ID: 920546445

View in Genome Browser
Species Human (GRCh38)
Location 1:206822350-206822372
Sequence GAGGCTGGTGGGTGATATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920546440_920546445 -6 Left 920546440 1:206822333-206822355 CCTGGAGGAGAATGCTGGAGGCT 0: 1
1: 0
2: 2
3: 30
4: 306
Right 920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG 0: 1
1: 0
2: 1
3: 28
4: 336
920546435_920546445 25 Left 920546435 1:206822302-206822324 CCATAGCTATGGGCAAAGTTGGC 0: 1
1: 0
2: 0
3: 0
4: 83
Right 920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG 0: 1
1: 0
2: 1
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920546445 Original CRISPR GAGGCTGGTGGGTGATATGG AGG Intronic
900209050 1:1444528-1444550 GAGGCTGCAGAGTGATGTGGGGG + Intergenic
900218885 1:1496446-1496468 GAGGCTGCAGAGTGATGTGGGGG + Intronic
901280805 1:8033268-8033290 GAGCCTGTGGGGTGCTATGGGGG + Intergenic
901824939 1:11855070-11855092 TAGGCTTGTGGGTGGGATGGAGG - Intergenic
902628874 1:17692945-17692967 GAGGCTGCTGGGTGACAAGGCGG - Intronic
902838347 1:19060458-19060480 GCGGCGGGTGGGGAATATGGTGG - Intergenic
903548434 1:24141495-24141517 GAGGCTGGTGGCTGAGGTGGGGG + Intronic
904019142 1:27449018-27449040 TAGGCTGGTGGGGGTTGTGGTGG - Intronic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
905706523 1:40063956-40063978 GAGACAGGTGGCTGAAATGGAGG + Intronic
906281538 1:44557843-44557865 AAGGCTGGTGGGGGATGTGAAGG - Intronic
907375429 1:54034232-54034254 AGGGCTGGAGGGTGAGATGGGGG + Intronic
908450078 1:64245676-64245698 GAGGCTGATGGGTATTATTGTGG - Intronic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
909487235 1:76187877-76187899 GAGGCTGGAGGGAGGTATAGAGG - Intronic
910071086 1:83214108-83214130 GAGGTGGGTGGGTGGAATGGTGG - Intergenic
911265891 1:95742840-95742862 GTGGCTGCTGTGGGATATGGGGG + Intergenic
912116753 1:106416866-106416888 GAAGCTGGTAGGTGAGTTGGTGG + Intergenic
914049453 1:144119466-144119488 GAAGCTGGCAGGTGATTTGGGGG - Intergenic
914129731 1:144845974-144845996 GAAGCTGGCAGGTGATTTGGGGG + Intergenic
914431290 1:147622071-147622093 GAGACTGTGGTGTGATATGGAGG - Intronic
914513274 1:148352910-148352932 GAGGCTGGTGGTGGGTAGGGTGG + Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
915164265 1:153939873-153939895 GAGGCTGGAGGTGGAGATGGAGG - Intronic
915243389 1:154539970-154539992 GAGCCTGGTGGGTGAAGGGGAGG + Intronic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
915766381 1:158366515-158366537 GAGCTTGGTGTTTGATATGGTGG - Intergenic
917337822 1:173943426-173943448 GAGTATGGTGAGTGTTATGGTGG - Exonic
918600626 1:186355134-186355156 GAGGCAGGTGGGTCATTTGAGGG - Intronic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
922177820 1:223210858-223210880 CAGTCTGGTGGGGCATATGGAGG - Intergenic
922229253 1:223671518-223671540 GAGGATGATGAGTGATAAGGAGG + Intergenic
922560843 1:226568583-226568605 GAGGCTGGTGGGTGGCCAGGAGG + Intronic
922706894 1:227794925-227794947 GAGGCTGCTGGGTGGCCTGGAGG - Intergenic
923050793 1:230390104-230390126 GAGGCTGCTTTGTGACATGGCGG + Intronic
1062902647 10:1157574-1157596 GAGGCTGGTGGGTGTGATCAGGG + Intergenic
1062963655 10:1591941-1591963 CAGGCTGGTGGGTGAGGTGAAGG - Intronic
1064259523 10:13774052-13774074 GAGACAGGTGGGTGATAGAGAGG - Intronic
