ID: 920540467

View in Genome Browser
Species Human (GRCh38)
Location 1:206774175-206774197
Sequence CACACAGCAGGGACATCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920540467_920540479 29 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540479 1:206774227-206774249 TGTCTCTTCCCAACTCTTCAGGG No data
920540467_920540472 -8 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540472 1:206774190-206774212 GCTGTGTGACCTATGGATCAGGG No data
920540467_920540475 -1 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540475 1:206774197-206774219 GACCTATGGATCAGGGTCAGGGG No data
920540467_920540478 28 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540478 1:206774226-206774248 GTGTCTCTTCCCAACTCTTCAGG No data
920540467_920540474 -2 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540474 1:206774196-206774218 TGACCTATGGATCAGGGTCAGGG No data
920540467_920540471 -9 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540471 1:206774189-206774211 TGCTGTGTGACCTATGGATCAGG No data
920540467_920540473 -3 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540473 1:206774195-206774217 GTGACCTATGGATCAGGGTCAGG No data
920540467_920540477 6 Left 920540467 1:206774175-206774197 CCTGTGGATGTCCCTGCTGTGTG No data
Right 920540477 1:206774204-206774226 GGATCAGGGTCAGGGGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920540467 Original CRISPR CACACAGCAGGGACATCCAC AGG (reversed) Intergenic