ID: 920543049

View in Genome Browser
Species Human (GRCh38)
Location 1:206793660-206793682
Sequence GGTTCCAGGCATAAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920543049_920543054 2 Left 920543049 1:206793660-206793682 CCCTCCATTTTATGCCTGGAACC No data
Right 920543054 1:206793685-206793707 AAACAACAGAAAAAAACACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920543049 Original CRISPR GGTTCCAGGCATAAAATGGA GGG (reversed) Intergenic
No off target data available for this crispr