949 ACAGCCAGCCAAGACTGGGATGG + Intronic
1001155172 5:169266488-169266510 CCATGAAGACAAGAAAGGGAAGG - Intronic
1001565091 5:172694979-172695001 GCAAGAAGCCAAGACTGAGAAGG + Intergenic
1002805411 6:568949-568971 ACATGAAAAGTAGACGGGGAAGG + Intronic
1002948515 6:1785647-1785669 AGATGAAGAGAAGACAGGGCTGG - Intronic
1003149436 6:3536430-3536452 ACAATAAGAAAAGACTTGGAGGG + Intergenic
1003927614 6:10891539-10891561 TAAGGAAGACAGGACTGGGAAGG + Exonic
1005179159 6:23083936-23083958 ACATGGAGACAAGAGGGGAAAGG + Intergenic
1005507997 6:26486650-26486672 CCATGAAGATAAGACTGATATGG - Intergenic
1006230445 6:32581695-32581717 CCAGGAAGAGAAGGCTGGGATGG - Exonic
1007219638 6:40268437-40268459 ACAAGAAGACAAGAGGAGGAGGG + Intergenic
1007872516 6:45056692-45056714 ACATGGAGGGAAGGCTGGGATGG + Intronic
1009373473 6:62938304-62938326 AAAAGAAGAGAAGAGTGGGAAGG - Intergenic
1009476606 6:64099462-64099484 ACCTTGAGACAAGACTGTGAAGG - Intronic
1009780412 6:68261396-68261418 AGATGTACCCAAGACTGGGAAGG + Intergenic
1010694247 6:78950015-78950037 AAATGAAAACAAGGCTTGGAAGG - Intronic
1010809603 6:80285631-80285653 ACATGTTCACAAGACTGGCATGG - Intronic
1011164633 6:84432006-84432028 AGAAGAAGAAGAGACTGGGAGGG - Intergenic
1011233535 6:85189951-85189973 ACTTGAGAACAAGAGTGGGAGGG + Intergenic
1013022314 6:106232219-106232241 ACAGGAAAATAAGACTGAGAAGG - Intronic
1013377042 6:109527316-109527338 GCAAGAAGACAAACCTGGGAAGG + Intronic
1014090758 6:117401258-117401280 GCATGGAGAATAGACTGGGAGGG - Intronic
1015488902 6:133802561-133802583 TCATGAAGACAAGACTAGATTGG - Intergenic
1017114067 6:150960342-150960364 ACATGAAGGCACGGCTGGGAAGG + Exonic
1017624904 6:156338420-156338442 GCAAGCAGACTAGACTGGGAAGG + Intergenic
1018613316 6:165662958-165662980 ATGTGAAGACTAGACTGGGAGGG - Intronic
1018627383 6:165792691-165792713 ACTTGAAGAGAGGACTGGGCTGG - Intronic
1019270618 7:145308-145330 ACATGAGGACCATACAGGGAAGG - Intergenic
1020309512 7:6857609-6857631 ACATGAAGGTGAGACTGGGCAGG - Intergenic
1021301928 7:18983937-18983959 ATATGATGAAAAGAATGGGAAGG - Intronic
1021383324 7:19996119-19996141 TAATGAAGACAAGACAGAGAAGG + Intergenic
1023167667 7:37358828-37358850 ACATGAAGAACAGACTGGCATGG + Intronic
1024695024 7:51847066-51847088 ACATGAAGTGTATACTGGGAAGG - Intergenic
1029501287 7:100932125-100932147 ACATGAAGAATAGAAAGGGAAGG + Intergenic
1030659964 7:112207652-112207674 ACATCAAGACAAAAATGGGGTGG - Intronic
1032035404 7:128517754-128517776 GAATGAAGACAAGACAGAGAAGG + Intergenic
1032377839 7:131441342-131441364 ACAGGAATACAAGATTGGTAAGG - Intronic
1035029656 7:155848916-155848938 AGAGGAAGAGAAGACGGGGAGGG - Intergenic
1035312063 7:157975688-157975710 ACATGAATACCAGACACGGAGGG - Intronic
1037492081 8:19406149-19406171 TCATTAAGACATGACTGGGGGGG + Intronic
1038725054 8:30074660-30074682 ACATGAAAACATGTATGGGAAGG + Intronic
1039613523 8:38937347-38937369 AGATGAGGACAAGCCAGGGAGGG - Intronic
1040377635 8:46841971-46841993 ACATGAAAACAAGACATGTATGG + Intergenic
1041235263 8:55794750-55794772 ACATGAAGACTAAACTGAGTAGG + Intronic
1041663789 8:60423398-60423420 ACAAGAAGGTAAGACTGAGAAGG + Intergenic
1043563225 8:81519535-81519557 CCATGAAGGCAAGAATGGAATGG + Intergenic
1045173732 8:99697843-99697865 GGATGAAGACAAGAATGGCAAGG + Intronic
1046782329 8:118229126-118229148 ACTTGAAGGGAAGAGTGGGAGGG + Intronic
1050891679 9:10832122-10832144 AGATGAATACAAGAATGGGGAGG + Intergenic
1055077507 9:72231153-72231175 ACATGAAGTCAAGATAGGGCTGG + Exonic
1058151594 9:101469497-101469519 AAATGGAGAGAGGACTGGGAAGG - Intergenic
1060562757 9:124560400-124560422 ACATGTAGACAAGAAGGAGATGG - Intronic
1061843416 9:133373624-133373646 ACATGAAGAAAAGGCAGGGCAGG + Intronic
1061999945 9:134210879-134210901 ACATGATGAAGAAACTGGGAGGG - Intergenic
1062140924 9:134958572-134958594 ATCTGAAGACTGGACTGGGATGG + Intergenic
1185721000 X:2381318-2381340 ACGTGATGACAAGAGTGAGAAGG + Intronic
1186113485 X:6279860-6279882 ACATGAGTAAAAGACTGGTAGGG + Intergenic
1188378589 X:29463965-29463987 ACATAAAGACTGGACTGGGCTGG - Intronic
1189352973 X:40290891-40290913 ACATGTAGACAAAACAGAGAAGG + Intergenic
1189584646 X:42445986-42446008 ACATGAGGAGAAGTGTGGGAGGG + Intergenic
1190737040 X:53262502-53262524 ACAAGAAAACAAGACGAGGAAGG + Intronic
1191680393 X:63834172-63834194 TCAAGAAGACCACACTGGGAAGG - Intergenic
1192232420 X:69274662-69274684 ACAGGAAGAAAGGAGTGGGAAGG + Intergenic
1193595775 X:83443176-83443198 ACATGCAGACAAATGTGGGAGGG + Intergenic
1194134682 X:90126286-90126308 ACAAGAATACTAGAGTGGGAAGG - Intergenic
1195170161 X:102259587-102259609 ACATGGACACCAGACTGGGGAGG + Intergenic
1195188696 X:102427513-102427535 ACATGGACACCAGACTGGGGAGG - Intronic
1197893993 X:131291624-131291646 ACATCAGTACAACACTGGGAAGG - Intronic
1198121390 X:133595808-133595830 ACATAAAGACAAGAGTGGTAGGG - Intronic
1200480464 Y:3696397-3696419 ACAAGAATACTAGAGTGGGAAGG - Intergenic
1201434281 Y:13939905-13939927 ACAGGAATACCAGAGTGGGAGGG - Intergenic