1064276897 10:13914755-13914777 GAGGCTGAAGTGTGATGTGGTGG + Intronic
1064479278 10:15723103-15723125 GAGGCTGGTGGATCATCTTGAGG + Intergenic
1064531375 10:16313942-16313964 GAGGCTGGTGGGATAAACGGAGG - Intergenic
1064647848 10:17478521-17478543 GTGGATGGTGGGTGAAATGGGGG - Intergenic
1068085478 10:52368505-52368527 GAGGCTGCTGGGTGCTCTGATGG - Intergenic
1069893135 10:71664397-71664419 GAGGCTGATGGGTGCTCTCGAGG - Intronic
1071682055 10:87716218-87716240 GAGGGTGGAGGGTGCCATGGAGG - Intronic
1071789710 10:88941204-88941226 GAGGCCTGTGGGAGATAAGGGGG - Intronic
1072166216 10:92815637-92815659 GAGGCAGGTTTGTGATTTGGAGG - Intergenic
1074348188 10:112709123-112709145 GAGGATGGTGAGTGAGATGAAGG - Intronic
1076117976 10:127913858-127913880 AAGGCTGGTGGATGAGGTGGGGG - Intronic
1076601570 10:131660176-131660198 GAGTTTGGTGGGGGAGATGGTGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1081255770 11:40892403-40892425 GGGGTTGCTGGGTCATATGGTGG - Intronic
1082097037 11:48139374-48139396 AAGGTGGGTGGGTGATGTGGTGG - Intronic
1082807984 11:57462015-57462037 GTGGCTGGTGGGCCAGATGGGGG + Intronic
1082975934 11:59071737-59071759 GAGGCCCTTGGGTGAAATGGTGG - Intergenic
1085328010 11:75623310-75623332 GAGGCTTGTGAGTGAGAGGGAGG + Intronic
1085721846 11:78919409-78919431 GAGTTTGATGGGTGATGTGGAGG - Intronic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1087051071 11:93886932-93886954 GAGGCTGCTGAGTGATCTGGAGG + Intergenic
1089156526 11:116406973-116406995 GAGGCAGGCAGGTGCTATGGGGG + Intergenic
1089388186 11:118081481-118081503 GAAGCTGGAGGGTGCTCTGGGGG - Intronic
1089631533 11:119787456-119787478 GTGGCTGGTGGGGGCTAGGGAGG - Intergenic
1089775374 11:120832002-120832024 GAGGATGGTGTGGGACATGGAGG - Exonic
1090004150 11:122984994-122985016 GCGGCTGGTGGGTGGGGTGGGGG - Intergenic
1090776258 11:129968607-129968629 GAGGCTGGTGGGTAGTGAGGGGG - Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1092764049 12:11836691-11836713 GAGGGAGGTGGGTGAGAAGGGGG - Intronic
1096216146 12:49798420-49798442 GAGGCTGGTGGCTCTGATGGTGG + Exonic
1096240237 12:49955894-49955916 GAGGCAGGTGGGTGGTAAGAGGG + Exonic
1096345535 12:50842938-50842960 GAGGCTGGTGAGCAAGATGGCGG - Exonic
1096653289 12:53072939-53072961 GGGGCTGGGGGTTGATCTGGAGG - Intronic
1096797153 12:54085111-54085133 GAGGCTGGTGGGGGAAAGAGAGG - Intergenic
1097249555 12:57625028-57625050 GAGGCAGGTGGGTGTTCTGAGGG + Intronic
1098066112 12:66618412-66618434 CTGGCTGGTGGGGGATATGGAGG + Intronic
1098154192 12:67580083-67580105 GGGGCAGGGGGGTGATTTGGGGG + Intergenic
1100413472 12:94346601-94346623 GAGACTGGTGTCTGAAATGGTGG + Intronic
1101340607 12:103839706-103839728 GAAGCTGTTGTGTGGTATGGTGG - Intronic
1102084558 12:110125006-110125028 CAGGCTGGTGGGCGACTTGGGGG + Intronic
1102219850 12:111187215-111187237 CAGGCTGCTGGGTGATATGGAGG - Intronic
1102396317 12:112589151-112589173 GAGGCTGGAGGGGGAAGTGGGGG + Intronic
1102683033 12:114703311-114703333 GAGGCTGGTGGATGATGAGAAGG + Intergenic
1102933733 12:116880674-116880696 GGGGCTGGTGGGGATTATGGAGG + Intronic
1103463719 12:121125088-121125110 AAGGCAGGTGGGTGGGATGGTGG - Intergenic
1104510665 12:129374810-129374832 GAGGATGGAGGCTGGTATGGTGG + Intronic
1104928213 12:132324734-132324756 GAGGCTGGGGGGTGAGAAAGGGG - Intronic
1105899424 13:24742740-24742762 GTGGGTGGTGGGTGCTATGGAGG - Intergenic
1107819687 13:44275193-44275215 GAGGCTGGTGCCTGATAGTGGGG - Intergenic
1108038639 13:46318834-46318856 GAGACTGCTGGATCATATGGTGG - Intergenic
1112372044 13:98802647-98802669 GAGGCTGGAGGGTGATCATGAGG + Intronic
1113004142 13:105679407-105679429 GTGGCTGGCATGTGATATGGGGG + Intergenic
1113213965 13:108016765-108016787 GAGGTGGGTGGCTGATATGACGG + Intergenic
1116682388 14:47989598-47989620 GAGGCAAGTGGCTGATGTGGGGG + Intergenic
1117051063 14:51860169-51860191 GAGGCTGGTGTGGGATCTCGGGG + Intronic
1119415871 14:74468801-74468823 GAGGGTGGTGGGTGAGGTGATGG - Intergenic
1120791742 14:88590356-88590378 GAGGCAGGTGGGTGATGAGAAGG - Intronic
1121533916 14:94678009-94678031 GAGGCTGGTGTGGGCGATGGTGG - Intergenic
1121565851 14:94908546-94908568 GAGGCTGGTGTGGAAAATGGAGG + Intergenic
1122495631 14:102152644-102152666 GAGGCAGGTGGATCATATGAGGG - Intronic
1124067119 15:26354779-26354801 GAGTCTGGTGGTTGTTATGTTGG - Intergenic
1125797466 15:42413582-42413604 GAGGCATGTGGATGATTTGGTGG - Exonic
1127191844 15:56539575-56539597 GAGGCTGCTGGCTGAGCTGGCGG - Intergenic
1128534766 15:68482081-68482103 GAGGCTGGTGGGGGACCGGGGGG + Intergenic
1128759577 15:70206978-70207000 GATGATGGGGGGTGATCTGGGGG - Intergenic
1129144880 15:73637811-73637833 GAGGCTGCTGGGGGAAGTGGTGG - Intergenic
1129170702 15:73805840-73805862 GAGACTGGTGGGTGGGAGGGTGG - Intergenic
1129606013 15:77025361-77025383 GAGGCTGGTGGAGGGTTTGGGGG + Intronic
1130054363 15:80509571-80509593 GATGGTGGTGAGTGCTATGGAGG + Intronic
1132004478 15:98214254-98214276 GAGGCTGATGTGTGTTATAGGGG - Intergenic
1132019914 15:98351899-98351921 CAGGCTGGTGGCAGATATGGAGG + Intergenic
1135195373 16:20389776-20389798 GGGGCTGATGGGTGATGGGGAGG + Intronic
1135222471 16:20624846-20624868 GGGGCAGGTGGGTGGAATGGGGG - Intronic
1136236912 16:28919940-28919962 GAGTCTGGTGGGGGAGAGGGAGG + Exonic
1137482179 16:48861712-48861734 GAGAAAGGTGGGTGATATAGAGG + Intergenic
1141282766 16:82644048-82644070 TAGGATGGGGGGTGGTATGGAGG + Intronic
1141892384 16:86935022-86935044 GAAGCTGGTGGTTTATGTGGGGG + Intergenic
1141955581 16:87369251-87369273 GAGGCTGCACGGCGATATGGAGG - Intronic
1203137762 16_KI270728v1_random:1740020-1740042 GAAGCTGGCAGGTGATTTGGGGG + Intergenic
1143137564 17:4720293-4720315 GAGGCGGGTGAGTGTCATGGGGG + Exonic
1143740677 17:8951404-8951426 GAGGCTGGGGGGAGAAGTGGCGG - Intronic
1144798523 17:17909580-17909602 GAGGCTGCTGGGGGGTGTGGGGG + Intronic
1144948080 17:18980008-18980030 GTGGGTGGTGGATGCTATGGTGG + Intronic
1145400684 17:22529787-22529809 GACGATAGTGGGTCATATGGTGG - Intergenic
1146382767 17:32343214-32343236 GAGGCTGGAAGTTGACATGGAGG - Intronic
1146714522 17:35073477-35073499 AAGACTGGTGGGAGAGATGGTGG + Intronic
1146714579 17:35074244-35074266 AAGACTGGTGGGAGAGATGGTGG - Intronic
1146939130 17:36831929-36831951 GAGGCTGGTGGATTAGATGAAGG + Intergenic
1147652320 17:42069628-42069650 GTGGCTGTTGGCTGACATGGAGG - Intergenic
1148227642 17:45910107-45910129 GAGACAGGAGAGTGATATGGGGG + Intronic
1148754388 17:49965093-49965115 GGGGCCGGTGGGTGGGATGGAGG + Intergenic
1149289846 17:55207334-55207356 GAGACTGGAGGGTTATATGGGGG - Intergenic
1149973580 17:61243508-61243530 GGGACTGCTGGGTCATATGGTGG + Intronic
1151120034 17:71782853-71782875 GAGGGTTTTGGGTGATTTGGAGG - Intergenic
1151816563 17:76474157-76474179 AAGGCTGGTGGGTCATGTCGGGG + Intronic
1152001092 17:77645754-77645776 GAGCCTGGTGGTTTAGATGGGGG - Intergenic
1152068223 17:78122930-78122952 GTGGCTGGTGGGTGCTATGTTGG - Intronic
1152267490 17:79304819-79304841 GTGGCTGTTGGGTTATATGAGGG + Intronic
1152404969 17:80092452-80092474 GAGACTGGTGGCTGTCATGGCGG - Intronic
1152755056 17:82083741-82083763 GAGGCAGGTGGGGGCTGTGGGGG + Intronic
1153647254 18:7206324-7206346 GAGGCAGGTGGGAGATGCGGTGG - Intergenic
1154382695 18:13866982-13867004 GTGCCTGGTGGGTTATGTGGGGG - Intergenic
1156233036 18:35173497-35173519 GAGGCTGGTGGATGTAGTGGTGG - Intergenic
1156278430 18:35607586-35607608 GAGGCTGGGGGCTGGTATGGTGG + Intronic
1157441537 18:47715594-47715616 GTGGCTTGTGGGGGAAATGGGGG - Intergenic
1157468783 18:47971495-47971517 AAGGGTGGTGGTGGATATGGAGG - Intergenic
1157526999 18:48391170-48391192 GAGGCTGCTGCGTCACATGGCGG - Intronic
1157830644 18:50854246-50854268 CAGTGTGGTGGGTGAAATGGGGG + Intergenic
1157830702 18:50854660-50854682 GAGGCTGGTAGGTAATAAAGAGG + Intergenic
1159002820 18:62988464-62988486 GAGGTTGGCGGGTGGTGTGGGGG - Intergenic
1160742667 19:694731-694753 CAGGCTGGTGGGGGAGCTGGGGG - Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1162337875 19:10072851-10072873 GAGGGTGGGGGGTGATTGGGAGG + Intergenic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1163492174 19:17623422-17623444 GAGGATGGTGGGTGAGGAGGGGG + Intronic
1165060149 19:33201213-33201235 GAGGCTGGGGGGAGGGATGGAGG + Intronic
1165462364 19:35951624-35951646 GAGGGTGGAGGGTGATAAGGTGG + Intergenic
1166751082 19:45164261-45164283 GAGGCTGGTGGGTGGGGTCGGGG + Intronic
1167524214 19:49973476-49973498 GAGTCTGTTGGGAGAGATGGAGG - Intergenic
1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG + Intergenic
1168329614 19:55559645-55559667 TAGACTGGTGGGGGAGATGGAGG + Intergenic
1202688841 1_KI270712v1_random:72034-72056 GAAGCTGGCAGGTGATTTGGGGG - Intergenic
926962376 2:18372408-18372430 GAACCTGGTGGGTGTTCTGGTGG - Intergenic
927055994 2:19365945-19365967 GGGGCTGAAGGGTGATGTGGGGG + Intergenic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
932479405 2:72029790-72029812 GAGAATGGTGGGTGAAATCGAGG - Intergenic
932564671 2:72898376-72898398 CAGGCTGGTGGGGGAGAGGGTGG + Intergenic
933957594 2:87384065-87384087 GAAGCTGGCAGGTGATTTGGGGG + Intergenic
934241714 2:90275960-90275982 GAAGCTGGCAGGTGATTTGGGGG + Intergenic
934271458 2:91540725-91540747 GAAGCTGGCAGGTGATTTGGGGG - Intergenic
934516805 2:94993549-94993571 GATGCTGGTGGCTGAAATGAGGG + Intergenic
934857416 2:97737911-97737933 GAGGCAGGTGGGCGGTGTGGTGG + Intronic
937053023 2:118907697-118907719 GTGGCTGGGGGGTGTGATGGAGG + Intergenic
937309036 2:120890813-120890835 GAGGCTGGTGGGTTATAGCGAGG + Intronic
937478432 2:122235933-122235955 GTGTCTGGTGGGTGTCATGGAGG + Intergenic
937901208 2:127020583-127020605 CAGGGTGGTGGGTGAGGTGGTGG - Intergenic
940419423 2:153461881-153461903 GAAGAAGGTGGGTGAGATGGAGG + Intergenic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
942326461 2:174780707-174780729 GAGGCTGGTGCAAGATTTGGAGG + Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
944192271 2:197015790-197015812 TATGGTGGTGGGGGATATGGTGG + Intronic
945036288 2:205706734-205706756 CAGGCTGCTGGGTTAAATGGTGG + Intronic
946788870 2:223278169-223278191 GAGATTGCTGGGTCATATGGTGG + Intergenic
946877086 2:224140101-224140123 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
948567632 2:238896821-238896843 CAGGCTGGTGAGTGACAAGGAGG - Intronic
948676518 2:239600280-239600302 GAGGATTGTGGGTGATAATGAGG + Intergenic
1170134935 20:13062207-13062229 AAGCCTGGTGGGGGAGATGGGGG - Intronic
1173793197 20:45841258-45841280 GAGACTGGGGGGTGGTGTGGGGG - Exonic
1174203236 20:48821515-48821537 GAGGGAGGTGGGTGATAGGGTGG - Intronic
1175144594 20:56886090-56886112 GGGGGTGGAGGGTGATAAGGGGG + Intergenic
1175640339 20:60624281-60624303 CAGGCTGGTGGCTCAGATGGTGG - Intergenic
1175816677 20:61886713-61886735 GGGGCTGGTGAGTGCTCTGGAGG - Intronic
1175875019 20:62225308-62225330 GCTGCTGGTGAGTAATATGGGGG + Intergenic
1176235468 20:64051642-64051664 GCTGCTGGTGGGTGTTGTGGGGG - Intronic
1176375766 21:6086246-6086268 GGGGCCGGTGGGTCAGATGGGGG + Intergenic
1176932131 21:14826407-14826429 GAGGGTGGTGGCAGAAATGGTGG - Intergenic
1178351397 21:31874590-31874612 GAGAATGGTGGGTGATGAGGGGG - Intronic
1178839380 21:36126627-36126649 GAGGCTGTTGAGTGCCATGGGGG - Intergenic
1179046311 21:37848197-37848219 GAAGATGGTGGGAGATGTGGAGG + Intronic
1179398965 21:41066524-41066546 GTGGCTGGTGGGTGATGCAGGGG + Intergenic
1179587567 21:42383388-42383410 GAGGATGGTGGGTGCTGTGGAGG + Intronic
1179747708 21:43451998-43452020 GGGGCCGGTGGGTCAGATGGGGG - Intergenic
1179943831 21:44657122-44657144 GGTGCTGGTGGGTGGTCTGGGGG - Intronic
1180059003 21:45375169-45375191 GAGGCTGGTGGGTGACTTGCTGG + Intergenic
1180552584 22:16552563-16552585 GAAGCTGGCAGGTGATTTGGGGG + Intergenic
1180872799 22:19156469-19156491 GAAATTTGTGGGTGATATGGAGG - Intergenic
1181351450 22:22261469-22261491 GAAGCTGGCGGGTGATTTGGGGG - Intergenic
1181997917 22:26897641-26897663 GAGGCTGGTGGGAGGTGAGGGGG + Intergenic
1183303445 22:37069755-37069777 GAGGCTGGTGGGTCCTAGTGGGG + Intronic
1183862518 22:40680048-40680070 GAAGCTGGAGGGTGGTATGTGGG + Intronic
1184650763 22:45918604-45918626 GAGGCTGGTGGCCCATCTGGGGG - Intergenic
1185211027 22:49570580-49570602 GAGGCTGGTGGGGGGGGTGGTGG - Intronic
1185279812 22:49965259-49965281 GAGGCTGTAGGGTGAGATGAGGG - Intergenic
1185368180 22:50446473-50446495 GAGGCTTGGGGGTGAAAGGGTGG - Exonic
953705916 3:45230038-45230060 GAGGCTGGAGAGTGATGGGGAGG - Intergenic
955119225 3:56039085-56039107 TAGGCTGGTGAGTGGTATGAGGG - Intronic
955398757 3:58576152-58576174 GAAGCTGCTGGGAGATCTGGAGG - Intronic
955756252 3:62227968-62227990 GTGGCTGGATGGTGCTATGGTGG + Intronic
955809967 3:62777375-62777397 CAGGCTGCTGGGGGATGTGGAGG + Intronic
956215219 3:66841891-66841913 GTGGGTGGTAAGTGATATGGAGG - Intergenic
958065118 3:88534855-88534877 GGGGGTGGTGGGTGCTATGGGGG + Intergenic
958892983 3:99801000-99801022 GAGGCAGGTTGGTGATGTGGGGG - Intergenic
960886314 3:122399074-122399096 GAGGGTTGTGGGTGGTAGGGAGG - Intronic
960895818 3:122503927-122503949 GTGGCTGCTGGGTGTTTTGGGGG + Intronic
961378948 3:126484771-126484793 GAGGCTGGTGGGAGGTGTGAGGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961640321 3:128360876-128360898 GAAGGTGGTGGGTGGGATGGAGG - Intronic
961667592 3:128503401-128503423 GAGGCTGGTGTGTGAGGAGGGGG - Intergenic
962011215 3:131392699-131392721 GAGGTGGGTGGGTCACATGGTGG - Intergenic
962268190 3:133958348-133958370 GAGGCTGCTGGTGGATCTGGTGG + Intronic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
963941254 3:151098161-151098183 GAGGCTTTTGGGTATTATGGTGG + Intronic
964004531 3:151811968-151811990 GGGGCTGGTATGGGATATGGAGG - Intergenic
964335455 3:155649564-155649586 CAGGGTGCTGTGTGATATGGGGG - Intronic
965874388 3:173299461-173299483 GAGGCTGTTGTGGGAGATGGGGG + Intergenic
967094393 3:186164870-186164892 GAGGCTGTTGGGTGACAAAGAGG + Intronic
968762445 4:2449672-2449694 GTGGCTGGTAGGTGCTCTGGGGG - Exonic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969105002 4:4800524-4800546 TAGGATGGTGGGTCATTTGGGGG - Intergenic
969522698 4:7687871-7687893 GAGGCTGATGGGGGATAGCGAGG - Intronic
969599961 4:8170507-8170529 GTGGCTGGTGGAGGAGATGGTGG + Intergenic
970649933 4:18166478-18166500 GAGATTGGTGAGTAATATGGTGG - Intergenic
972464324 4:39339268-39339290 GAGACTGCTGGGTCATATGGTGG + Intronic
973639775 4:52891367-52891389 GAAGGTGGTGAGTGCTATGGAGG + Intronic
973641140 4:52904081-52904103 GAGGCTGGTGAGAGATGTGCTGG - Intronic
975708558 4:77135858-77135880 GTGGATGGTGGGTGTTATGGAGG + Intergenic
977420253 4:96790646-96790668 GAGGATTGTGGGTGAGTTGGAGG - Intergenic
978491000 4:109312296-109312318 GAGGGTGGAGGGTGGGATGGAGG - Intergenic
978947317 4:114515640-114515662 GGGGCTGGTGGGAAATCTGGAGG - Intergenic
979563321 4:122124610-122124632 GAGGGTGGAGGGAGGTATGGAGG - Intergenic
982216957 4:153090900-153090922 GAGGCTGGTTGGTGCCATGGGGG - Intergenic
985697958 5:1352500-1352522 GAGGCTGGTGGGGCCTATGTGGG + Intergenic
985777712 5:1853574-1853596 GAGGCAGGTGGGGCATATGTGGG - Intergenic
985827647 5:2204892-2204914 GAGGCTGGTGGGGGTTATCTGGG + Intergenic
986888319 5:12267833-12267855 GAGGCTGGAGGGTGAGAGGAAGG - Intergenic
987089289 5:14497118-14497140 GGGGCTGGTGGGTGGGAGGGAGG - Intronic
989168266 5:38451269-38451291 GATGTTGGTGGTTGATTTGGTGG + Intronic
990797061 5:59555343-59555365 GAGGGTGGAGGGTGGTATGAGGG + Intronic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
994085862 5:95758456-95758478 ATGGCTGGTGGGTGATGAGGTGG + Intronic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
994924267 5:106094024-106094046 GTGTGTGGTGAGTGATATGGTGG + Intergenic
995908744 5:117159628-117159650 GTGGGTGGTGGGTGGTCTGGAGG + Intergenic
996237406 5:121148731-121148753 GAGGTGGGAGGGTGAGATGGGGG - Intergenic
997294841 5:132762875-132762897 GGGGCTGGATGGTGATTTGGGGG - Intronic
997441038 5:133908797-133908819 GATGGTGGTGGCTGTTATGGTGG + Intergenic
998065353 5:139153565-139153587 GAGGCAAGTGGGTGTTGTGGTGG - Intronic
999665854 5:153912239-153912261 GAGGATGGTGGGTGAGAGGAGGG - Intergenic
1001261325 5:170232239-170232261 GAGGCTGGTGTGTACTATAGGGG + Intergenic
1001657810 5:173366208-173366230 GAGGCTGGAGGGTGAAAGGAGGG - Intergenic
1002878524 6:1232514-1232536 GAGGCGGGTGGGTGACATGTGGG - Intergenic
1003200901 6:3959539-3959561 GAGGCTGGTGGGGGAGGCGGAGG + Intergenic
