ID: 920541305

View in Genome Browser
Species Human (GRCh38)
Location 1:206780163-206780185
Sequence ACATAAATACTACAGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920541305_920541309 -1 Left 920541305 1:206780163-206780185 CCACCCCTCTGTAGTATTTATGT No data
Right 920541309 1:206780185-206780207 TCAGTTTGTAATTAGACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920541305 Original CRISPR ACATAAATACTACAGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr