ID: 920541008

View in Genome Browser
Species Human (GRCh38)
Location 1:206778009-206778031
Sequence ACACTATCAAAGCCAATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920541008_920541014 8 Left 920541008 1:206778009-206778031 CCTGACATTGGCTTTGATAGTGT No data
Right 920541014 1:206778040-206778062 CTTCAGAATAAACGCCTGGTGGG No data
920541008_920541013 7 Left 920541008 1:206778009-206778031 CCTGACATTGGCTTTGATAGTGT No data
Right 920541013 1:206778039-206778061 ACTTCAGAATAAACGCCTGGTGG No data
920541008_920541016 24 Left 920541008 1:206778009-206778031 CCTGACATTGGCTTTGATAGTGT No data
Right 920541016 1:206778056-206778078 TGGTGGGCCAGAAGTTTAAGAGG No data
920541008_920541012 4 Left 920541008 1:206778009-206778031 CCTGACATTGGCTTTGATAGTGT No data
Right 920541012 1:206778036-206778058 GGTACTTCAGAATAAACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920541008 Original CRISPR ACACTATCAAAGCCAATGTC AGG (reversed) Intergenic
No off target data available for this crispr