ID: 920543279

View in Genome Browser
Species Human (GRCh38)
Location 1:206795124-206795146
Sequence CTCCAGCTGGCCCTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920543279_920543283 2 Left 920543279 1:206795124-206795146 CCAGACACAAGGGCCAGCTGGAG No data
Right 920543283 1:206795149-206795171 TTGGGAAGTACAGTAACACCTGG No data
920543279_920543285 15 Left 920543279 1:206795124-206795146 CCAGACACAAGGGCCAGCTGGAG No data
Right 920543285 1:206795162-206795184 TAACACCTGGCCACCAAGGCTGG No data
920543279_920543284 11 Left 920543279 1:206795124-206795146 CCAGACACAAGGGCCAGCTGGAG No data
Right 920543284 1:206795158-206795180 ACAGTAACACCTGGCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920543279 Original CRISPR CTCCAGCTGGCCCTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr