ID: 920553603

View in Genome Browser
Species Human (GRCh38)
Location 1:206886433-206886455
Sequence GTGAGTGGTGGGTGAGTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920553599_920553603 -7 Left 920553599 1:206886417-206886439 CCAGGCTGCACAAAAGGTGAGTG No data
Right 920553603 1:206886433-206886455 GTGAGTGGTGGGTGAGTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920553603 Original CRISPR GTGAGTGGTGGGTGAGTGAG CGG Intergenic
No off target data available for this crispr