ID: 920543519

View in Genome Browser
Species Human (GRCh38)
Location 1:206797106-206797128
Sequence CAGTGTAGAGACTTTGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920543510_920543519 20 Left 920543510 1:206797063-206797085 CCTTCGCTGGGGTCAGCCTCTAA 0: 1
1: 0
2: 1
3: 5
4: 103
Right 920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 149
920543509_920543519 27 Left 920543509 1:206797056-206797078 CCTGACTCCTTCGCTGGGGTCAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 149
920543508_920543519 28 Left 920543508 1:206797055-206797077 CCCTGACTCCTTCGCTGGGGTCA 0: 1
1: 0
2: 0
3: 11
4: 174
Right 920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 149
920543515_920543519 4 Left 920543515 1:206797079-206797101 CCTCTAAGGGTCAGGGCTCACTC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920543519 Original CRISPR CAGTGTAGAGACTTTGCTGC GGG Intergenic
900480698 1:2897663-2897685 CAGTGTGGACACTGGGCTGCTGG - Intergenic
901793533 1:11667256-11667278 CAGTGCAGAGCCCTGGCTGCCGG + Intronic
904256768 1:29259442-29259464 AAGTGTGGGGCCTTTGCTGCGGG - Exonic
912056044 1:105598958-105598980 CAAAGTATAAACTTTGCTGCTGG + Intergenic
913481886 1:119296499-119296521 AAGTGCAGGGAATTTGCTGCAGG + Intergenic
915723516 1:158001569-158001591 CAGAGAAGGGACTTTGCTGTGGG + Intronic
916689374 1:167175945-167175967 CAGTTTACAGACTCTGCAGCTGG - Intergenic
917231748 1:172845234-172845256 CACTCTAGAGCCTTTGCTCCTGG + Intergenic
917647373 1:177042341-177042363 CAGGCTAGGGACTGTGCTGCTGG - Intronic
919726344 1:200887293-200887315 CAGTAAAGACACTTTGGTGCAGG - Intergenic
920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG + Intergenic
921049515 1:211501070-211501092 CAGAGGGGAGACCTTGCTGCTGG + Intergenic
924627417 1:245707201-245707223 CAGTGTTATGACATTGCTGCAGG - Intronic
1065783298 10:29190466-29190488 GAGTGTAGAGACTGTGCTCCTGG + Intergenic
1067055356 10:43046666-43046688 CAGTGAAGCCACTGTGCTGCGGG + Intergenic
1067319602 10:45205493-45205515 CAGGGATGAGGCTTTGCTGCAGG + Intergenic
1069065484 10:63937842-63937864 CAGTGCAGTGACTTTACTGTGGG + Intergenic
1069133481 10:64734729-64734751 CAGTGTCTAGACCTTGGTGCAGG + Intergenic
1071804189 10:89098842-89098864 GATTGAAGCGACTTTGCTGCGGG - Intergenic
1073228224 10:101943051-101943073 CAGTGTGGGAACTTTTCTGCAGG - Intronic
1076301445 10:129430539-129430561 CAGAGTAGAGACTTTCATCCAGG - Intergenic
1078400659 11:11023590-11023612 CAGTGTAACCAGTTTGCTGCTGG - Intergenic
1079251923 11:18792812-18792834 CTGTGTAGAGAATCAGCTGCAGG - Intergenic
1082130887 11:48487989-48488011 GAGTGGAGAGACTTTGCAGGGGG + Intergenic
1082184408 11:49162808-49162830 CAGTCTAGCCACTTTTCTGCAGG + Intronic
1083980570 11:66164968-66164990 CAGTGTGGAGACCAAGCTGCAGG + Intronic
1086681941 11:89682560-89682582 CAGTCTAGCCACTTTTCTGCAGG - Intergenic
1086907537 11:92434567-92434589 CAGTCTAGCAACTTTGGTGCTGG + Intronic
1087384282 11:97450128-97450150 CAGAACAGAGACTTTGCTTCTGG + Intergenic
1087668589 11:101079852-101079874 CTGTGTAGAGATCTTGGTGCAGG + Intronic
1087705909 11:101491692-101491714 CAGTGCAAAGACTTTGTTGTTGG - Exonic
1090483287 11:127086706-127086728 CAGTGCAGAGATCTTGGTGCAGG + Intergenic
1090799373 11:130160841-130160863 GAGGGTAGAGACCTGGCTGCTGG - Intronic
1091463498 12:663853-663875 CAGTATTGAGACTGTGCTGGAGG - Intergenic
1092448266 12:8578368-8578390 CTGTGTACAGACTTGGATGCTGG + Intergenic
1092674515 12:10901023-10901045 CTGTGCAGAGATTTTGATGCAGG + Intronic
1096119712 12:49080304-49080326 CAGTGTAGAGAAATTGGAGCAGG - Intergenic
1096780430 12:53988684-53988706 CAGTGGAGGGACTTTGTTCCAGG - Intronic
1098137497 12:67417904-67417926 CAGTGTAGAAACTTTGTTTAGGG + Intergenic
1098492058 12:71093266-71093288 CAGGGTAGCGAATTTGCTTCTGG + Intronic
1099517701 12:83618513-83618535 AACTGGAGAGACTTTGCTTCAGG - Intergenic
1104104166 12:125643216-125643238 CAGTGTCAAGCCTGTGCTGCTGG - Intronic
1105200789 13:18173773-18173795 CATTGTAGAGAATTAGCTTCAGG + Intergenic
1106609051 13:31261030-31261052 AAGTATCCAGACTTTGCTGCAGG + Exonic
1110663574 13:78088565-78088587 CAGTTTACAAACTTTGCTTCTGG + Intergenic
1111419917 13:87998859-87998881 CAGTTTAGTGACTTCCCTGCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112236000 13:97637348-97637370 CAGTGGAAAGTCCTTGCTGCGGG - Intergenic
1112890505 13:104224351-104224373 CAGTCTAGAGACTCTGATACAGG - Intergenic
1113108897 13:106800914-106800936 GACTGTAGAGATTTTGGTGCAGG - Intergenic
1115694486 14:35881706-35881728 CAGTGTAGAAGCCTGGCTGCAGG - Intronic
1116222901 14:42111602-42111624 CTGTGCAGAGACCTTGGTGCAGG - Intergenic
1116751807 14:48895522-48895544 AAGTGTTGAGACTTTGAAGCCGG + Intergenic
1116889902 14:50258193-50258215 CAGTGGAGAGACATTGGTGTTGG - Intronic
1120722647 14:87905232-87905254 CAGAGCAGACTCTTTGCTGCAGG - Intronic
1128509529 15:68304830-68304852 GAATGGACAGACTTTGCTGCTGG - Intronic
1130870207 15:87965540-87965562 CAGTGTGGAGACTGTCCAGCAGG + Intronic
1131652660 15:94418406-94418428 CAGAGCAGAGAATTTGCTGATGG + Intronic
1132381721 15:101370846-101370868 CAGTGGAGAGACCAGGCTGCTGG + Intronic
1140787353 16:78355546-78355568 CAGTGTTGGTAGTTTGCTGCTGG - Intronic
1144271572 17:13622660-13622682 CAGTGTAGAGACTTGTTTTCTGG + Intergenic
1147680098 17:42237707-42237729 CAGTTTAGAGACTTTGGCCCTGG - Intronic
1149923945 17:60684000-60684022 AAGTGTTGTGACTTTTCTGCAGG + Exonic
1150161430 17:62901354-62901376 CAGTATACAGGATTTGCTGCTGG - Intergenic
1151757232 17:76081922-76081944 CACCATAGAGACTGTGCTGCTGG + Exonic
1164722316 19:30441422-30441444 CAGTGTACAGAGGTTGCTGGAGG - Intronic
1168687691 19:58358362-58358384 CGCTGTAGAGACTTCGCTGTGGG - Intronic
926066734 2:9846356-9846378 GGGTGTAGAGAGTCTGCTGCTGG + Intronic
927798161 2:26070202-26070224 CAGAGTAGAGAATTTGCTTTTGG + Intronic
927812262 2:26186623-26186645 CAAGGTGGGGACTTTGCTGCAGG + Intronic
927945560 2:27133224-27133246 CAGGGTAGAGAATTTGCAGGCGG - Exonic
928394890 2:30935969-30935991 TTGTGTAGAGAGTTTGCTGGGGG + Intronic
933093966 2:78154986-78155008 CAGTGTGGAGAATTTGATCCAGG - Intergenic
933257724 2:80099654-80099676 CAGTTTAGAGAATTTTCAGCAGG + Intronic
939377946 2:141394552-141394574 CATTGTAGACACTTTGAAGCTGG - Intronic
943511958 2:188836832-188836854 CAGTGTGGAGTCTTAGCTGAGGG - Intergenic
945963417 2:216160414-216160436 CAGTGTTGAGATTTTGCTGTTGG + Intronic
946528916 2:220550465-220550487 CATTCTAGAGCCTTTGCTTCAGG - Intergenic
948013003 2:234664808-234664830 CAGTGTCAGGACTTGGCTGCTGG + Intergenic
948779505 2:240310183-240310205 CAGAGTAGGGACTTCTCTGCTGG + Intergenic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1172980854 20:38940466-38940488 CATTCAAGAGCCTTTGCTGCAGG + Intronic
1174276854 20:49410133-49410155 CATTGGAGAGACATAGCTGCTGG + Intronic
1177774965 21:25557662-25557684 TAGTGTAGAGATTTTGCTCTTGG - Intergenic
1179184631 21:39075522-39075544 CAGTTTAGAGACCTACCTGCAGG + Intergenic
1180297693 22:10959287-10959309 CAGTGCTGAGAATTTGCTTCAGG + Intergenic
1184112295 22:42402426-42402448 CAGAGCAGAAACTTTGCTGCAGG + Intronic
1184138138 22:42561542-42561564 CTGTGTAGGGACTTTGGAGCTGG + Intronic
957303640 3:78427448-78427470 CAATGTAGAGGCTTTGTTTCTGG - Intergenic
958747028 3:98148912-98148934 TAGTGTAGAAAATATGCTGCGGG - Intergenic
959902354 3:111674866-111674888 CAGTGTACAGACATGCCTGCGGG - Intronic
961246218 3:125456045-125456067 CTAAGTAGAGACATTGCTGCTGG + Intronic
966494534 3:180564913-180564935 CAGTGTGGAAATTTTCCTGCTGG + Intergenic
966686392 3:182700229-182700251 CATTGCAGAGACTTGGTTGCAGG - Intergenic
966902817 3:184499498-184499520 CAGGGCAGAGGCTGTGCTGCTGG - Intronic
969010905 4:4061179-4061201 CTGTGGTGAGACTTTGCTGATGG - Intergenic
969983291 4:11180640-11180662 CAATGTGGAGACTTTGCTAATGG + Intergenic
970542029 4:17089591-17089613 CATTGTAGAGAAATTGCTGTAGG - Intergenic
971515899 4:27486023-27486045 CAGTGAAGAGACGCTACTGCAGG + Intergenic
972030030 4:34443595-34443617 CAGTGTAGATAATTTGATCCAGG - Intergenic
973876072 4:55220417-55220439 GAGTGTAGAGACTCTGGAGCTGG - Intergenic
979913833 4:126405147-126405169 CTGTGCAGAGATCTTGCTGCAGG + Intergenic
980838746 4:138230796-138230818 CAGACTATAGACTTTTCTGCCGG + Intronic
982458298 4:155636426-155636448 CAGTGTAAAGAATTAGCTGGAGG - Intergenic
984925816 4:184805775-184805797 CAGTGGGGTGACTTTGCTGCTGG - Intronic
985710364 5:1424389-1424411 CAGTGATGAGACCTTGCTGGGGG - Intronic
985964569 5:3330118-3330140 CAGAGAAGAGGCTATGCTGCTGG - Intergenic
988482726 5:31642981-31643003 CAGTGCAGAGAACTTCCTGCTGG + Intronic
988975756 5:36514496-36514518 CAGTGGAGTTACTTTGCTGCTGG + Intergenic
989515339 5:42337003-42337025 TGATGTAGTGACTTTGCTGCTGG - Intergenic
989588505 5:43092213-43092235 CAGCGTATAAACTTTGCTGTGGG - Intronic
990595174 5:57305692-57305714 CAGTGGACAGACTGTGCTGTTGG + Intergenic
991341016 5:65609242-65609264 CTGTGAAAAGACTTTGCAGCAGG - Exonic
993971923 5:94430042-94430064 CTGTGCAGAGATCTTGCTGCAGG - Intronic
994400886 5:99277199-99277221 TAGAGTAGGGATTTTGCTGCAGG - Intergenic
996567614 5:124896605-124896627 AAAAGTAGAGTCTTTGCTGCTGG + Intergenic
999053243 5:148546589-148546611 CATTGTGGAGAGTTTGCTGTGGG - Intronic
999127359 5:149255669-149255691 CAGTGTTGAGACCCTGATGCAGG + Intronic
999717504 5:154373174-154373196 CAGTGTAGGCACTTTGGTGAAGG + Intronic
1000470675 5:161637261-161637283 CAGGGAAGAGTCTTTGATGCTGG - Intronic
1005704115 6:28434734-28434756 CAGTGTGGAGTCTCTGGTGCTGG + Exonic
1005867747 6:29948923-29948945 TAGTGGAGAGACAGTGCTGCTGG - Intergenic
1006253181 6:32807756-32807778 CAGTGTAGAAGCTATGGTGCAGG + Intergenic
1009734684 6:67662054-67662076 CAGTTTAGAACCTTTGCTGGAGG + Intergenic
1011534503 6:88361575-88361597 CACTGTTGAGCTTTTGCTGCTGG + Intergenic
1013770813 6:113625865-113625887 CACTGTCAACACTTTGCTGCAGG + Intergenic
1015385606 6:132619611-132619633 CATTGTAGAATCTCTGCTGCAGG - Intronic
1020711539 7:11612220-11612242 CAGTGTAGGGCCCATGCTGCAGG + Intronic
1021312953 7:19116077-19116099 CAGTCTAGAGACTCTGGAGCTGG - Exonic
1023069157 7:36411609-36411631 CATTGTAGAGATTTTGTTGAAGG - Intronic
1027934844 7:84589248-84589270 CTGTGCAGAGATCTTGCTGCAGG + Intergenic
1029228325 7:99045330-99045352 CTCTGTAGAGGATTTGCTGCAGG - Intronic
1031388746 7:121186950-121186972 CAGTTTATAGCCTATGCTGCAGG - Intronic
1032925649 7:136601921-136601943 TAAAGTATAGACTTTGCTGCTGG + Intergenic
1038358556 8:26854595-26854617 CATTGTTGAGAATTTGGTGCAGG + Intronic
1038428875 8:27484046-27484068 CAATGTAGAGACATTGCAGGAGG + Intergenic
1045737201 8:105310083-105310105 CAGGGCAGGGACCTTGCTGCTGG - Intronic
1046447403 8:114340851-114340873 CAGTGTAGAGACTCACATGCTGG - Intergenic
1047082427 8:121478071-121478093 CAGTGTAGACAGTTTCCTCCAGG + Intergenic
1047253602 8:123199167-123199189 AAGTGTAAATACTTCGCTGCTGG + Intronic
1047584137 8:126250819-126250841 TAGTTTAGAGACTTTGCTCTTGG + Intergenic
1048881322 8:138875012-138875034 CAGTGAAGAGACTCTGATGAAGG - Intronic
1049507100 8:143008653-143008675 CAGTGCAGAAGCTATGCTGCAGG + Intergenic
1049513199 8:143039994-143040016 CAGTGGAGAGTCAGTGCTGCAGG + Intronic
1052026625 9:23580688-23580710 CAGAGTAGAGACCTTGTTGCTGG - Intergenic
1052880327 9:33597892-33597914 CAGTGTAAAAACTAGGCTGCAGG + Intergenic
1053305314 9:36980646-36980668 CAGTGTAGAGACCCTGTTGGAGG + Intronic
1054777995 9:69139896-69139918 CAGTGTTGTGACCTTCCTGCTGG - Intronic
1055275879 9:74614961-74614983 CAGTGTAGAGACTTAACACCAGG - Intronic
1056767313 9:89452812-89452834 CAGTCTAGAGACAGTGCAGCAGG - Intronic
1058760711 9:108128895-108128917 CAGGATAGTCACTTTGCTGCTGG - Intergenic
1061685077 9:132269413-132269435 CAGTGTAGATACTTGGGTTCTGG + Intronic
1062591405 9:137276404-137276426 CAGGGCAGAGGCTTTGCTGCAGG + Intergenic
1062664050 9:137657357-137657379 CAGTGTTGAGAGTTGGCTGCAGG + Intronic
1187822010 X:23297850-23297872 GAGTATAGTGATTTTGCTGCTGG - Intergenic
1194260207 X:91685390-91685412 CAGTGCAGAGATCTTGGTGCAGG + Intergenic
1200812174 Y:7497761-7497783 CAATGTAGTGACTTTGCAGTTGG + Intergenic
1201571521 Y:15420620-15420642 CGGGGCAGAGACTCTGCTGCTGG - Intergenic