1003327883 6:5106460-5106482 GATGATGGTGGGTTGTATGGTGG + Intronic
1004619706 6:17321988-17322010 GGGGCTGGTATGGGATATGGAGG + Intergenic
1006473286 6:34240048-34240070 GAAGCTAGTGGGTGAGGTGGGGG - Intronic
1006642128 6:35494956-35494978 GAGGCGGGTGGGTGATCCAGTGG - Intronic
1006781952 6:36637891-36637913 GAGGCTGGTAGAAGAGATGGTGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1007210413 6:40189358-40189380 GTGGGTGGTGGGGGATATGAAGG + Intergenic
1007255019 6:40522435-40522457 GAAGCTGGAGGGTGGTATGAGGG + Intronic
1007424485 6:41737866-41737888 GGGGCTGGTGGGTGCTATCAGGG - Intronic
1007925363 6:45645636-45645658 AAGGCTGGTTGGTTATCTGGGGG - Intronic
1009324903 6:62338198-62338220 GATTTGGGTGGGTGATATGGTGG + Intergenic
1010329673 6:74608531-74608553 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
1011504921 6:88030903-88030925 GAGGGTGGTGGGTGAGAGGAGGG + Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1015171385 6:130258665-130258687 GTGGTTGCTGGGTGATAAGGAGG - Intronic
1017451138 6:154555478-154555500 AAGGCTGGTGGGTGGGGTGGGGG + Intergenic
1017762059 6:157577005-157577027 GAGGGTGGAGGGTGGGATGGGGG - Intronic
1017882135 6:158569344-158569366 CAGGCTCGTGGGTGAGAGGGTGG - Intronic
1017956768 6:159185043-159185065 AAAGCTGGTGGTTTATATGGAGG + Intronic
1017995283 6:159526942-159526964 GATGTTGGTGGGCGGTATGGGGG - Intergenic
1019007818 6:168817090-168817112 GAGACTGGTGTGTGACTTGGGGG + Intergenic
1019812782 7:3176661-3176683 GAGGCAGGTGGGGGGTCTGGTGG + Intergenic
1022898216 7:34774322-34774344 AACCCTGGTGGGTGACATGGAGG + Intronic
1024126567 7:46303532-46303554 GTGGCTGGTGTCTGAAATGGGGG - Intergenic
1024874031 7:54000397-54000419 GGGGCAGGTTGGTGAGATGGGGG - Intergenic
1024956960 7:54932588-54932610 GAGATTGCTGGGTTATATGGTGG - Intergenic
1025255615 7:57382170-57382192 AAGGCTGTTGGGGGACATGGGGG + Intergenic
1026296165 7:69054117-69054139 GAGGGTGGAGGGTGAGAGGGGGG - Intergenic
1026809860 7:73454469-73454491 GAGGATGATATGTGATATGGGGG - Intronic
1027288800 7:76678967-76678989 GAGGTGGGTGGGTGGAATGGTGG - Intergenic
1027639845 7:80719439-80719461 GAGCTTAGTGGGTGAGATGGGGG + Intergenic
1027957140 7:84895111-84895133 GAGGGTGGAGGGTGAGAGGGTGG - Intergenic
1029514424 7:101016852-101016874 GGGGCTGGTGGGTGCTGAGGAGG + Intronic
1031894616 7:127334924-127334946 GAGACTGCTGGATGATATGGCGG - Intergenic
1032699907 7:134370471-134370493 TAGGGTGGTAGGTGACATGGTGG + Intergenic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033443335 7:141399356-141399378 GAAGCTAGTGGGAAATATGGAGG + Intronic
1033529113 7:142245259-142245281 GAGGCTGCTGGGTGGGATGAAGG + Intergenic
1034693928 7:153037517-153037539 GAGGCTGGGGGGTGGGGTGGGGG - Intergenic
1034953634 7:155318148-155318170 GATGATGGTGGATGATATGATGG - Intergenic
1035723717 8:1812285-1812307 GAGCCTGGGGGCTGATATGAGGG - Intergenic
1037796483 8:21999685-21999707 GAGGTGGGTGGGTGAGTTGGTGG + Intronic
1037813152 8:22098360-22098382 ACGGCTGGGGGGTGATTTGGGGG + Intronic
1038866944 8:31449326-31449348 CACACTGGTGGGTGATGTGGGGG + Intergenic
1039709681 8:40043045-40043067 GAGGCTGATGTGAGCTATGGTGG + Intergenic
1039826311 8:41176831-41176853 GAGGCTGGTGTGTGAGGTGGTGG - Intergenic
1039934922 8:42034022-42034044 GAGCAGGGTGGGTGATAAGGAGG + Intronic
