ID: 920550438

View in Genome Browser
Species Human (GRCh38)
Location 1:206856175-206856197
Sequence TTGGGAAGTTAAGCCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920550438_920550441 -1 Left 920550438 1:206856175-206856197 CCAGCACAGGCTTAACTTCCCAA No data
Right 920550441 1:206856197-206856219 AGAACTGCAGCGCTTCCCCCAGG No data
920550438_920550442 0 Left 920550438 1:206856175-206856197 CCAGCACAGGCTTAACTTCCCAA No data
Right 920550442 1:206856198-206856220 GAACTGCAGCGCTTCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920550438 Original CRISPR TTGGGAAGTTAAGCCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr