ID: 920535505

View in Genome Browser
Species Human (GRCh38)
Location 1:206734113-206734135
Sequence CCTCAGGGGCAGGTGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 492}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920535489_920535505 24 Left 920535489 1:206734066-206734088 CCTTCCCTTGGAGGGAGAGGTGG 0: 1
1: 1
2: 2
3: 45
4: 331
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492
920535493_920535505 19 Left 920535493 1:206734071-206734093 CCTTGGAGGGAGAGGTGGCAGGA 0: 1
1: 2
2: 31
3: 502
4: 10700
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492
920535488_920535505 25 Left 920535488 1:206734065-206734087 CCCTTCCCTTGGAGGGAGAGGTG 0: 1
1: 0
2: 1
3: 27
4: 253
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492
920535485_920535505 27 Left 920535485 1:206734063-206734085 CCCCCTTCCCTTGGAGGGAGAGG 0: 1
1: 0
2: 3
3: 39
4: 277
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492
920535487_920535505 26 Left 920535487 1:206734064-206734086 CCCCTTCCCTTGGAGGGAGAGGT 0: 1
1: 0
2: 7
3: 32
4: 272
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492
920535491_920535505 20 Left 920535491 1:206734070-206734092 CCCTTGGAGGGAGAGGTGGCAGG 0: 1
1: 1
2: 7
3: 82
4: 1283
Right 920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG 0: 1
1: 0
2: 4
3: 57
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920535505 Original CRISPR CCTCAGGGGCAGGTGGTGGA GGG Exonic
900145235 1:1156355-1156377 CCTCAGAGGCACGTGGTGACCGG + Intergenic
900145253 1:1156427-1156449 CCTCAGAGGCACGTGGTGACCGG + Intergenic
900226293 1:1535032-1535054 CCTGGGGGGCAGGTGGGGGCAGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900436051 1:2631866-2631888 CCTCAGGGGGAGGTGATTGGTGG - Intronic
900582074 1:3414320-3414342 GTTCAGGGGCAGGTGGTGACAGG + Intronic
900616331 1:3567289-3567311 CCTCAGGGGCAGGTCTGGGCTGG - Intronic
900640514 1:3686060-3686082 CGCCAGGGGCAGGTGGGGGCAGG - Intronic
901143156 1:7048634-7048656 GCTCAGGGACAGGTGGTGGTGGG - Intronic
901221713 1:7587164-7587186 CCTCTGTGGCAGGAGGTGGGGGG + Intronic
901397857 1:8994617-8994639 CCTCTGTGGCAGGTGACGGAAGG + Intergenic
901402252 1:9022683-9022705 CCTCTGTGGCAGGTGACGGAAGG + Intronic
901731913 1:11286025-11286047 CCTCTGGGGCAGTTTGTTGAAGG - Exonic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902062924 1:13660326-13660348 CCTCAAGGGAAGGTGATGCAGGG - Intergenic
902076182 1:13788567-13788589 CCTCAGGGAAAGGTGGTGAAGGG + Intronic
902476557 1:16691579-16691601 CCACAGGGGCAGGTGGCCAATGG + Intergenic
902837438 1:19056067-19056089 CGTCATGGGCTGGGGGTGGAGGG + Intergenic
903239580 1:21974016-21974038 CTTGCGGGGCAGGTGTTGGAAGG + Intergenic
903243388 1:21998943-21998965 CTTGCGGGGCAGGTGTTGGAAGG + Intergenic
903620815 1:24696653-24696675 CCTCAGGGGCAGATGGGGACTGG + Intergenic
903889250 1:26558689-26558711 CCTCAGGGGCTGGCCGTGGCGGG - Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
903972886 1:27130603-27130625 CCACAGTGGCATGTGCTGGAGGG - Intronic
904392144 1:30193020-30193042 CCTCAGGTGCAGCTGGGAGAAGG - Intergenic
904410277 1:30320839-30320861 CCTCAGGGGCATGGAGTGGGTGG + Intergenic
904682964 1:32241475-32241497 CGACAGGAGCAGGTGGTGGACGG + Intergenic
905171757 1:36113878-36113900 CCACGGGGGCAGGTGATGGTGGG + Intronic
906390221 1:45408746-45408768 CCTGAGAGCCAGGTGATGGAAGG + Intronic
906523414 1:46480096-46480118 CCTTAGGGGCAGGGAGGGGAGGG + Intergenic
906550199 1:46659327-46659349 CCACAGTGGCAGGTGGAGAATGG - Intronic
907162803 1:52383765-52383787 CCTCAGGAGCAAGTGCTGGATGG - Intronic
907288179 1:53395625-53395647 CCTCAGGGGCCGGGGGTTGGGGG - Intergenic
907694350 1:56706801-56706823 ACTAAGGGTCAGGTGCTGGATGG + Intronic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910377464 1:86588031-86588053 CCTCTGGGGCAGGAGGTTGGAGG - Intergenic
910398767 1:86817631-86817653 CCTCTGAGCCAGGTGCTGGAGGG + Intergenic
910446452 1:87303169-87303191 GCTCAGTGGCAGGTTGTGGGAGG - Intergenic
911462073 1:98203640-98203662 GGTCAGGGGCAGGGAGTGGAGGG + Intergenic
913291418 1:117275950-117275972 GCTAAGGGGCAGGTGCAGGAAGG - Intergenic
913328782 1:117650365-117650387 TGGCAGGGGCAGGGGGTGGATGG + Intergenic
915461039 1:156070716-156070738 CCCCCAGGGCAGGTGGGGGAGGG + Intergenic
915724466 1:158007796-158007818 GCACAGGGGCTGCTGGTGGATGG - Intronic
916801603 1:168221336-168221358 CCACAGGGGCAGGTGGGGAGAGG + Intergenic
917519605 1:175736910-175736932 CCTCAGGGGGCTGAGGTGGAGGG + Intronic
918203283 1:182287410-182287432 CCTCAGGGGAACCTGGTGGTTGG - Intergenic
918399287 1:184147390-184147412 GCACAGGGCCAGGTGGAGGATGG + Intergenic
920181393 1:204134201-204134223 CCACAGAGCCTGGTGGTGGATGG - Intronic
920250403 1:204618982-204619004 CATCTGGGGCAGGTGGTGGAAGG + Exonic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
920684943 1:208102197-208102219 CCTCTGCGGCAGGTGTTGGGAGG - Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921347670 1:214203615-214203637 TCTAAGGGGCATGTGGAGGAGGG - Intergenic
922505052 1:226121549-226121571 CCGCAGGGGCCGGGGGTGGCGGG + Intergenic
922603774 1:226876091-226876113 ACTCACGGGCAGGTGGGGGTGGG - Intronic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
924058527 1:240146957-240146979 CCTCAGGGTAAGGTGGAAGACGG + Intronic
924169647 1:241325108-241325130 CCTTAGAGTCAGGTCGTGGATGG - Intronic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1065046792 10:21752810-21752832 CCCCACGGGCAGGAGATGGAAGG + Intergenic
1065139373 10:22705545-22705567 CCTCAGGGGCTGGTGGGAGGGGG - Intronic
1065879641 10:30027737-30027759 CCTAAGCGGGAGGTGGTGAAGGG - Exonic
1067551970 10:47242614-47242636 CCTCAGGGGCAGCTGAGGGAGGG + Intergenic
1067767053 10:49094771-49094793 TCTCAGTGGCAGGGGGTGGGGGG + Intronic
1067923851 10:50487327-50487349 TGTCAGGGGAAGGGGGTGGAGGG + Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1069854906 10:71434739-71434761 CTTGAGGGGAAGGTGGTGGAGGG + Intronic
1070613355 10:77949655-77949677 CCTGAGGGGCTGGTGGAGGATGG + Intergenic
1072001711 10:91201588-91201610 CCTCAGGGGCTGTGGGTGGAGGG - Intronic
1073179920 10:101577554-101577576 CCTCCAGGGCTGGGGGTGGAGGG - Intronic
1074469439 10:113714159-113714181 TGTCAGGGGCAGGTGAGGGAGGG - Intronic
1074988283 10:118677486-118677508 CCTCAGGAGAGGGTGGTGGAGGG - Exonic
1075622003 10:123934809-123934831 TCTCAGTGGCAGGCGATGGATGG - Intronic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075655838 10:124160554-124160576 CCTCTGAGGCACGTGCTGGAAGG + Intergenic
1076161323 10:128246309-128246331 TCTCTGGGGGTGGTGGTGGAGGG + Intergenic
1076352425 10:129826152-129826174 CCTGGGGAGCAGGTGGTGGTGGG + Intergenic
1076538455 10:131198358-131198380 CCTCAGGAGCAGGTGGGCAATGG - Intronic
1076598187 10:131638679-131638701 CCTCCGGAGCAGGTGGTGGCAGG + Intergenic
1076688656 10:132209549-132209571 CCTCAGGGCAAGCTTGTGGACGG + Intronic
1076734523 10:132452756-132452778 CCCCAGGGGCAGGAGGTGAGGGG - Intergenic
1077017891 11:404979-405001 CCTCAGGGGCAGGGGGTGCCTGG - Intergenic
1077032426 11:474508-474530 CTTCAAGGGCAGGGGGTGGGCGG - Intronic
1077107314 11:847859-847881 CCTCTGTGGCTGGGGGTGGAAGG - Intronic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1077875156 11:6298618-6298640 AAGCAGGGGCAGGTGGTGGTGGG + Intergenic
1077875900 11:6305336-6305358 CCCCTGGGGTCGGTGGTGGAGGG + Intergenic
1081677140 11:44976820-44976842 ACTCAGTGGCTGGTGGAGGAGGG + Intergenic
1081833833 11:46137056-46137078 CCTCGGGGGCCTGTGGTGGGAGG + Intergenic
1083768429 11:64853358-64853380 CCACAGTGGGAGGTGGTGGTGGG - Exonic
1084056756 11:66638910-66638932 TCTCAGGGGGCGGTGGGGGAAGG - Intronic
1084162293 11:67356466-67356488 CCTCATGGTGAGGTGGGGGAAGG - Intronic
1084364716 11:68690144-68690166 GTTAAGGGGGAGGTGGTGGAGGG + Intronic
1084380814 11:68811535-68811557 CTTCTGGGGCAGGGGGTGGGGGG + Intronic
1084553313 11:69862024-69862046 GCTCAGGGGCAGGCAGTGGTGGG - Intergenic
1084666064 11:70577015-70577037 CCTCCGTGGCAGGTGCAGGACGG - Intronic
1085019520 11:73196713-73196735 CCTCTGGAGCAGCTGGGGGAAGG - Intergenic
1085450697 11:76630340-76630362 TGTCAGGGGCAGCTGCTGGAAGG - Intergenic
1087636954 11:100712565-100712587 ACTGAGTGGCAGGTGGTGGGAGG + Intronic
1089127852 11:116190022-116190044 TCTCAGGAGCTGGGGGTGGAGGG + Intergenic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1089794220 11:120967340-120967362 CCTCTAGGGCAGGAGGAGGATGG - Intronic
1090437939 11:126702490-126702512 CGTCAGGGAGAGGTGGAGGAGGG + Intronic
1091385904 12:94497-94519 CCCAAGGAGCAGGAGGTGGATGG + Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1091774076 12:3172918-3172940 CTTCAAGGTCAGGTGGTGGGAGG - Intronic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092159528 12:6308491-6308513 GCCCAGTGGCAGGTGGTGGTGGG - Intergenic
1092226027 12:6748873-6748895 CCTCAGGGGCTGGGGGACGAAGG - Exonic
1092254290 12:6917741-6917763 TCCCAGGGGCGGGTGGGGGAGGG + Intronic
1094224343 12:28028447-28028469 CCTCGGGGTAAGGTGGTGGGTGG + Intergenic
1096460200 12:51818180-51818202 GCTCTGGGGCAGGTAGGGGAAGG - Intergenic
1096607501 12:52777166-52777188 GCTCTGGGGGAGCTGGTGGAGGG - Exonic
1097245225 12:57604454-57604476 TCCCAGGAGCTGGTGGTGGATGG - Intergenic
1101532875 12:105590418-105590440 CTTCCGGGGCAGGAAGTGGATGG - Intergenic
1101736266 12:107465578-107465600 GCTCAGGGGCAGGGGGTGCTGGG + Intronic
1102108930 12:110349357-110349379 CCTGATGGGCAGGTGGCTGAAGG + Intronic
1103224735 12:119276986-119277008 TATCAGGGTCAGGGGGTGGAGGG + Intergenic
1104415475 12:128594037-128594059 CCTCAGTGGGTGGTGGGGGAGGG - Intronic
1104942877 12:132403138-132403160 GCGGAGGGGCAGGTGGTGGGAGG + Intergenic
1107816761 13:44251332-44251354 CCTCAGTGGCTGGGGGTGGGGGG - Intergenic
1108859537 13:54838138-54838160 TCTCTGGGGAAGGTAGTGGAGGG - Intergenic
1109210785 13:59533737-59533759 AGTCTGGGGCAGGTGGGGGATGG - Intergenic
1113398694 13:109972286-109972308 ACCCAAGAGCAGGTGGTGGAAGG - Intergenic
1114215308 14:20653662-20653684 CCGCAGGGTCTGGTGGTGGCCGG + Intergenic
1114493794 14:23119114-23119136 CCTCAAGAGCAGGTGGGGGCGGG - Exonic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115761214 14:36580675-36580697 ACTCTGGGGCTGGCGGTGGAGGG + Exonic
1118982140 14:70725510-70725532 ACTCAGGTGCTGGTGTTGGAAGG - Intronic
1119181843 14:72610704-72610726 GCTCAAGGGCAGGTGGGAGATGG + Intergenic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121254298 14:92519994-92520016 CCACAGGGGTAGGGGTTGGAGGG + Intronic
1121278040 14:92680961-92680983 TCACAGGGGCAGGGGGTGGGGGG - Intronic
1121974863 14:98393680-98393702 CCTCAGGGCCGGGCGGTGAACGG + Intergenic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122124531 14:99571953-99571975 CCTCAGGGGAAGGAACTGGAGGG + Intronic
1122138189 14:99646361-99646383 CAGCAGGGGCAGGTGGTGTGGGG + Intronic
1122272728 14:100575629-100575651 CCTGGGGGGCTGGTGGGGGAAGG + Intronic
1122480083 14:102041589-102041611 GATCAGGAGCAGGCGGTGGATGG - Exonic
1122750260 14:103928045-103928067 CCTCAGGGTGAGGAGATGGAAGG - Intronic
1122780112 14:104139895-104139917 CCCCAGGGGCAGGTGCTTGCAGG + Intronic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122986391 14:105213630-105213652 CCTCAGTGCCAGGTGGGGGAGGG - Intronic
1123956649 15:25342807-25342829 GTTGAGGGGCAGGTGGTGGAGGG - Intronic
1124098657 15:26672614-26672636 GTTCAGGGGCTGGAGGTGGAGGG - Intronic
1127713362 15:61623807-61623829 CGTCTGGGGCATGTGGTGGAGGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128179500 15:65589264-65589286 ACTCAGGGGGCGGAGGTGGAAGG - Intronic
1128363156 15:66976812-66976834 CCTGAAGGGCAGGGGGTGAAGGG + Intergenic
1128429617 15:67578380-67578402 CCTCAGGGGCCAGTTGTGTAGGG + Intronic
1129467912 15:75734186-75734208 CCTCTGTGGCAGGCAGTGGAGGG - Intergenic
1129519626 15:76177615-76177637 CCTCAGGGGCACGTTGTCCAAGG + Intronic
1129719348 15:77869545-77869567 CCTCTGTGGCAGGCAGTGGAGGG + Intergenic
1129857815 15:78837543-78837565 CCTCAGCGGCAAATGGGGGAGGG + Intronic
1130098941 15:80877366-80877388 ACTCTGGGGCAGGTACTGGAAGG - Intronic
1132529393 16:438107-438129 TCTCAGGAGGAGGTGGGGGAAGG - Intronic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132974178 16:2703298-2703320 CCTCAGAGCCAGGTGGTGGCTGG + Intronic
1133345073 16:5064481-5064503 CTTCAGCTGCAGCTGGTGGATGG - Intronic
1134557174 16:15175329-15175351 CCTCAGGCACAGCTGATGGAGGG + Intergenic
1134917753 16:18087040-18087062 CCTCAGGCACAGCTGGTGGAGGG + Intergenic
1136071842 16:27792050-27792072 GCTGAGGGGTGGGTGGTGGAAGG - Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136271537 16:29151722-29151744 CCTCTGGGACAGGCGGTGCAGGG + Intergenic
1137449747 16:48560620-48560642 CCTTAGGGTCGGATGGTGGAGGG - Intronic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1139468842 16:67167620-67167642 CCTGAGGGGCCTGTGGGGGAGGG + Intronic
1139573160 16:67825825-67825847 CTTCAGGAGCAGGTGCTGGCAGG + Exonic
1139670784 16:68491393-68491415 CCTCAGGGGCAGGAGGGGAGGGG + Intergenic
1139953863 16:70684364-70684386 CATGAGGGGCAGGGGGTGGGGGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140855928 16:78977702-78977724 CAGCAGGGGCAGGGGGTGCAGGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141464173 16:84195708-84195730 CCCCCGGGGCAGGCGGGGGATGG + Intronic
1141635239 16:85310894-85310916 GCTCAGGGGCTGGGGATGGAGGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142075154 16:88113707-88113729 CCTCTGGGACAGGCGGTGCAGGG + Intronic
1142127976 16:88419606-88419628 CTTCAGGGGCAGGGAGTGGGAGG - Intergenic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142583046 17:953474-953496 CCTCAGGGACAGGGGGTGTGGGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143514387 17:7412078-7412100 GGTCGGGGGGAGGTGGTGGATGG - Intronic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144497520 17:15757884-15757906 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144629313 17:16862368-16862390 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144652112 17:17013747-17013769 CCTCAGGTGCAGGGGGTAGCGGG + Intergenic
1144998966 17:19290194-19290216 CCTCAGGCCCAGGGGGTTGAGGG + Intronic
1145005767 17:19336882-19336904 CCTCAGGGAAAGGGGGTGGGAGG + Intergenic
1145160884 17:20572934-20572956 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1145277347 17:21440514-21440536 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145315185 17:21726409-21726431 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145713616 17:26998345-26998367 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146380185 17:32322318-32322340 GCTCAGGGGCAGGTGTGGAAGGG - Exonic
1146936792 17:36816913-36816935 ACTCAGGGGGAGGTGTTGGCTGG + Intergenic
1147145867 17:38484184-38484206 TCTCAGGGGAAGGGGGAGGATGG + Intronic
1147159324 17:38561421-38561443 CCTCAGGGACTGGGGGTGGGGGG - Intronic
1147165544 17:38591292-38591314 CCTCAGGGGAACCTGGGGGAAGG + Intronic
1147571136 17:41571861-41571883 CCTCAGGGGGCGGTGGAGGAGGG - Exonic
1147627227 17:41907999-41908021 CCTCAGTGTCAGGTGGAGCAGGG + Intronic
1147632000 17:41938288-41938310 CAGAAGGGGCAGCTGGTGGATGG - Intronic
1148022930 17:44565629-44565651 GCTCAGGGACAAGAGGTGGAGGG - Intergenic
1148367687 17:47069032-47069054 GTTGAGGGGCAGCTGGTGGAAGG - Intergenic
1150183004 17:63146855-63146877 CCTGGGAGGCAGGTGGTTGAGGG - Intronic
1150212188 17:63447279-63447301 CCTGGAGGGCAGGTGGGGGAGGG - Intergenic
1151090772 17:71437986-71438008 CCTCAGAAGAAGGTGGTGGTAGG - Intergenic
1152024365 17:77799082-77799104 CCACGGGGTCAGGTGATGGAGGG - Intergenic
1152162897 17:78680259-78680281 GCTGACGGGCGGGTGGTGGAGGG - Exonic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1152631523 17:81412818-81412840 ACTCAGGGCCAGGTGTTGGCTGG + Intronic
1153466833 18:5397358-5397380 GCTAAGCGGCAGGTGGTGCACGG + Exonic
1153631026 18:7069802-7069824 TCTCTGGGGCAGCTGGAGGAGGG - Intronic
1153927134 18:9843962-9843984 GCTCTGGGGCAGGTGGAGGAAGG + Intronic
1154067726 18:11124602-11124624 CTAGAGGGGCAGGTGGTGGTGGG - Intronic
1154195771 18:12265419-12265441 CCTCAGGGACAGATGCTGGGAGG + Intronic
1155144345 18:23070947-23070969 CCTCTATGGTAGGTGGTGGAAGG - Intergenic
1156253875 18:35377093-35377115 ACTCAGGGGCAGGCAGCGGAGGG + Intronic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160588045 18:79923354-79923376 ATGCATGGGCAGGTGGTGGATGG + Intronic
1160729436 19:634238-634260 CCTCAGGGGCAGGAGCCGAATGG + Intergenic
1161393307 19:4032297-4032319 GCTGAGGGCCAGGTGGTGGATGG + Intronic
1161575163 19:5051013-5051035 CCACAGGTGCAGGTTGGGGAGGG - Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162833661 19:13302629-13302651 CCTTAGGGGCTGGTGCAGGAGGG - Intronic
1162851234 19:13432510-13432532 TACCAGGGGCTGGTGGTGGAGGG + Intronic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1163533223 19:17862769-17862791 GCTCACGGGAAGGTGGTGGTGGG - Intronic
1163726129 19:18924153-18924175 TCTCAGGGGCGGGTGGGGGCAGG + Intronic
1164476547 19:28579890-28579912 CCTCAAGGGCAGGTGCAGGGTGG - Intergenic
1164574821 19:29399734-29399756 TCTCTGGGGCAGGTGGAGGATGG - Intergenic
1164838624 19:31375373-31375395 TCCCAGGGGCAAGGGGTGGAGGG - Intergenic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165348986 19:35266586-35266608 ACTGAGGGGCAGGGGCTGGAAGG + Intronic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1165821097 19:38676607-38676629 CCTCTGGGGCCGGATGTGGAAGG + Intronic
1166066996 19:40365923-40365945 CCTCAGGGGTAGGTGGGGGGAGG + Exonic
1166067415 19:40367906-40367928 CAGCAGGGGCAGGGGGTGGGAGG + Intronic
1166389890 19:42402943-42402965 CCTCAGGGTCAGGTTCTTGAGGG + Exonic
1166777940 19:45323687-45323709 GTTCGGGGGCAGGTGTTGGAGGG + Intergenic
1167006963 19:46782524-46782546 CCCGTGGGGCAGGAGGTGGAGGG - Exonic
1167244646 19:48365685-48365707 AGTCAGGGGCACGGGGTGGAAGG - Intronic
1167716282 19:51144552-51144574 ACTGAGGAGCGGGTGGTGGAGGG - Exonic
1167966246 19:53149672-53149694 CCTCAGGGTAAGTTGGGGGATGG - Intronic
1202710578 1_KI270714v1_random:17420-17442 CCACAGGGGCAGGTGGCCAATGG + Intergenic
925715238 2:6779053-6779075 ACCCTGGGGCAGGTGGTTGATGG - Intergenic
926232188 2:11012725-11012747 CCACAGGGGCTGGGGGCGGAAGG - Intergenic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
926696187 2:15771417-15771439 CCTCAGGGAGAGGAGGTGAAGGG + Intergenic
927873548 2:26639730-26639752 ACTCAGGGTCTGGTGGTGGCAGG - Intronic
927873567 2:26639817-26639839 TTTCAGGGGAAGGTGGGGGAAGG - Intronic
927922013 2:26979937-26979959 GCTGAGGGTCAGGTTGTGGATGG + Intronic
928399776 2:30969405-30969427 ACTCAGGGGCAAGTTGGGGAGGG + Intronic
929083257 2:38142425-38142447 CCTCAGGGGCAGGGTGTGGTGGG - Intergenic
929769259 2:44878349-44878371 GCTCAGGGGCCAGTGGTGTAGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932479048 2:72027730-72027752 CCCCAGGAGCAGGTGGGGGCAGG + Intergenic
932700243 2:73986464-73986486 CCTCAGCGCCAGGTGATGGTAGG + Exonic
933817713 2:86081462-86081484 CTCCAGGTGCAGGTGGTGGGAGG - Intronic
934523154 2:95032499-95032521 CCTCAGGGACAGGTGCTGATAGG + Intronic
934858493 2:97743906-97743928 CCTAATGGGTAGGTGGTGGGGGG + Intergenic
934939881 2:98493027-98493049 CCTGATGGGCAGCTGGTGGAGGG - Intronic
934977658 2:98816031-98816053 CCATAGGGGCTGGTGGTGGGGGG + Intronic
935099457 2:99978978-99979000 GATCAAAGGCAGGTGGTGGAAGG + Intronic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
935951274 2:108331123-108331145 CCCCAGGGGGATGTGGTGGTGGG + Intergenic
936738143 2:115471485-115471507 TCTCAGAAGCCGGTGGTGGAAGG - Intronic
937095496 2:119232793-119232815 TCCCAGGGGTAGGTGGTGGGGGG - Intronic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937207431 2:120245716-120245738 CCCCCGGGGCAGGGTGTGGAGGG + Intronic
937428103 2:121816514-121816536 CCTCTGTGGCAGGTGGGGCAGGG + Intergenic
937921538 2:127135086-127135108 GCTCAGGGGCGGGGGGTGGGGGG - Intergenic
938092853 2:128444599-128444621 GCTCAGAGGGAGGTGGTGCAAGG + Intergenic
938201476 2:129376405-129376427 CTCCAGGTGCAGGTGTTGGAAGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938308313 2:130268992-130269014 CCCCAAGGTCAGGTGGTTGAGGG - Intergenic
938447016 2:131387844-131387866 CCCCAAGGTCAGGTGGTTGAGGG + Intergenic
940405852 2:153301085-153301107 ACTCAGGGGCCTGAGGTGGAAGG + Intergenic
940854886 2:158722324-158722346 CCTCAGGGGCAGCAGGTCCAGGG + Intergenic
942302055 2:174571991-174572013 CCACTGGAGGAGGTGGTGGAGGG + Exonic
943884916 2:193204395-193204417 CCTCATTGCCAGGTGGTGGTGGG - Intergenic
944024013 2:195142203-195142225 CCTCAGGAGCAGTTTGTGGAGGG + Intergenic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
945286224 2:208085181-208085203 ACTCAGGGGCAAGTGTGGGAGGG + Intergenic
945826365 2:214724855-214724877 CCTCAAGTGGAGGTGGCGGAAGG + Intergenic
946355591 2:219182422-219182444 CCTCAGGGGCAGGCAGGGGCTGG - Exonic
946416498 2:219542806-219542828 CCTCAGGGTGAGATGGGGGAGGG - Intronic
947161751 2:227222231-227222253 GCTCAGGGGCAGGGGGCTGAAGG - Intronic
947421634 2:229946101-229946123 CCCCAGGGGGTTGTGGTGGAGGG + Intronic
947815714 2:233034850-233034872 CCTCAGGGGCTGGAGGTCGCGGG - Exonic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
948874296 2:240819055-240819077 CCGCAGGGGCGGGAGGGGGAGGG - Intronic
1169067467 20:2702044-2702066 CCTGAGGGCAAGGGGGTGGAGGG + Intronic
1169338111 20:4774029-4774051 CCTCAGGCGCATGGGGTGGGCGG + Intergenic
1170157037 20:13278443-13278465 CCACAGGTGCAGGTGGGGGCTGG - Intronic
1170554416 20:17504169-17504191 CCTCATGGTCATGTGGGGGATGG - Intronic
1170607784 20:17886713-17886735 CCCCAGGGCCCAGTGGTGGAGGG + Intergenic
1171048279 20:21831995-21832017 CCTCACTGGCAGGTGCTGGGAGG + Intergenic
1171059321 20:21940780-21940802 CCTCATGGGGAGCTGGGGGAAGG + Intergenic
1171272350 20:23826784-23826806 AGTCAGGGGCAGGTCATGGAGGG - Intergenic
1171317236 20:24205956-24205978 CCCCACAAGCAGGTGGTGGAAGG + Intergenic
1171379180 20:24720550-24720572 CCACAGGGGTAGGTGGTTGGGGG - Intergenic
1171812492 20:29756750-29756772 CATCCGGGGCATCTGGTGGAAGG + Intergenic
1172038726 20:32028938-32028960 CCTGAGGGCCAGGAGCTGGAGGG + Intronic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1173564825 20:44031156-44031178 ACACAAGGGCAGGTGGGGGAAGG + Intronic
1174177049 20:48651789-48651811 CCTCAGGGCCAGGCCTTGGATGG - Intronic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1176268990 20:64225665-64225687 ACTCAGAAGCAGGTGGTGGGAGG + Intronic
1176270333 20:64232942-64232964 GCTCTGGAGCAGGTGTTGGAGGG - Intronic
1177571131 21:22888477-22888499 GCTCTGGGGAAGGTGGTGGGAGG + Intergenic
1177995306 21:28089687-28089709 CTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1178628975 21:34243053-34243075 CCTCTGGGGCAGGTGGAAGGTGG + Intergenic
1179140738 21:38722786-38722808 TCTCAGGGGCAGGGGGTGCGAGG + Intergenic
1180146039 21:45919596-45919618 CCTCTGGGGCAGGTGGGGAAAGG - Intronic
1180160473 21:45996868-45996890 CCTCAGGTGCAGGTGGGGGCAGG + Intronic
1180199502 21:46215919-46215941 CCTCGGGGTCAGTTGCTGGAGGG - Intronic
1181405421 22:22681047-22681069 CCTCAGGGGCATGGGTTCGAGGG + Intergenic
1182320262 22:29474238-29474260 CCACAGAGTGAGGTGGTGGAGGG - Intergenic
1182660065 22:31918884-31918906 CTGCAGGGGCAGCTGCTGGAAGG - Intergenic
1183952117 22:41357835-41357857 CCCCAGGGGGAGGGGGTGGGAGG - Exonic
1184124272 22:42475988-42476010 CTTTAGGGGCGGGTGGGGGAGGG - Intergenic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184450639 22:44580518-44580540 GCTATGGGGCAGGTGGTAGAGGG + Intergenic
1184488631 22:44796327-44796349 CCTCGGGGGCAGCTGATGGTGGG + Intronic
1184537793 22:45099511-45099533 CCTCAGGGGCAGGTGGCAGAGGG - Intergenic
1184667889 22:45998061-45998083 CCTCAGGGGCAGGGACTGGGGGG + Intergenic
1184727760 22:46356459-46356481 CTCCAGGGGCAGGTGGTGGGAGG + Intronic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184964643 22:47962324-47962346 TCTTAGTGGTAGGTGGTGGAGGG - Intergenic
1185044514 22:48522454-48522476 CCTCAGTGGCTGGTGGGGGCTGG + Intronic
1185345404 22:50308437-50308459 CTTCAGGGCCAGGAGGTGGGCGG + Intergenic
950453259 3:13077678-13077700 CCTCACGTGCAGGTGGCTGACGG + Intergenic
950486770 3:13278498-13278520 CATGAAGGGCAGGTGGTGGGTGG + Intergenic
950614648 3:14148938-14148960 CCTCTGGTGCAGATGGTGAAAGG - Exonic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952901148 3:38112433-38112455 TCTGAGGGCCAGGTGTTGGAGGG - Intronic
953032849 3:39189352-39189374 CCTCCAGGGCTGGGGGTGGAGGG + Exonic
953201494 3:40781922-40781944 TCTGAGGAGCAGGTGGTGAATGG + Intergenic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953925932 3:46982432-46982454 CCCCAGGGGGAGGGGGTGGGTGG - Intronic
954360765 3:50121650-50121672 CCTCAGGGACAGGTGGGGTGTGG + Intergenic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
955145563 3:56315040-56315062 CATCAGTGGCATGTGGTGGAAGG - Intronic
956115236 3:65911391-65911413 GCTCTGGGGCTGCTGGTGGAGGG - Intronic
956384325 3:68700937-68700959 CCTCAGGGGCATGAGGTGAGAGG - Intergenic
957159054 3:76584762-76584784 TATCAAGGCCAGGTGGTGGATGG - Intronic
959096684 3:101964219-101964241 CCTCAGGAGCTCGGGGTGGAGGG - Intergenic
959370226 3:105514721-105514743 CCACAGTGGCAAGTGGTGGGGGG + Intronic
960551582 3:118981894-118981916 CCTCAGGGCCAGCAGGAGGAAGG - Intronic
960987927 3:123292535-123292557 CCTCTGTGGGTGGTGGTGGAAGG - Intronic
961142593 3:124567612-124567634 TCACAGCAGCAGGTGGTGGAGGG + Intronic
961159530 3:124711511-124711533 CCTCATGGGCAGGGCTTGGATGG + Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961460161 3:127045122-127045144 GCTCAGGTGCAGGTGGAGGGTGG + Intergenic
961544455 3:127622715-127622737 TCTCTGGGTGAGGTGGTGGATGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962318145 3:134371314-134371336 CCTCAGGGCCTGCTGCTGGATGG + Exonic
962392364 3:134983810-134983832 CCTCATAGACAGGTGGTTGATGG + Intronic
962650218 3:137480915-137480937 GCCCAGGGGCAGGGGGTGGGTGG - Intergenic
963230743 3:142906654-142906676 ACTGAGGGGCATATGGTGGAAGG - Intergenic
963942413 3:151108237-151108259 GGTGAGGGGCAGGTGGTGGGTGG + Intronic
964515636 3:157504762-157504784 CATTAGGGGCAGGTGGTTTAAGG - Intronic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
965901336 3:173644964-173644986 GCTCAGAGGCTGGTGGTGGGAGG + Intronic
966775717 3:183541236-183541258 CCTCTGTGGCAGCTGGCGGAGGG - Intronic
966890774 3:184406109-184406131 CTTAAGGGGCAGGAGGTGGGGGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968442890 4:633490-633512 CTGCAGGGGAAGGGGGTGGAGGG + Intronic
968489696 4:883345-883367 CCTCGGGGACAGGTTGTAGACGG + Exonic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
968892121 4:3375009-3375031 CCACAGGGACAGGCGGTGCATGG - Intronic
969460427 4:7326096-7326118 GCTCAGAGGCAGGTGGTGAGGGG + Intronic
969532175 4:7736193-7736215 CCCCAGGGGCATGTGGCTGAGGG - Intronic
969728145 4:8938090-8938112 CCCCAGGGACAGGTGATGGCTGG - Intergenic
974583415 4:63836867-63836889 CCCTATGGTCAGGTGGTGGATGG + Intergenic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
976672285 4:87666647-87666669 CCTCTGGGGCAGATGTAGGAGGG + Intergenic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
977033882 4:91924826-91924848 GCTGAGGGGCAGGTGGAGGGTGG + Intergenic
977726449 4:100302228-100302250 CATCAGGGGCAGGTTGTGGTTGG + Intergenic
978310234 4:107379270-107379292 CATCAGAGGCAGGTGGTGTAGGG + Intergenic
980878439 4:138685842-138685864 CCTCAGGGGCATCAGGTGAAAGG - Intergenic
981342487 4:143637860-143637882 CATGTGGGGCAGGTGGTGGAGGG + Intronic
981747834 4:148068178-148068200 CCTCAGGGGCAGGGTTGGGAGGG + Intronic
982490390 4:156022490-156022512 GCTCTGGGGGTGGTGGTGGAAGG + Intergenic
983903677 4:173163401-173163423 CCTCACTGGCAGGCGGTGGGAGG - Intergenic
985202102 4:187494397-187494419 CCTCAGGGGACCATGGTGGAAGG - Intergenic
985475532 5:76837-76859 CCACACGGACAGGTGGCGGATGG + Intergenic
985712856 5:1439778-1439800 TCTCAGGGGCTGGTGGTTCAGGG - Intronic
985938020 5:3111617-3111639 CCTCAGGGGATGGGGGTGGGTGG - Intergenic
986051130 5:4091406-4091428 CCTCAGGGGCAAGTGTGGGAGGG + Intergenic
986409341 5:7461090-7461112 TCTCAGGGGCAGCTGGTCCAAGG + Intronic
986442690 5:7795547-7795569 CTTCTGGGGCATGGGGTGGATGG + Intronic
988967294 5:36432252-36432274 GCTCAGGGACAGGTGCTGGCAGG + Intergenic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
989539115 5:42598261-42598283 ACTCAGGGCCAGGTTGTTGAGGG + Intronic
989813524 5:45707887-45707909 TGTCAGGGGAAGGTGCTGGAAGG - Intergenic
992583317 5:78204762-78204784 CCTCAGTGACAGGGGCTGGATGG - Intronic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
994788719 5:104197147-104197169 ACACAGGGGCAGGTTGGGGATGG + Intergenic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
996257589 5:121425116-121425138 CCTCAGGGGCAGCTGGTGTCTGG - Intergenic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998136671 5:139677697-139677719 CCTCAGAGGCTGGGGGTGGGTGG + Intronic
998140316 5:139696391-139696413 GCTCAGGGCCAGCTGCTGGAAGG - Intergenic
998161455 5:139814963-139814985 GGCCAGGGGCAGGTGGTGGGTGG - Intronic
998373109 5:141673590-141673612 CCTCAGGGGTGGGTGCTGGGAGG - Exonic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999253289 5:150195273-150195295 GCTCAGGAGGAGGTGGAGGAAGG - Intronic
999257968 5:150220342-150220364 AATCAGGGGCAGGTGGGGGAGGG + Intronic
999662247 5:153877591-153877613 CCTCTGGGGCTGGTGGTGGGAGG - Intergenic
999715021 5:154353508-154353530 CCTCAGGCGCATTGGGTGGAAGG + Intronic
999722973 5:154412510-154412532 ACTCAGGTGCAGGTGGTCCAGGG - Intronic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1001057376 5:168460920-168460942 CCACAGGGGAAGGTGCTGAAGGG + Intronic
1001249520 5:170136033-170136055 CCTTGGGGGCATGTGGTTGAAGG + Intergenic
1001993372 5:176134866-176134888 GCTGAGGGGGAGGTGGTGGGGGG + Intergenic
1002375999 5:178789554-178789576 CCTCATGGGCTGGTAGTGGGAGG - Intergenic
1002399721 5:178984863-178984885 TCTCAGGGCCAGGTGGAGGGTGG - Intronic
1003075115 6:2976773-2976795 TCTCAGTGCCAGGTGGTGGCTGG + Intergenic
1003078003 6:2999643-2999665 CCTCAGGGGCGGGGAGTGGGCGG + Intronic
1003380527 6:5620790-5620812 GATCAGAGGCAGTTGGTGGATGG + Intronic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1004753299 6:18585362-18585384 AGTCAGGAGCAGGTGGGGGAGGG - Intergenic
1004895604 6:20144843-20144865 CTTGAGGGGTAGGTGGAGGAAGG - Intronic
1005072177 6:21872005-21872027 CCTCAGGTGTTGGTGGTGTAGGG + Intergenic
1005740328 6:28785396-28785418 CTTCTGGGGGAGGGGGTGGAGGG - Intergenic
1006736590 6:36277929-36277951 CCACAGGGGCAGCTGCTGGTGGG - Intronic
1007351058 6:41273816-41273838 CCTCCCTGGCAGGTGGTGGCAGG - Intronic
1007358139 6:41335558-41335580 CCTCAGGGGTAGGTCATGGTGGG + Intergenic
1008534375 6:52496081-52496103 TGTCAGGTTCAGGTGGTGGAAGG + Intergenic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1012016099 6:93853935-93853957 GCTAAGGGGCAGGTGGGGGCGGG - Intergenic
1012287098 6:97403957-97403979 CCTCAGGGGCCTGAGGTGGGAGG - Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013296233 6:108760558-108760580 CCTCAGTGGCCAGTGCTGGAGGG - Intergenic
1014074435 6:117220183-117220205 CCTCAGGTGATGGTGGTAGAAGG + Intergenic
1015919488 6:138252612-138252634 CCCCAGGAGAAGGGGGTGGAAGG - Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1018512163 6:164536058-164536080 TGCCAGGGGCAGGTGGTGAATGG - Intergenic
1018787665 6:167121075-167121097 CCAGAGGGGAAGGTAGTGGATGG - Intergenic
1019083130 6:169449727-169449749 CCTGGGGAGCATGTGGTGGAAGG + Intergenic
1019476791 7:1248263-1248285 GCCCAGGGGCAGGCGGAGGAAGG - Intergenic
1019742457 7:2681644-2681666 CGACAGGGACAGGTGGTGCAGGG + Intronic
1020211402 7:6160329-6160351 CATCTGGGGCGGGTGGTGGCCGG + Intronic
1021364495 7:19760099-19760121 CCTGAGGGGGAGGAGGTAGAAGG - Intronic
1022257070 7:28669522-28669544 CATGAGGGGAAGCTGGTGGAGGG + Intronic
1023372209 7:39522809-39522831 CCTCAGTTGAAGGTGCTGGAGGG - Intergenic
1023859743 7:44211277-44211299 CCTCAGGCCCAGGTGGTTGGAGG + Intronic
1024270100 7:47635619-47635641 CCTCTGTGGAAGGTGGTCGAGGG + Intergenic
1024539961 7:50468138-50468160 CCTCGCGGGCAGGGGGTGGCTGG + Intronic
1024540908 7:50474376-50474398 GGTCAGGGACTGGTGGTGGAGGG + Intronic
1024629397 7:51235008-51235030 CCCCAGAGACAGGTTGTGGAGGG - Intronic
1026964254 7:74429255-74429277 CCTCAAGGGCACTTGGGGGACGG + Intergenic
1026968471 7:74454383-74454405 CCTCCCGGGCAGGTGGGGGGCGG - Intronic
1027101711 7:75380316-75380338 GCCCAGGGGTGGGTGGTGGAAGG + Intergenic
1028058704 7:86282238-86282260 CCACAGGGGCGGGTGGGGGAGGG + Intergenic
1029125842 7:98294867-98294889 CCTGGGTGGCAGGTGCTGGAAGG - Intronic
1029710699 7:102297788-102297810 TCTCGGGGGAAGGGGGTGGAGGG + Intronic
1031401519 7:121329831-121329853 CCTTAGGGGTTGGTGGGGGACGG + Intronic
1031414231 7:121476546-121476568 CATGAGGGGCAGGTGGTTGAGGG - Intergenic
1032438797 7:131925166-131925188 ACTGAGGGGCAGGTGGTTGGGGG + Intergenic
1032438951 7:131926959-131926981 ACTGAGGGGCAGGTGGTTGGGGG + Intergenic
1032790063 7:135235991-135236013 ACTCAGGAGGATGTGGTGGAAGG + Intronic
1033207296 7:139433981-139434003 CCCCAGGGACAGGTGCTGGCTGG - Intergenic
1034398535 7:150846295-150846317 CGCCAGGGGCAAGTGGTGGCAGG - Intronic
1034447076 7:151119205-151119227 CCCGAGGGGCAGGTTGTGGAGGG + Intronic
1034969748 7:155411475-155411497 CCTCAGTGGTAGGTGGGGGACGG - Intergenic
1035085292 7:156252998-156253020 CTTCCGGGGCTGCTGGTGGATGG + Intergenic
1036079751 8:5542217-5542239 ACTCAGGGACAGGTGGTTGCAGG + Intergenic
1036452598 8:8881886-8881908 CCTCAAGGCCAGGTGGTAGAAGG + Intronic
1036648723 8:10628474-10628496 TCTCTGGGGCTGGGGGTGGAGGG - Intronic
1036760452 8:11505379-11505401 GCTCAGGGACAAGGGGTGGAGGG - Intronic
1037059141 8:14485263-14485285 CAGCGGGGGCAGGGGGTGGAGGG - Intronic
1037930644 8:22878181-22878203 CCTGAGGGAAAGGGGGTGGAGGG + Intronic
1037944725 8:22981703-22981725 CTTCAGGGGCAGGCAGTGGGGGG - Intronic
1037945633 8:22987819-22987841 GATCTGGGGCAGGAGGTGGAGGG + Intronic
1038014224 8:23499609-23499631 AGTCAGGGGCAGGTGGAGGTGGG + Intergenic
1038303978 8:26383007-26383029 CGTCAGGGGCAGGGGAGGGACGG + Exonic
1039241299 8:35559562-35559584 GCTCAGGGCCAGGTGTTGGTAGG + Intronic
1039473476 8:37827446-37827468 CCCCAGGGGCAGGTGAGGAAGGG + Intronic
1039861953 8:41466726-41466748 CCTCAGGGCCAGGCTGAGGAGGG + Intergenic
1042768396 8:72352535-72352557 CCTTAGGGTCAGGTGGTGGGTGG + Intergenic
1043623512 8:82227440-82227462 GCTCAGGCTCAGGTGGAGGATGG - Intergenic
1044732066 8:95237001-95237023 CCTCAGCCTCTGGTGGTGGAAGG - Intergenic
1045236162 8:100354210-100354232 GGTCAGGGGCAGGAGGTTGATGG - Intronic
1045510253 8:102807597-102807619 CCCCCGGGACAGGTGGAGGAGGG + Intergenic
1047951569 8:129939739-129939761 CCACAGGGGCAGGTGTTGAGGGG - Exonic
1048185922 8:132240655-132240677 CCTCATGGGGAGGTGGTGCGAGG - Intronic
1048297200 8:133223172-133223194 CCTCCTGGGGAGGTGGTGGTGGG - Intronic
1048330533 8:133467671-133467693 CCCCAGGGGCAAGGGGTGGCTGG + Intronic
1048381538 8:133870063-133870085 GCTCTGGGGCACGTGATGGAGGG + Intergenic
1048399477 8:134050923-134050945 CCCTTGGGGGAGGTGGTGGAGGG + Intergenic
1048609790 8:136009848-136009870 CTGCAGGGGTAGGTGGTGCAGGG - Intergenic
1049529753 8:143148340-143148362 CCTGACGGGCATGGGGTGGATGG - Intergenic
1049667402 8:143852396-143852418 TCTCTGGGGCAGGTGGTGACGGG - Intergenic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1049760592 8:144330463-144330485 CCTCAGAGGCTGGTGCTGCAAGG - Intergenic
1051361244 9:16283464-16283486 CCACAGGGGCACGTGGCGGCAGG + Intergenic
1055903403 9:81266283-81266305 CCTCAGAGACATGTGGTGGTGGG + Intergenic
1056782942 9:89564944-89564966 AAACAGGGGCTGGTGGTGGAAGG - Intergenic
1056943833 9:90977195-90977217 ATTCAGGGGCAGGGGGAGGAAGG + Intergenic
1057083567 9:92189693-92189715 CCACGGGGGCAGGGGGTCGAGGG - Intergenic
1057135056 9:92681712-92681734 TGGAAGGGGCAGGTGGTGGAGGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057291375 9:93809564-93809586 CCCCAGGGGCAGGGGTTGAATGG - Intergenic
1057429300 9:94979739-94979761 CCCGTGGGGCAGGTGGTGGGGGG + Intronic
1059251550 9:112891163-112891185 CCACCGGGGCAGGGGCTGGAAGG + Intergenic
1059343638 9:113613598-113613620 CATCAGGGGCAGGGGCTGGTGGG + Intergenic
1059396521 9:114037518-114037540 CCTCTGGGGAAAGGGGTGGAGGG - Intronic
1059689412 9:116670345-116670367 CCACAAGGGCAGGAGGTAGAAGG + Intronic
1060045556 9:120337393-120337415 CCTCTGGGGCACATGGTGGGGGG - Intergenic
1060670618 9:125466272-125466294 CCTCAGGGGTACGGGGTGGGTGG - Intronic
1061392766 9:130327066-130327088 CCTCAGAGCAAGGTGGTGGTGGG + Intronic
1061582306 9:131545644-131545666 CCGGAGGGGCAGGTGCTGGTGGG + Intergenic
1061832306 9:133303846-133303868 CCTGAGTGGCAGGTGGTGTCTGG + Intergenic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062169183 9:135125128-135125150 CCTCAGGGGGGTGAGGTGGAAGG + Intergenic
1062197963 9:135285038-135285060 GCTCGGGGGCAGGTGGTGCTGGG + Intergenic
1062303629 9:135889713-135889735 GCTCAGGGGAAGGAGGAGGAGGG - Intronic
1062532259 9:137007132-137007154 CCTCAGGCACAGGTGCTGGCAGG - Intergenic
1062552841 9:137097972-137097994 GCTCAGGGGCTGGTGGCTGATGG + Intronic
1187181507 X:16947141-16947163 CCGCAGGGACAGGAGGCGGAGGG - Intronic
1189287855 X:39864932-39864954 CCTCAGGGGCACGTCTGGGAGGG + Intergenic
1190020895 X:46873888-46873910 GCTCAGGGTCAGGTGGGGGTGGG - Intronic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1195047059 X:101063738-101063760 CACCAGGGTCTGGTGGTGGAGGG - Intergenic
1196578530 X:117351134-117351156 CCTCAGGTGCAGGTTGTTGGGGG + Intergenic
1198574286 X:137992932-137992954 CTCCAGGGGAAGGTGGTGAATGG + Intergenic
1199298090 X:146181963-146181985 CCTCAGGGGCAGCGGGTTGTAGG - Intergenic
1200003065 X:153072078-153072100 CCTCCGGGGCACGTGCGGGAGGG + Intergenic
1200004658 X:153077931-153077953 CCTCCGGGGCACGTGCGGGAGGG - Intergenic
1200121559 X:153793568-153793590 CATCAGGGCCAGGTGCTGGCTGG + Exonic
1201368020 Y:13230139-13230161 ACTCAGGAGGAGGTGGTGGGAGG - Intergenic