1040323945 8:46331829-46331851 GGGGCTGGTGGGTCAGCTGGCGG - Intergenic
1040493481 8:47946337-47946359 GTGGCTGATGGGAGATGTGGGGG - Intronic
1041180625 8:55244209-55244231 GAGGCTGGAGGGTGAGAGGAGGG - Intronic
1042961115 8:74304441-74304463 GGGGCTGGTGGGTGAAATGAGGG + Intronic
1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG + Intergenic
1044126237 8:88461143-88461165 GAGGTTGGTGGGTGAGAGGAAGG - Intergenic
1044792998 8:95866782-95866804 GAGGGTGGTGGGGTATCTGGGGG + Intergenic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1045588935 8:103571354-103571376 GAGGCTTGTGTGTGTTAAGGTGG - Intronic
1047032357 8:120896390-120896412 GAGGCTGCTGTGGGGTATGGGGG - Intergenic
1047636507 8:126768798-126768820 GAGGCTGGGGAGGGAGATGGAGG + Intergenic
1048288498 8:133161781-133161803 GAGGCTGCTGGGTGCAATGTAGG + Intergenic
1049055622 8:140234369-140234391 GTGGCTGGTGGCTGCCATGGTGG + Intronic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1049747133 8:144267714-144267736 GAGGCTGGCAGGAGATGTGGGGG + Intronic
1052838164 9:33266606-33266628 GAGGCTGGGGATTGATCTGGTGG + Intronic
1055116808 9:72613666-72613688 GTGGGTGGTGGGTGCTGTGGGGG + Intronic
1055673663 9:78632843-78632865 CAGGCTGTTGGGTGAGAAGGAGG - Intergenic
1056034870 9:82593783-82593805 GAGGGTGGGGGGTGAGAAGGAGG + Intergenic
1056719169 9:89058566-89058588 GATGCTGGTGGAGGATGTGGTGG + Intronic
1057161149 9:92889290-92889312 GAGGCTGGTGGGTAGTAGGAAGG - Intergenic
1057676147 9:97137597-97137619 GAGGGTGGTGGGTAGTAGGGAGG - Intergenic
1057851568 9:98570629-98570651 CAGGCTGGTGGGAGATCTGCAGG + Intronic
1057899283 9:98935506-98935528 GTGGCTGATGTGTGATAGGGAGG + Intergenic
1058012976 9:99998886-99998908 GAGACTGCTGGGGGAGATGGAGG - Intronic
1060092698 9:120758189-120758211 GAGGCTGGAGTGGGGTATGGTGG + Exonic
1060150633 9:121286118-121286140 GAGGCTGGGGGGAGCTATGTGGG - Intronic
1060196865 9:121629470-121629492 GAGGGTGGTGGTGGGTATGGCGG + Intronic
1060552208 9:124491019-124491041 GAGGCGGGTGGGTGGGAGGGTGG - Intronic
1061056419 9:128225186-128225208 GAGGCTGGAGGGTGGAATCGAGG - Intronic
1061178315 9:129010237-129010259 GAAGCTGGTGGGTGGTGTGTGGG - Intronic
1062648556 9:137563680-137563702 GAGGCTGGTGGGCTTAATGGTGG + Intronic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1188421943 X:30000763-30000785 GAGGCTGGTGTGTGTGGTGGTGG + Intergenic
1189205731 X:39237180-39237202 GAGGCTGGAGGGTGGTTTGCTGG - Intergenic
1189327304 X:40120610-40120632 GTGGCTGGTGGCTGCTGTGGGGG - Intronic
1190295991 X:49028028-49028050 CAGTCTGGTGGGGGAAATGGAGG + Intergenic
1192200837 X:69065790-69065812 GAGGCTGGTGTGTAATGAGGTGG - Intergenic
1192631539 X:72781514-72781536 GAGGCGGGAGGGTCATGTGGAGG - Intronic
1192650170 X:72939287-72939309 GAGGCGGGAGGGTCATGTGGAGG + Intronic
1192991273 X:76460197-76460219 GAGGCTGGTGGATCATTTGAGGG - Intergenic
1194179253 X:90692541-90692563 GAGGGTGGAGGGTGATAGGAGGG + Intergenic
1194478272 X:94388093-94388115 GAGGCAGGTGGGGGAAGTGGAGG + Intergenic
1195969555 X:110458417-110458439 GAGGTTGGTGGGTGAGAGGATGG - Intergenic
1199720939 X:150542341-150542363 GAGGGTTGTGGGTGTGATGGGGG + Intergenic
1200136695 X:153878712-153878734 GAGGCTTTTGGGTGCTCTGGAGG + Intronic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic