ID: 920540703

View in Genome Browser
Species Human (GRCh38)
Location 1:206775847-206775869
Sequence GGATGGATAGAATGTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920540696_920540703 14 Left 920540696 1:206775810-206775832 CCCATGAAGAGAGGGAAGTGAGA No data
Right 920540703 1:206775847-206775869 GGATGGATAGAATGTCAGCCTGG No data
920540697_920540703 13 Left 920540697 1:206775811-206775833 CCATGAAGAGAGGGAAGTGAGAA No data
Right 920540703 1:206775847-206775869 GGATGGATAGAATGTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920540703 Original CRISPR GGATGGATAGAATGTCAGCC TGG Intergenic
No off target data available for this crispr