ID: 920552240

View in Genome Browser
Species Human (GRCh38)
Location 1:206872294-206872316
Sequence CTGAATATACAAACAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920552232_920552240 30 Left 920552232 1:206872241-206872263 CCTTAAATAGGCCACTCCCCTTC No data
Right 920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG No data
920552236_920552240 19 Left 920552236 1:206872252-206872274 CCACTCCCCTTCTCTGGAGGGAG No data
Right 920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG No data
920552237_920552240 14 Left 920552237 1:206872257-206872279 CCCCTTCTCTGGAGGGAGTACAT No data
Right 920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG No data
920552239_920552240 12 Left 920552239 1:206872259-206872281 CCTTCTCTGGAGGGAGTACATAT No data
Right 920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG No data
920552238_920552240 13 Left 920552238 1:206872258-206872280 CCCTTCTCTGGAGGGAGTACATA No data
Right 920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920552240 Original CRISPR CTGAATATACAAACAGACAG TGG Intergenic
No off target data available for this crispr