ID: 920547278

View in Genome Browser
Species Human (GRCh38)
Location 1:206828957-206828979
Sequence CCTCATGCACACCTGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920547278 Original CRISPR CCTCATGCACACCTGTAGTC AGG (reversed) Intronic
900277559 1:1841608-1841630 TCACATGCACACATCTAGTCTGG + Intronic
900888886 1:5434989-5435011 CCTAATGCACACCTGTAATGTGG - Intergenic
904286038 1:29453837-29453859 TCTCAGTTACACCTGTAGTCAGG + Intergenic
904372570 1:30059146-30059168 CCTCAGGCACAGCTGGACTCAGG + Intergenic
906684154 1:47752240-47752262 CTTCATGCTCACCAGTAGGCAGG + Intergenic
908790144 1:67773014-67773036 CTTCAGGCACAGCTGTATTCAGG - Intronic
910427112 1:87129280-87129302 CCTCATGAACACCTATTGTGAGG + Intronic
919885693 1:201932615-201932637 GGTGGTGCACACCTGTAGTCAGG + Intronic
920547278 1:206828957-206828979 CCTCATGCACACCTGTAGTCAGG - Intronic
922345841 1:224695743-224695765 GCTCAGGCTCCCCTGTAGTCTGG + Intronic
1069787702 10:70999227-70999249 CCTCATTCGCACCTGGAGTAAGG - Intergenic
1076696604 10:132250210-132250232 CCTCACACACACCTGTCCTCAGG - Intronic
1076696696 10:132250668-132250690 CCTCACACACACCTGCACTCGGG - Intronic
1076745682 10:132512423-132512445 CCTCTTGCCCACCTGTGGCCAGG + Intergenic
1077552358 11:3206284-3206306 GCTCAGGTACACCTGGAGTCAGG - Intergenic
1077707113 11:4497467-4497489 CCTCAGGCTCCCCTGTAGCCTGG - Intergenic
1080065944 11:28013451-28013473 CCTCACGCAAACCTGGATTCAGG + Intergenic
1082894067 11:58171515-58171537 CCTCATGCAGAACTGCAGTTCGG + Intronic
1084291334 11:68170747-68170769 CCTTAAGCACATCTGTATTCTGG + Intronic
1084328053 11:68413115-68413137 CCGCATGCAAACCTGTTGCCAGG + Intronic
1085880494 11:80462445-80462467 GCTCATGCACACATGGAGACGGG + Intergenic
1086178744 11:83923995-83924017 CCTCAGCCACACAGGTAGTCTGG + Intronic
1087728107 11:101745991-101746013 TCTCATGCACAACTGTGGTCAGG - Intronic
1088892969 11:114059330-114059352 CCCCATGCACTCCTGTCCTCTGG + Intergenic
1089879850 11:121763020-121763042 CCTCAAGCATCCCTGGAGTCTGG - Intergenic
1090927890 11:131267582-131267604 CCTCATACAGACATGTAGTAGGG + Intergenic
1091265786 11:134270101-134270123 CCTCATCCACCCCTGGTGTCTGG - Intergenic
1091287026 11:134413143-134413165 GCTCTTGGACACCTGTATTCGGG + Intergenic
1096304531 12:50462804-50462826 CCTCTAGCACACATGTAGTAAGG + Intronic
1099343532 12:81469442-81469464 CCGCATGCACCCCTGTAGGAGGG + Intronic
1100656938 12:96656963-96656985 CAGTATGCACACCTGAAGTCAGG - Intronic
1102690222 12:114754662-114754684 AGTGGTGCACACCTGTAGTCAGG - Intergenic
1105750711 13:23420103-23420125 CCTCATGTCCACCTGTGGTGTGG + Intronic
1107338760 13:39383804-39383826 CCACATTCACACCTGCAGCCAGG + Intronic
1112409810 13:99153233-99153255 CCCCCTGCACACCTGTATTTAGG - Intergenic
1114076795 14:19165530-19165552 CTTGATGCACACCTTTAGTCAGG + Intergenic
1114085368 14:19234038-19234060 CTTGATGCACACCTTTAGTCAGG - Intergenic
1115836698 14:37413704-37413726 TCTCATGCCCACATGTAATCTGG - Intronic
1116646368 14:47534241-47534263 CCTCAATCACACCTCTACTCTGG - Intronic
1122416018 14:101549825-101549847 CCTCATGACCACCTGCAGTGGGG - Intergenic
1122574262 14:102731868-102731890 CCTCATCTACACCTGTATACAGG - Intergenic
1122647749 14:103206414-103206436 CCTCCTGCACTCCTCTTGTCTGG - Intergenic
1124067782 15:26362165-26362187 CCTCATGGACACCTCTACACGGG - Intergenic
1124249502 15:28097598-28097620 CCTCATCCTCACCTGTGGACAGG + Intronic
1129672659 15:77615889-77615911 CCTCTTGCTCACCTGCAGCCGGG + Exonic
1129877341 15:78984274-78984296 CCTCCTGCACACATGCAGGCTGG + Intronic
1130184232 15:81664309-81664331 CCTCAGGAACACCTGAGGTCAGG - Intergenic
1132669009 16:1095135-1095157 CACCCTGCACACCTGGAGTCGGG + Intronic
1132881162 16:2162323-2162345 CTCCCTGCACACCTGTAGGCCGG + Intronic
1133895844 16:9928165-9928187 GCTCATTCACACCTGCAGGCAGG + Intronic
1134639926 16:15822156-15822178 TCTCAGGCACACCTGGATTCCGG + Intronic
1137432581 16:48430265-48430287 GGTGGTGCACACCTGTAGTCGGG + Intronic
1141256980 16:82411603-82411625 CCTCTTGGACATCTGTAGTGTGG + Intergenic
1142622611 17:1174487-1174509 GCTCATGCTCACCTGGAGACAGG + Intronic
1143095437 17:4476248-4476270 CCTCAGACACACCTGGAGGCCGG - Intronic
1145303387 17:21655557-21655579 CCTCATATCCACCTGTAGTATGG - Intergenic
1145346654 17:22046283-22046305 CCTCATATCCACCTGTAGTATGG + Intergenic
1145347277 17:22049023-22049045 CCTGATGCTCACCTGTAGGCTGG + Intergenic
1148106129 17:45119978-45120000 GCACATGCACACCTGTAGGCTGG + Intronic
1148544706 17:48508764-48508786 CCACATGCACACCTGTACCATGG - Intergenic
1150713292 17:67549698-67549720 CCTCATGCATAGTAGTAGTCCGG - Intronic
1152735325 17:81994445-81994467 GCTCACGGACACCTGTACTCAGG - Intronic
1154207933 18:12354021-12354043 CCTCAGACAAACCTGCAGTCAGG + Intronic
1154950970 18:21209459-21209481 CAACAGGCACACCTGTAGTTGGG - Intergenic
1156503374 18:37574123-37574145 CCTGATGCACACCTGCCTTCAGG + Intergenic
1157407002 18:47430076-47430098 CCTCATGGACACCTTCAGCCTGG + Intergenic
1159752499 18:72319703-72319725 GGTGATGCACACCTGTACTCGGG + Intergenic
1166590723 19:43995939-43995961 CCTCATGCAAACCAGAAATCAGG + Intronic
1166792573 19:45406661-45406683 CCTCAGGCAACCCTGTAGCCCGG - Exonic
929745858 2:44657602-44657624 CCCCAGGAACACTTGTAGTCAGG - Intronic
933490231 2:82976958-82976980 CCTCAGCCTCACGTGTAGTCGGG + Intergenic
933523705 2:83409048-83409070 CCTCATTCACCCCAGTGGTCAGG + Intergenic
934619454 2:95795174-95795196 CCCCAAGCCCACCTGTACTCAGG - Intergenic
934641436 2:96029383-96029405 CCCCAAGCCCACCTGTACTCAGG + Intronic
935946389 2:108290126-108290148 CCCAATGTACACCTGTAGGCAGG - Intronic
936046010 2:109188431-109188453 CTTCATCCACACCTGTTGTGTGG - Intronic
937335769 2:121061556-121061578 CCTCAGGATCACCTGCAGTCAGG - Intergenic
938243975 2:129763403-129763425 GTTCATGCAAACCTGTGGTCAGG - Intergenic
938490788 2:131759955-131759977 CCTCATGTACACCTGGGGACTGG + Intronic
941204049 2:162549187-162549209 CCTCATGCATCTCTGAAGTCAGG - Intronic
948317490 2:237039540-237039562 CTTCCTGCACACCTGGAGCCCGG - Intergenic
1170621127 20:17997148-17997170 GGTGGTGCACACCTGTAGTCAGG + Intronic
1171520270 20:25770434-25770456 CCTGATGTACACCTGGAGTCCGG - Intronic
1171520282 20:25770490-25770512 CCTGATGCTCACCTGTAGGCTGG - Intronic
1171520902 20:25773248-25773270 CCTGATACCCACCTGTAGTATGG - Intronic
1171556637 20:26086003-26086025 CCTGATGCTCACCTGTAGGCTGG + Intergenic
1171556649 20:26086059-26086081 CCTGATGTACACCTGGAGTCCGG + Intergenic
1175158803 20:56992722-56992744 CCTCATGGATACCTATAGGCCGG + Intergenic
1176654418 21:9576777-9576799 CCTGATGCTCACCTGTAGGCTGG - Intergenic
1176654757 21:9578353-9578375 CCTCATATCCACCTGTAGTATGG - Intergenic
1180292603 22:10859155-10859177 CTTGATGCACACCTTTAGTCAGG + Intergenic
1180494930 22:15886170-15886192 CCTTATGCCCACCAGGAGTCTGG + Intergenic
1180495408 22:15888577-15888599 CTTGATGCACACCTTTAGTCAGG + Intergenic
1180881050 22:19203724-19203746 GCCCATGCACATCTCTAGTCTGG + Intronic
1181833007 22:25578236-25578258 TCTCACCCACACCTGGAGTCAGG - Intronic
1184927718 22:47655535-47655557 TCTCCTGCACACCTGCACTCTGG - Intergenic
1185048612 22:48541649-48541671 CCCCATGCAGACCTGCAGTGAGG + Intronic
1185064417 22:48623631-48623653 CCTCCTGCACACCTGTCTGCAGG - Intronic
1185339154 22:50283909-50283931 CACCACGCACACCTGTAGTCGGG + Exonic
952808637 3:37381476-37381498 CCTCATTAACACCTGGAGTTGGG + Intergenic
953221978 3:40979956-40979978 CCTCAGGGACACCTGGACTCAGG + Intergenic
956262955 3:67364594-67364616 CTTCATTCACACCTGAAGTGAGG - Intronic
966922902 3:184625930-184625952 CCACCTGCCCACCTGTAGTGTGG + Intronic
969095712 4:4731126-4731148 CATCATGGACACATGTCGTCAGG - Intergenic
970620155 4:17810264-17810286 CCTTATGCACACTTGTAAACAGG + Intronic
970978279 4:22066922-22066944 CCTGATCCAGACCTGTAGACTGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
974492736 4:62588259-62588281 CCCCATGCAAATCTGAAGTCTGG + Intergenic
976334798 4:83873007-83873029 GGTGGTGCACACCTGTAGTCAGG - Intergenic
980663644 4:135899730-135899752 CAGCATGCACACCTGTAGCCTGG + Intergenic
985599315 5:818214-818236 CCACATGCACACCTGCTGCCGGG - Intronic
986944239 5:12995322-12995344 CCACGTGCCCACCTGTTGTCAGG - Intergenic
990449200 5:55919206-55919228 CCTCCTGCCCACCTGTAGTTGGG + Intronic
991294723 5:65068588-65068610 CCTCATTGACAGCTGTAGGCAGG + Intergenic
995138870 5:108710794-108710816 CCTAATGCAAACTTGTAGCCAGG - Intergenic
995832821 5:116372751-116372773 CCAGTTGCACACATGTAGTCAGG - Intronic
999046636 5:148476857-148476879 CCTCATGCAGTCCTGGAGGCTGG + Intronic
1000188175 5:158881441-158881463 CCTCTTGCCCATCTGTAGCCAGG - Intronic
1001528480 5:172445834-172445856 CCAGATGCACACCTGCAGGCGGG - Intronic
1001794515 5:174490949-174490971 CCTCATTCCCACCTGTTGCCTGG - Intergenic
1002468504 5:179420657-179420679 CCTCCTGCAAACCTGTAGCCAGG + Intergenic
1006603028 6:35238341-35238363 CCTCATGCACACACACAGTCAGG - Intronic
1006882601 6:37353268-37353290 GGTGGTGCACACCTGTAGTCCGG - Intergenic
1007213398 6:40216510-40216532 CCTCCTGCACCCCTGAGGTCTGG - Intergenic
1007472307 6:42098903-42098925 CCTCATGCTCACCTGTACCAGGG - Intergenic
1007491809 6:42228926-42228948 CCTCCTGTCCACCTGGAGTCTGG + Intronic
1007930841 6:45689245-45689267 CCTCATCCCCACCAGTAGCCAGG + Intergenic
1012524463 6:100160592-100160614 CCTGTTGCACACTTGTACTCTGG - Intergenic
1019293649 7:262473-262495 GCTCATGCACGGCTGGAGTCTGG + Intergenic
1023673584 7:42605737-42605759 CCTCAAGGACAGCTGTGGTCAGG + Intergenic
1023951387 7:44848603-44848625 CCTCATGCTCAGCCGTATTCTGG + Intergenic
1025280777 7:57625445-57625467 CCTGATGCTCACCTGTAGGCTGG - Intergenic
1025303953 7:57840062-57840084 CCTGATGCTCACCTGTAGGCTGG + Intergenic
1028610988 7:92711403-92711425 CCTCATGCACACCCATACTGAGG + Intronic
1035578988 8:728137-728159 CCTGAAGCACACATGGAGTCAGG + Intronic
1035599887 8:891167-891189 CCTCAATCACACCTGTGGCCTGG - Intergenic
1037576861 8:20214182-20214204 GAACATGCACACCTATAGTCTGG + Intronic
1047861231 8:128969631-128969653 GCTCATGCACATATGGAGTCTGG + Intergenic
1057089566 9:92245003-92245025 CCTCATGTACACCTTTGATCAGG - Exonic
1059720220 9:116952699-116952721 CATCATCCACACCTGCTGTCAGG + Intronic
1060647222 9:125291333-125291355 CCTCATCCACACATGTAGCTGGG - Intronic
1060981965 9:127798013-127798035 GCTCATGCACTGCTGAAGTCGGG + Intronic
1061657409 9:132103329-132103351 CCCTGTGCACACCTGTGGTCTGG - Intergenic
1203632139 Un_KI270750v1:80235-80257 CCTGATGCTCACCTGTAGGCTGG - Intergenic
1203632482 Un_KI270750v1:81811-81833 CCTCATATCCACCTGTAGTATGG - Intergenic
1188757944 X:33987427-33987449 CCCCATGCACAGCTGCTGTCTGG - Intergenic
1193524436 X:82572345-82572367 CCTCTGGCACACCTGTGGCCTGG - Intergenic