ID: 920557244

View in Genome Browser
Species Human (GRCh38)
Location 1:206913162-206913184
Sequence AAAGAAGCAGAGAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1285
Summary {0: 1, 1: 0, 2: 5, 3: 99, 4: 1180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920557235_920557244 19 Left 920557235 1:206913120-206913142 CCAAAGTGGATGACAGTGAGGGG 0: 1
1: 0
2: 1
3: 26
4: 350
Right 920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG 0: 1
1: 0
2: 5
3: 99
4: 1180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920557244 Original CRISPR AAAGAAGCAGAGAAGGAGCT GGG Intronic
900114468 1:1022594-1022616 GGAGAAGCAGAGAATGAGGTTGG - Intronic
900133982 1:1106135-1106157 AAGGAAGCAAAGGAGGAGCAGGG + Intronic
900682633 1:3925286-3925308 AAAGAGACAGTGATGGAGCTAGG - Intergenic
900840621 1:5046015-5046037 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
900971656 1:5995326-5995348 ACAGAGGCAGTGACGGAGCTGGG + Intronic
901203581 1:7481078-7481100 AGAGAGGGAGAGAAGGAGGTGGG - Intronic
901329885 1:8398256-8398278 AAAGCAGTAGGGAAGGGGCTTGG + Intronic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
901745443 1:11370059-11370081 ACAGAAGTGGAGAAGGAACTGGG + Intergenic
901871668 1:12142206-12142228 AAAGAGGCAGAGAAGGGCCGAGG - Intronic
902166038 1:14572368-14572390 AGGGAAGAAGAGAATGAGCTGGG + Intergenic
902675372 1:18005078-18005100 GAAGAAACAGAGAAGGGGCTTGG + Intergenic
902688913 1:18097380-18097402 AAAGAGGGAGAGAAGGAGGGAGG - Intergenic
903133401 1:21293594-21293616 AAATCAGCAGAGATGGAGCCTGG + Intronic
903516690 1:23916006-23916028 AAAGAAGACCAGAAGGAGCTGGG + Intergenic
904599517 1:31665833-31665855 AGGGAGGCAGGGAAGGAGCTGGG - Intronic
905002989 1:34688069-34688091 AAAGAGGAAGCTAAGGAGCTGGG - Intergenic
905253964 1:36668085-36668107 AGGGAAGCAGGGTAGGAGCTAGG + Intergenic
905422175 1:37855064-37855086 AAAGAAGAAAAAAAGGACCTTGG + Intronic
905589150 1:39147104-39147126 AAAGAAGAAAAGAAGGAGGGAGG - Intronic
905858896 1:41333098-41333120 AAAGATGCAGAGAAGGAAGGTGG - Intergenic
906069882 1:43008635-43008657 AAAGCAGGAGAGACGGGGCTAGG - Intergenic
906287389 1:44596264-44596286 AAAAAGACAGAGAAGGGGCTGGG + Intronic
906340220 1:44973056-44973078 AAAGAAAGAGAGAAAGAGGTTGG + Intronic
906497350 1:46314373-46314395 AAAAAAAAAGAGAAGGGGCTGGG + Intronic
906518460 1:46453325-46453347 ACAGAAGCAGAGAGGGAGAGAGG + Intergenic
906546237 1:46621192-46621214 CCAGCAGCAGAGAAGGGGCTAGG - Intergenic
906553800 1:46690521-46690543 AAAGGAGGAGAGAAGGAGGGGGG + Intronic
906659372 1:47571685-47571707 GAAGAAGGAGAGAAGGAGGGAGG - Intergenic
906944327 1:50282951-50282973 AAAGAATCAGTGGAGGATCTAGG + Intergenic
907718286 1:56948142-56948164 AGAGAAGGAGAGAAGGAAATGGG + Intronic
907792230 1:57678148-57678170 AAAGAAGTAGAGAAAGAGGAAGG + Intronic
907806892 1:57829688-57829710 AAGGTGGCAGAGAAAGAGCTGGG - Intronic
907855934 1:58303479-58303501 AAAGTAGCAAAGAAAGAACTTGG + Intronic
907865612 1:58396764-58396786 AAAGAAACAGAGAGGGAGTCCGG + Intronic
908029287 1:59982722-59982744 AAAGGAAAAGAAAAGGAGCTAGG - Intergenic
908465851 1:64393900-64393922 AAAGAAAGAGAGAAAGAGCATGG + Intergenic
909222816 1:72984364-72984386 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
909245645 1:73279251-73279273 AAAGAAGCATTGAAGAAGATAGG + Intergenic
909423958 1:75499681-75499703 AAATAAGAAGAGAAAGAGATAGG - Intronic
909565889 1:77053195-77053217 AAAGAAGCAGAGAACTATTTGGG + Intronic
909867501 1:80692708-80692730 AAATAAGGAGAGAAGGAAATAGG - Intergenic
909920595 1:81376508-81376530 AAAGAAGGAGAGAAGGAAGGAGG - Intronic
909974492 1:82029411-82029433 AAAGAGGCAGAGAAGGACAAAGG + Intergenic
909978614 1:82072046-82072068 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
910009818 1:82447774-82447796 AAAGAGGCAGAGGATGAGGTAGG + Intergenic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911730821 1:101290804-101290826 AAGGAAGCAGAGAAGGAATCTGG - Intergenic
912163735 1:107017834-107017856 AAAAATGCAGAAAATGAGCTGGG - Intergenic
912310644 1:108617664-108617686 AAAGAACCAGAGACTGAGGTGGG + Intronic
912449557 1:109760749-109760771 GAACAAGCAGGGAGGGAGCTGGG - Intronic
912503934 1:110142586-110142608 AAAGAAACAGAGAACAAGCAGGG - Intergenic
913127722 1:115808572-115808594 AAAGAAAGAAAGAAGGAACTTGG - Intergenic
913453665 1:119009123-119009145 AAAGAAGAAGAAAAGGGGATGGG - Intergenic
913697403 1:121340809-121340831 AAAGAGGCAGGAAAGGAACTTGG - Intronic
913969122 1:143401057-143401079 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
914063499 1:144226656-144226678 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
914115651 1:144739698-144739720 AAAGAAGAAGAGAGGGAGGGAGG + Intergenic
914140156 1:144939243-144939265 AAAGAGGCAGGAAAGGAACTTGG + Intronic
914210552 1:145574864-145574886 AAAGAAGAAAAGAAGGAGAAGGG - Intergenic
914404304 1:147355686-147355708 AGAAAGGCAGAGAAGGAGCATGG - Intergenic
914511895 1:148340386-148340408 CAAGAGGCTGAGAAGGAGATAGG - Intergenic
914989162 1:152483392-152483414 AAAGAGGAGGAGAAAGAGCTGGG - Intergenic
915079185 1:153339929-153339951 CTAGAAGCAGAGAAGCAGCACGG + Intronic
915089935 1:153417159-153417181 AAAGAACCAGAAAAGGACCTTGG - Intronic
915095546 1:153459916-153459938 AAAGAACCAGGAAAGGACCTTGG + Intronic
915128968 1:153684057-153684079 CAAGAAGCAGAGAAGTTGATGGG + Intronic
915469879 1:156119563-156119585 AAAGAGACAGAGAAGGGGCAGGG - Intronic
915971816 1:160360491-160360513 CAGGAAGCAGAGAAGTGGCTGGG + Intergenic
915987814 1:160483733-160483755 AAAGAGCCTGAGAAGCAGCTAGG + Intergenic
916413758 1:164574118-164574140 AAAAACACAGAGAAGGAGGTGGG - Intronic
916415349 1:164587490-164587512 AAAGAGGCAGATAAAGTGCTGGG - Intronic
916434096 1:164760444-164760466 AAAGAAGGAGAGAAGGAGGAAGG - Intronic
916623251 1:166524951-166524973 AAATGAGGAGAGAAAGAGCTGGG + Intergenic
916909413 1:169329736-169329758 GAAGAAGTAGAGAAAGAGATAGG + Intronic
917001670 1:170367703-170367725 AAAGAAGGAGAGAGAAAGCTGGG - Intergenic
917189261 1:172396468-172396490 AAAGAAGCAGGGAAGGAATGGGG - Intronic
917232902 1:172857131-172857153 AGAGAAGGAGAGAAGGTGATAGG + Intergenic
917448247 1:175124807-175124829 AAGGAAGGGGAGAAGGAGGTAGG - Intronic
917506831 1:175634991-175635013 AAAGGAGCAGAGGAGGGGCTAGG - Intronic
918069147 1:181122335-181122357 AGAGAAGCAGAAACAGAGCTGGG + Intergenic
918134703 1:181661322-181661344 GGAGAAGCAGAGAAGCAGCGGGG + Intronic
918169494 1:181982894-181982916 AATGAAGCAGAGCAAGATCTGGG - Intergenic
918276386 1:182957072-182957094 AAAGGAGGAGAGAAGGAGGGGGG + Intergenic
918319161 1:183348516-183348538 AAAAAATCAGAGAAGGAGATTGG + Intronic
918338449 1:183545880-183545902 AAAGAATCACAGAATGAACTTGG - Intronic
918714568 1:187770028-187770050 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
919196317 1:194291032-194291054 AAAGAAGAAGAGAAGGGGCGAGG + Intergenic
919373455 1:196762268-196762290 GAAGAAGTAGAGAACGAGATAGG - Intergenic
919379896 1:196846945-196846967 GAAGAAGTAGAGAACGAGATAGG - Intronic
919576960 1:199322393-199322415 AAAGAAGCAAAGCAGAAGCCAGG - Intergenic
919839677 1:201599691-201599713 AGAGAATCAGAGCAGGCGCTCGG - Intergenic
920214258 1:204350969-204350991 AAAGAGGCAGAGAAGGACAAGGG - Intronic
920237967 1:204521908-204521930 AATAAAGCAGGGAAGGAGATAGG + Intronic
920484736 1:206359141-206359163 AAAGAGGCAGGAAAGGAACTTGG - Intronic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
920956041 1:210620971-210620993 AAGGAAGCACGGTAGGAGCTGGG + Intronic
921212251 1:212910668-212910690 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
921499548 1:215884406-215884428 AAAGAAGTAGAGAAGAACATAGG + Intronic
922094858 1:222434672-222434694 AGAGAAGCAGAGGAAGGGCTGGG - Intergenic
922143595 1:222915919-222915941 AAAGAAACAGCAAAGGAGATGGG - Intronic
922928288 1:229368845-229368867 AAAGAAGCAAAGATGAGGCTGGG - Intergenic
924817681 1:247457026-247457048 GAAGAGGAGGAGAAGGAGCTGGG + Intergenic
924908010 1:248477627-248477649 AAAGAAGCAAAGAAGCAGGTAGG - Intergenic
924916098 1:248570456-248570478 AAAGAAGCAAAGAAGCAGGTAGG + Intergenic
1062946761 10:1467410-1467432 GAAGAAACTGAGAAGGAGATGGG - Intronic
1063001867 10:1932315-1932337 AAAGAAGGAGAGAAGGAGGGAGG + Intergenic
1063105304 10:2987154-2987176 AAAGAGGGAGAGAAGGAGGGAGG - Intergenic
1063107093 10:3001919-3001941 AAAGAAACAGAGAAGGAGAGTGG + Intergenic
1063218767 10:3947077-3947099 AAAGAAAGAGGGAGGGAGCTAGG - Intergenic
1063599462 10:7467086-7467108 GAAGAAGAAGAGAAAGGGCTTGG + Intergenic
1063623987 10:7672149-7672171 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
1063702002 10:8394024-8394046 AAAGAAGCAAAAAAGGCTCTTGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1064249086 10:13693210-13693232 AAAGAAGCAGAGAGGAAGGGAGG - Intronic
1064355528 10:14614375-14614397 AAAGAGACAGAGAAGGAGTCAGG + Intronic
1065433551 10:25683994-25684016 AGAGAAGCACAAAATGAGCTTGG - Intergenic
1065638273 10:27753127-27753149 AAAGAGGGAGAGAAGGAGAAAGG - Intergenic
1065639817 10:27770370-27770392 AACGAAGGAGAGAAGGAGGGAGG - Intergenic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1065874319 10:29983816-29983838 AAAGAAGGAGGGAAGGAGGGAGG + Intergenic
1067306518 10:45069722-45069744 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1067550291 10:47229577-47229599 AAATAAGCAGAAATGGAGCCAGG + Intergenic
1067934947 10:50602225-50602247 GAAGAAGCAGAGATGGGGCAGGG - Intronic
1068885615 10:62093635-62093657 AAAAAAGACGAGAAGGAACTGGG - Exonic
1068942472 10:62693142-62693164 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
1069726111 10:70580170-70580192 AAAGAAGGAGAGAATGAGGATGG - Intergenic
1069930365 10:71877711-71877733 AATGAAGGAGTGAAGGAACTTGG + Intergenic
1070448024 10:76527063-76527085 AAAAAAGAAGAGGTGGAGCTGGG + Intronic
1070664403 10:78333111-78333133 AATGGAGCAGAGAAGGAGAAGGG + Intergenic
1070678789 10:78434405-78434427 ACCGAAGCAGAGAAGGAGTGGGG - Intergenic
1070761944 10:79029427-79029449 AAAGAAGGAAAGAAGGAGGCTGG - Intergenic
1070871504 10:79758074-79758096 GAAGAAGCAAAGCAGAAGCTTGG + Intergenic
1071018238 10:81022795-81022817 AATGAGGTAGAGAAGGAGCTAGG + Intergenic
1071359288 10:84829536-84829558 AAAAGAAAAGAGAAGGAGCTGGG + Intergenic
1071398546 10:85246585-85246607 AAAGAAACAGAGACGGAGGGAGG + Intergenic
1071444887 10:85736257-85736279 AAGGAAGGAGAGAAGGAGGGAGG + Intronic
1071638436 10:87280282-87280304 GAAGAAGCAAAGCAGAAGCTTGG + Intergenic
1071656806 10:87457670-87457692 GAAGAAGCAAAGCAGAAGCTTGG - Intergenic
1071781401 10:88849876-88849898 AAAGAAGGAGAGAATGAGGGAGG - Intronic
1072121238 10:92407133-92407155 TATGGAGGAGAGAAGGAGCTAGG + Intergenic
1072792857 10:98331191-98331213 AAAGAAGACGTGGAGGAGCTTGG + Intergenic
1072822957 10:98576533-98576555 GGAGAAGCAGAGAGGGAGGTGGG + Intronic
1072948306 10:99830540-99830562 AAAGAAACAAAGGAAGAGCTTGG - Intronic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1073622617 10:105064704-105064726 ATAGCTGCAGAGAAGGAGGTAGG + Intronic
1074024205 10:109616870-109616892 ATAGAAGCAGAGAAAGATCTTGG + Intergenic
1074163655 10:110856076-110856098 AAAAAAGCAGAGAGAGAGCAAGG - Intergenic
1074326452 10:112455487-112455509 AAGGAAGGAGAGAAGGAGGGAGG - Intronic
1074387320 10:113026991-113027013 ACAAAAGCAGAGAACGAGTTGGG + Intronic
1074559389 10:114521660-114521682 AAGGAAGGAAAGAAGGAGCGGGG - Intronic
1074719921 10:116255716-116255738 AAAGAAGGGGAGAAGGAGAGAGG - Intronic
1075226332 10:120632840-120632862 AACGAAGCAGAGGATTAGCTTGG + Intergenic
1075248536 10:120846029-120846051 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1075467133 10:122660215-122660237 AAAGCAGCAGTGAGTGAGCTGGG + Intergenic
1075467576 10:122663136-122663158 AAACAAGGAGAGAAGGAGGTTGG + Intergenic
1075683721 10:124349835-124349857 ACATAAGAGGAGAAGGAGCTGGG - Intergenic
1076558762 10:131347254-131347276 AAAGAATGAGAGAAGGAGGAAGG - Intergenic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1076736241 10:132460429-132460451 AAGGCAGCAGAGAAGTGGCTGGG - Intergenic
1076749115 10:132533416-132533438 CAAGGAGCAGAGAGGGAGATGGG - Intergenic
1076823134 10:132951903-132951925 AAGGAAGCAGTGAAGGAGCAGGG - Intergenic
1077247069 11:1544827-1544849 CAGGAAGCAGTGAAGGAGCAGGG + Intergenic
1077272224 11:1686739-1686761 AAGGAGGCAGAGAAGGAGGGAGG - Intergenic
1077398728 11:2341519-2341541 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1077497362 11:2892638-2892660 GAAGAGGAAGAGGAGGAGCTGGG - Intronic
1077631574 11:3814712-3814734 AAAGAAGGAAAGAAAAAGCTTGG - Intronic
1077661057 11:4068950-4068972 TAAACAGCAGAGAAGGAGGTAGG - Intronic
1078151647 11:8764671-8764693 AAAGAATTAGAAAAGGGGCTGGG + Intronic
1079333169 11:19549934-19549956 AAAGAAGGGGAGATGGAGCAGGG + Intronic
1079341703 11:19617051-19617073 AAAAAAGGAGAGAACAAGCTAGG - Intronic
1079447300 11:20568967-20568989 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1079491328 11:20991950-20991972 AAAGAACCAAAGAAGGAGAGGGG - Intronic
1079816219 11:25062163-25062185 AAAGAAGGAGAGGAGGAGGAAGG + Intronic
1079903539 11:26218468-26218490 AAAGAAGCAGAGAAGAACCCTGG - Intergenic
1080135082 11:28844755-28844777 AGAGAAGGAGAGAAGGAGGGAGG - Intergenic
1080320935 11:31008342-31008364 AAAGAAACAGAGTAAGAGGTAGG + Intronic
1080599283 11:33806915-33806937 ACAGAAGGTTAGAAGGAGCTTGG + Intergenic
1080607413 11:33875195-33875217 AATGAAGCAGATCAGGTGCTTGG + Intronic
1080708213 11:34719556-34719578 AAAGAACCAGGAAAGGAGCCTGG + Intergenic
1080748330 11:35128999-35129021 AAAGACTCAGAGGAGGAGCAAGG + Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1081799170 11:45846084-45846106 AAAGAAGCACAGAATAAGATGGG + Intergenic
1082067378 11:47911635-47911657 AAAGAAGCAGAGACAGAGGCAGG + Intergenic
1082787849 11:57326702-57326724 AAAGAAGAGGAGGAGGAGCGAGG - Exonic
1082797819 11:57390636-57390658 GAGGAAGCAAAGAAGGACCTGGG - Exonic
1082883177 11:58058328-58058350 AAAGTGCCAGAGAAGGGGCTTGG - Intronic
1083274442 11:61588668-61588690 AATGAAGCAGCCACGGAGCTGGG - Intergenic
1083433610 11:62628021-62628043 AAAGAAGCAGAAGGAGAGCTAGG - Intronic
1083721694 11:64606708-64606730 AAAGAAGTAGGGAAGGAGGGTGG + Exonic
1083873718 11:65508548-65508570 AAAAAAAAAGAGTAGGAGCTGGG + Intergenic
1084046940 11:66574516-66574538 AGACAAGGAGAGAAGGGGCTGGG - Intergenic
1084231031 11:67753316-67753338 AAAGCAGAAGAGCAGGTGCTGGG - Intergenic
1084421953 11:69064632-69064654 AAAGCAGCAGAGATGCAGCGTGG - Intronic
1084521394 11:69665192-69665214 AAAGAGGCAGAGAGGGAGTAGGG + Intronic
1084902611 11:72321117-72321139 AAAGAAGGATGGGAGGAGCTTGG + Intronic
1085724080 11:78939140-78939162 GAAGTAGCAGAGAAGGAGAAAGG - Intronic
1085781957 11:79417726-79417748 AAAGAAGGCCACAAGGAGCTTGG - Intronic
1085810765 11:79678956-79678978 AGAGAGGGAGAGAAGTAGCTGGG + Intergenic
1086049013 11:82567057-82567079 AAAGAACTAGAGAAAGAGCCAGG + Intergenic
1086101762 11:83107938-83107960 AAAGAAACAGAGAAAAAGATAGG - Intergenic
1086145751 11:83549802-83549824 AAAGAAGCTTAGATGGAGTTAGG + Intronic
1086231133 11:84571211-84571233 AAAGAGGAAGAAAAGGAGGTAGG - Intronic
1086231218 11:84572390-84572412 CAAGAAGGAGAGAAGAAGCAAGG - Intronic
1086252311 11:84830964-84830986 AAAGAAATAGAGACAGAGCTGGG - Intronic
1086355114 11:85988627-85988649 AAAGAATCAGGGAAGCAGCTAGG + Intronic
1086583819 11:88429452-88429474 AAGGAAGAAGTGAAGCAGCTGGG + Intergenic
1086988049 11:93271378-93271400 AAAGAAGAAGAAAAGGAAATTGG + Intergenic
1087127652 11:94642766-94642788 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1087262798 11:96029652-96029674 ATAGGAGCAGAGAAGAAGATGGG - Intronic
1087298433 11:96405169-96405191 AAAGACAGAGAGAACGAGCTGGG - Intronic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1087904747 11:103682559-103682581 CAAGAAGCACGGAAGGAGCTGGG + Intergenic
1087942105 11:104110686-104110708 AAAGTAGCAGATAAGGGGATTGG - Intronic
1088371686 11:109095703-109095725 TAAGGAGCAAAGAAAGAGCTGGG + Intergenic
1088881331 11:113975624-113975646 AAGGGAGCAGAGAAGTAGCCTGG + Intronic
1089893817 11:121907506-121907528 ACAGAAACAGAGAAGGAAGTGGG - Intergenic
1089918336 11:122181730-122181752 AAAGAAGGAAAGAAGGAGGGAGG - Intergenic
1090062781 11:123478085-123478107 AAAGAAAAAGAGAAGAGGCTGGG - Intergenic
1090228065 11:125083461-125083483 AGTGAAGCAGAGAAAGGGCTGGG + Intronic
1090518681 11:127455760-127455782 ATAGAAGCAGAGAGTGACCTGGG - Intergenic
1090526965 11:127547309-127547331 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1090626378 11:128612404-128612426 ACAGAGGGAGAGAAGGAGGTAGG - Intergenic
1090850763 11:130568896-130568918 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1090872118 11:130758040-130758062 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1091294906 11:134466864-134466886 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1091547384 12:1510493-1510515 ACAAAAGCAGAGAAGGAACAAGG + Intergenic
1091585953 12:1817018-1817040 AGAGAAGCAGATAAAGGGCTAGG - Intronic
1091886348 12:4019697-4019719 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1091976117 12:4827109-4827131 AAAGAAGGAAAGAAGGAGGAAGG - Intronic
1092205601 12:6612955-6612977 GAAGAGGGAGGGAAGGAGCTGGG - Intergenic
1092287753 12:7139221-7139243 AAAGAAGCAGGCAAGGGACTGGG + Intronic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092646391 12:10578530-10578552 ATAGAAACAGAGAAGGAGTCAGG + Intergenic
1092723955 12:11467060-11467082 AGAGAAGGAGAGAAGGGGTTGGG + Intronic
1092970193 12:13686468-13686490 ACAGAGGGAGAGAAAGAGCTAGG - Intronic
1093062477 12:14621664-14621686 AATGAAGCAGAGAAGACACTGGG - Intronic
1093837510 12:23852943-23852965 AAAGAGGCAGAGAAGGAAAGGGG + Intronic
1093946903 12:25119836-25119858 AATGCAGCAGACAAGGATCTAGG + Intronic
1094304470 12:29002051-29002073 AAAGAAACACAGATGGAACTAGG + Intergenic
1094590076 12:31811747-31811769 AAAGAAGAAAAGAATTAGCTGGG - Intergenic
1095358969 12:41312820-41312842 AAAGAAGAAAAGAAGGTGATAGG - Intronic
1095694530 12:45129543-45129565 AAAGAAGGAAAGAAGGAGGGAGG + Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1096529885 12:52235883-52235905 AAAGAAGCAGAGAGGGAAAATGG + Intronic
1097951546 12:65434627-65434649 GAAGAAGGTGGGAAGGAGCTTGG + Intronic
1098137331 12:67416503-67416525 AGAGAAGCAGGGAAGGAGGAAGG - Intergenic
1098322683 12:69262471-69262493 AGAGAAGCAGAGAACGAGAGAGG + Exonic
1098402080 12:70086575-70086597 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1099010833 12:77289306-77289328 AAAGAACTAGAGAAGCAGCTGGG + Intergenic
1099188486 12:79540776-79540798 AGACAAGGAGAGAAGGAGTTGGG - Intergenic
1099338572 12:81397268-81397290 AGAGAAGAAGAGAAGAAACTGGG + Intronic
1099482245 12:83182145-83182167 AATGAAGCAGAGAAGATGTTAGG - Intergenic
1099858310 12:88198439-88198461 TAAGAAGCAGTGAAGGAGTAAGG - Exonic
1099942836 12:89210438-89210460 AAAGGAGAAGAGAAGGAGACAGG + Intergenic
1100390553 12:94142927-94142949 AGATCAGCAGAGAGGGAGCTGGG + Intergenic
1100435021 12:94563166-94563188 CAAGAATCAGAGAAGGATCCAGG + Intergenic
1100801695 12:98238554-98238576 AAAGAGGAAGAGAAGCAGATGGG - Intergenic
1101259421 12:103013406-103013428 AAAGTAGCATAAAAGGAACTGGG + Intergenic
1101427631 12:104600898-104600920 AAGGAAGCCGAGAAGGAGGAAGG - Intronic
1101667627 12:106833919-106833941 AAAGAGGGGGAGAAGGTGCTAGG - Intronic
1101737130 12:107471538-107471560 AATGAAACAGAGAAAGGGCTGGG - Intronic
1102017046 12:109655014-109655036 AGAGAGGTGGAGAAGGAGCTGGG + Intergenic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102451449 12:113044922-113044944 AAAGAAGGAGGGAAGGAGGGAGG + Intergenic
1102451470 12:113044995-113045017 AAAGAAGGAGGGAAGGAGGGAGG + Intergenic
1102644743 12:114396617-114396639 AGAGGAGCAGAGAAAAAGCTAGG + Intronic
1102842626 12:116142131-116142153 AATGAAGCAGTGAAGGAGGATGG - Intronic
1102900644 12:116633893-116633915 AAAGAAATAGACAAGCAGCTGGG + Intergenic
1103204919 12:119121121-119121143 TAAGAAGCAGAGGCGGATCTTGG + Intronic
1103328735 12:120139012-120139034 AAAAAAGGAGAGAAGGGGCCGGG + Intronic
1104463560 12:128973080-128973102 ATAGAAACAGAGTAGGAGGTTGG - Intronic
1104465588 12:128987762-128987784 AAAGAAGGAGAGAGGGAGGGAGG - Intergenic
1104485845 12:129150774-129150796 AGAGAAGCAGGGAAGGCTCTGGG - Intronic
1104704284 12:130931719-130931741 AAAGAACCAGAGAAGGAGTGAGG + Intergenic
1105057927 12:133120215-133120237 AAAGACTGAGACAAGGAGCTTGG + Exonic
1105278870 13:18951737-18951759 CAAGAAGGAGAGCGGGAGCTTGG - Intergenic
1106047724 13:26160522-26160544 GAAGAAGAAGAGAAGAAGATAGG - Intronic
1106081284 13:26501970-26501992 AAACAAGCAGCCACGGAGCTTGG + Intergenic
1106313331 13:28572746-28572768 AAAGAAGCAGATAAAAAGCATGG + Intergenic
1106755850 13:32822006-32822028 AAAGAAGGAGAGGAAGAGTTAGG - Intergenic
1106943277 13:34799823-34799845 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1107220457 13:37973734-37973756 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1107263974 13:38528710-38528732 AAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1108361786 13:49674535-49674557 AAAGAAACAGAGAAAGACATGGG + Intronic
1108490059 13:50972575-50972597 AAAGAAGGAAAGAAGGAAGTGGG - Intronic
1108512826 13:51171035-51171057 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1108622668 13:52199580-52199602 AAAGAAGGAGAGAATGAGGCTGG + Intergenic
1108664050 13:52611363-52611385 AAAGAAGGAGAGAATGAGGCTGG - Intergenic
1108843282 13:54648357-54648379 CAAGAAGCAGAGACTGAGATGGG + Intergenic
1108901231 13:55410860-55410882 AAAGAAGCAGTGGAAGAGCACGG - Intergenic
1108928808 13:55788907-55788929 AAGGAAGAAGAGAAGGAGAAAGG - Intergenic
1109211085 13:59536860-59536882 AAAGAGGTAGAGAAAGAGATAGG - Intergenic
1109600922 13:64627462-64627484 ACAGAGTCAGAGAAGGAGCAAGG - Intergenic
1109709824 13:66145886-66145908 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1109709875 13:66146093-66146115 AGACAAGGAGAGAAGGAGTTTGG + Intergenic
1109844526 13:67969362-67969384 AAAGAAGGAAAGAAGGAGGGAGG - Intergenic
1109912930 13:68940375-68940397 AAAGATTCTGAGAAGGACCTAGG - Intergenic
1110215661 13:73021847-73021869 AAAGAGGGAGAGAAGGAGGACGG + Intergenic
1110588134 13:77219633-77219655 AAAGAAGCAGAGAAGTGGTATGG + Intronic
1110592126 13:77275526-77275548 AAAGACTCTCAGAAGGAGCTGGG + Intronic
1110865639 13:80392503-80392525 AAGGAAGGAAGGAAGGAGCTGGG - Intergenic
1110879356 13:80552452-80552474 AAAGAAGGAGAGAAGGAAGGAGG + Intergenic
1110900287 13:80813549-80813571 AAAGAAGTAGAGAAAGAGGGAGG + Intergenic
1111335971 13:86823730-86823752 ATAGATGCAGAAAAGCAGCTGGG + Intergenic
1111435692 13:88204017-88204039 AAAGAAGCAAAGAAGGGGGAAGG - Intergenic
1111638622 13:90938044-90938066 AAAGAAGAAGAGCAGGAACTAGG - Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112200653 13:97270950-97270972 AAAGGAACAGAGAACAAGCTGGG + Intronic
1112296794 13:98194948-98194970 AAGAAAGCTGAGAAGGGGCTGGG - Intronic
1112664687 13:101556339-101556361 TAAGAAGAAGAAAAGAAGCTGGG + Intronic
1112710069 13:102117108-102117130 AGAAAAGCAGACAAGAAGCTCGG - Intronic
1113002208 13:105654171-105654193 AATGAAGGAGAGAAGGAACATGG - Intergenic
1114260194 14:21031049-21031071 AAAGAGGCAGTGAAGGAACTGGG + Exonic
1114280177 14:21187040-21187062 AAAGAATCAGAAAATGAGCAAGG + Intergenic
1114567292 14:23641977-23641999 AAAGATGCAGAGGCGGAGCCTGG - Intronic
1114761434 14:25320837-25320859 AAGGAAGTAGAGAAGAAGATAGG - Intergenic
1114777304 14:25498469-25498491 AAAGAAAGAGAGAAAGAGCAAGG + Intergenic
1114934234 14:27513744-27513766 AAAGAGGAAGAGAAGGTGATGGG - Intergenic
1115240758 14:31249837-31249859 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1115494299 14:33987047-33987069 TAAGAAGAGGAGAAGGAGCAAGG - Intronic
1115738294 14:36359100-36359122 GAACCAGCAAAGAAGGAGCTTGG + Intergenic
1116449132 14:45045308-45045330 AAAGAAGGAGAGCAGGAGGGGGG - Intronic
1116449737 14:45050908-45050930 AAAGAACCAGAGAAGAGGCTGGG - Intronic
1116573294 14:46545105-46545127 ATAAAAGCAGAGAAGGGGTTGGG - Intergenic
1116613347 14:47105336-47105358 AGAAAAGCAGAGAAGGGGTTGGG - Intronic
1116867702 14:50044614-50044636 AATGCAGCAGAGTAAGAGCTGGG - Intergenic
1116890632 14:50264523-50264545 AAAGAAGTAGAGAAGAAGCAAGG + Intronic
1116945808 14:50834229-50834251 AAAGAAGTTTAGAAGGAGCCAGG - Intergenic
1116952750 14:50894349-50894371 AGAAAAGCAGAGAAGGGGTTGGG - Intronic
1117105887 14:52396425-52396447 AAAGAAGGAGAGAAGCAGGGAGG - Intergenic
1117133368 14:52707541-52707563 AAAGAAGTAGAGGAGGAGTGGGG + Intronic
1117814702 14:59584886-59584908 AAAGAAGCGTTGAGGGAGCTGGG - Intergenic
1118009663 14:61596877-61596899 AAAGAGGCAGAGAAGAAGGAGGG + Intronic
1118562845 14:67105889-67105911 AAACAATAAGAGAAGGAGCAAGG - Intronic
1119225200 14:72939996-72940018 AAACACTCAGGGAAGGAGCTGGG + Intronic
1119420024 14:74502943-74502965 GAGGAGGGAGAGAAGGAGCTGGG + Intronic
1119609420 14:76048989-76049011 ACAGAAGCAGAGAAGATGGTGGG + Intronic
1119647158 14:76356150-76356172 GAAGAGTCAGAGAAGGGGCTAGG + Intronic
1119676876 14:76562453-76562475 AAACAAACAAAGAAGGAACTTGG + Intergenic
1119680576 14:76589600-76589622 AAAGCAGGAGAGAAGGGGATAGG + Intergenic
1119968961 14:78948136-78948158 AAAGCAGAAGTGAAGGAGCAGGG + Intronic
1119979965 14:79069246-79069268 AAAGAAGAAGAATAGGAGATAGG - Intronic
1120382056 14:83793232-83793254 AGAGAAGCAGGGAAGGAGTGGGG - Intergenic
1120444931 14:84582642-84582664 AAGGAAGGAGAGAGGGAGCAAGG + Intergenic
1121097821 14:91230019-91230041 AAAGAAGCAGAGAGGAAAATGGG + Intergenic
1121667346 14:95683396-95683418 AAATAAGCAGAGCTGGAACTTGG + Intergenic
1121703482 14:95974107-95974129 AGAAAAGCAGAGAAGGGGGTGGG - Intergenic
1121786349 14:96663938-96663960 TAAGAAAGACAGAAGGAGCTTGG + Intergenic
1121821499 14:96971779-96971801 AGGGAGGGAGAGAAGGAGCTGGG + Intergenic
1122002085 14:98667018-98667040 AAGGAAGGAGAGAAGGAGGGAGG - Intergenic
1122294828 14:100699495-100699517 ATAGAAGCAGAGAGTGGGCTTGG + Intergenic
1123011243 14:105350576-105350598 AGAGAAGCAGATGAGGAGCTGGG - Intronic
1123539305 15:21272206-21272228 AAAGAGGGAGAGAGGGAGCGAGG - Intergenic
1123798983 15:23802163-23802185 AAAGCAGCACAGAATGAGATCGG - Intergenic
1124112326 15:26803140-26803162 GAAGAAGAGGAGAAGTAGCTAGG - Intronic
1124134496 15:27022291-27022313 TAAGAAGAAGAGAAGAAGCCTGG - Intronic
1124993852 15:34703495-34703517 GAAGAAGAAGAGAAGGAGGAGGG - Intergenic
1125045610 15:35239948-35239970 AGAAAAGCAGAGAAGGGGTTAGG - Intronic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1125947681 15:43723305-43723327 AAAGAAAGAGAGAAGGGGCAGGG + Intergenic
1126404842 15:48313383-48313405 AATGAGGCAGAGGAGGAGCTAGG - Intergenic
1126660850 15:51031582-51031604 AAAGAAGCACTGAAGAAGATAGG - Intergenic
1127002073 15:54520671-54520693 AGAGAAGCAGGGAAGGACCTTGG + Intronic
1127137142 15:55936013-55936035 TAAGAAGCATAGAAGAAGGTTGG - Intronic
1127538561 15:59914589-59914611 AAAGAAGTAGAAAAGGAACTTGG - Intergenic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1127695321 15:61441227-61441249 ACAGGAGCAGAGCAGGAGGTAGG - Intergenic
1128043493 15:64596146-64596168 AAAGAAAAAAAGAAAGAGCTTGG - Intronic
1128156358 15:65394288-65394310 AAGGAAGCAGAGTAGGGGTTGGG - Intronic
1128599342 15:68982672-68982694 AAAGAGGCAGAGGAGGTACTGGG - Intronic
1128636024 15:69302930-69302952 AATGAAGCAAAGAAGAAGCAGGG - Intronic
1128719814 15:69940117-69940139 AGAGAAGCAGAGAAGACACTGGG + Intergenic
1128918792 15:71592197-71592219 GAAGAAGCAGAGAGGAAGTTTGG + Intronic
1129190319 15:73933738-73933760 AAAGGGGCAGGGAGGGAGCTGGG + Intronic
1129196838 15:73973474-73973496 AAAGAAGCAGGGACTGAGCTGGG - Intergenic
1129813357 15:78529141-78529163 AGAGAGGCAGAGTAGGAGCAGGG - Intronic
1129819884 15:78592328-78592350 AAATAAGCAGAGAAGTAACAGGG + Intronic
1130868378 15:87951279-87951301 AAATAAGCAGAGATGGTCCTAGG - Intronic
1131642458 15:94307252-94307274 AAGAAAGCAGAGTAGGTGCTGGG + Intronic
1131714712 15:95095801-95095823 AAAGAGGAAGAGAAGGAGCAAGG + Intergenic
1131989184 15:98076932-98076954 AAAGAAAAAGAGAAGGAGAGAGG + Intergenic
1132490562 16:227925-227947 AAAAAAGCAAAAAAGGAACTAGG + Intronic
1133047976 16:3099705-3099727 AAAGGAGCAGCGACGGTGCTAGG + Intergenic
1133272519 16:4617252-4617274 AAAAAAACAGAGAATTAGCTGGG + Intronic
1133543686 16:6784208-6784230 GAAGAAGTAGAGAAAGAGATTGG - Intronic
1133623163 16:7545594-7545616 AAAGAAGTGGAGACTGAGCTGGG - Intronic
1133673850 16:8050821-8050843 AAAGAAGAAGAGAAAGAGAATGG - Intergenic
1133765896 16:8837546-8837568 AGAAAAGCAGAGAAGGGGTTGGG + Intronic
1133869842 16:9676311-9676333 AGACAAGGAGAGAAGGAGTTTGG + Intronic
1133883663 16:9806537-9806559 AGAGAAGCAGAGAAGGGGAGAGG + Intronic
1134206498 16:12242618-12242640 AAAGAAGAAGAGAAGAAGAGAGG - Intronic
1134211569 16:12281773-12281795 TAAGAAGCAGAGCTGGGGCTGGG + Intronic
1134342346 16:13357111-13357133 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1134693433 16:16205921-16205943 ATAGAAGGAAGGAAGGAGCTTGG + Intronic
1134749448 16:16614261-16614283 AAAAAAGGAGAGAACTAGCTGGG - Intergenic
1134978417 16:18588779-18588801 ATAGAAGGAAGGAAGGAGCTTGG - Intergenic
1134996022 16:18739363-18739385 AAAAAAGGAGAGAACTAGCTGGG + Intergenic
1135206278 16:20486969-20486991 AAAGAAGGAGAGAGGAAGCAAGG + Exonic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135500879 16:22994824-22994846 AAAGTAGCAGAAAAAGAGATGGG - Intergenic
1135620899 16:23954543-23954565 AAAGGAGGAGTGAAGGAGTTTGG + Intronic
1135911396 16:26564749-26564771 CAAGAAGAAGAGAAAGAGCAAGG - Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1137829884 16:51534193-51534215 AAAGAGGCAAAAAGGGAGCTGGG + Intergenic
1138910275 16:61388290-61388312 AGATAATCAGAGAAGAAGCTGGG - Intergenic
1139092443 16:63664829-63664851 AGAGATGCAGAGACAGAGCTTGG - Intergenic
1139219359 16:65164321-65164343 AAAGGAGCACAGAAGGAATTTGG - Intergenic
1139226079 16:65234368-65234390 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1139667137 16:68465263-68465285 TAAAAAGCAGAGAAGCAGCCAGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139943207 16:70620991-70621013 AGAAAAGCAGAGAAGGGGTTGGG + Intronic
1139943933 16:70625504-70625526 AGAGAGGGAGAGAAGGAGTTGGG + Intronic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1140903574 16:79392117-79392139 AGAGAAGAAGAGAGGGAACTGGG + Intergenic
1141239722 16:82254394-82254416 GAAGGAGCAAAGCAGGAGCTAGG + Intergenic
1141392434 16:83676071-83676093 AAAGAAGGAGAGGAGGAGGGAGG + Intronic
1141394160 16:83690293-83690315 AAGGAAGCAGAGAAGGAAGGAGG + Intronic
1141573277 16:84947732-84947754 AAAGAAGCAGAGAAGCAGGCGGG + Intergenic
1141824408 16:86468793-86468815 AATGCAGCAGAGAGGGAGTTAGG + Intergenic
1141832404 16:86517057-86517079 AAAGGAGCTCAAAAGGAGCTGGG + Intergenic
1142096029 16:88240365-88240387 AGAGAGGCAGAGAAAGAGCATGG + Intergenic
1142146948 16:88496658-88496680 AAAGCAACAGAGAGGGGGCTTGG + Intronic
1143543559 17:7583251-7583273 AGTGAAGCAGAGGAGGAGGTGGG - Intergenic
1143873623 17:9975505-9975527 AAAGAAGGAGGGAAGGAGGATGG - Intronic
1143962255 17:10730317-10730339 AAAGAAGGAAAGAAAGGGCTGGG + Intergenic
1144415130 17:15039195-15039217 AAGGAAGGAGAGAAAGAGATGGG + Intergenic
1146106289 17:30040186-30040208 GAAATAGCAGAGAAAGAGCTTGG - Intronic
1146496858 17:33330312-33330334 TGAGAAGCACAGAATGAGCTGGG - Intronic
1146831646 17:36074803-36074825 AAAGAAAGAGAGAAAGACCTTGG + Intergenic
1147250126 17:39148199-39148221 AAAAAAGGAGGGAAGGAGGTTGG - Intronic
1147746951 17:42700629-42700651 AAAGATGAAGAGGAGGAGTTAGG - Exonic
1148046914 17:44749925-44749947 TATGAAGCAGAGGAGGGGCTTGG + Intronic
1148438888 17:47701674-47701696 GTAGAAGCAGAGAAGGGGCAGGG + Intronic
1148528509 17:48366065-48366087 AAAGATGCAGAAAAGGTGATAGG + Intronic
1148676778 17:49450369-49450391 AAAGAAGGAGGGAAGGAGAAAGG - Intronic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1149273189 17:55004873-55004895 AAAGGAGCAAATAAAGAGCTTGG + Intronic
1149530183 17:57388947-57388969 GAAGAAGAAGAGCAGGGGCTAGG - Intronic
1149629486 17:58110521-58110543 ACAGAAGCAGAGCAGGAGAAAGG - Intergenic
1150255063 17:63738045-63738067 AAAAAAGAAAAGAAGGGGCTGGG + Intronic
1150431463 17:65121753-65121775 AAAGAAAGAGAGAAAGAGCGGGG - Intergenic
1150475111 17:65468971-65468993 CAAGACGGAGAAAAGGAGCTGGG + Intergenic
1150689594 17:67353311-67353333 AAAGAAAGAGAGAGGGAGCGGGG - Intronic
1150868324 17:68877706-68877728 AAAGAAGCAGTGCAGAAGGTAGG - Intronic
1150927828 17:69552633-69552655 GAAGAAGGAAAGAAGGAGTTGGG + Intergenic
1151362893 17:73599234-73599256 AAGAAAGGAGAGAAGGTGCTGGG + Intronic
1151437945 17:74109768-74109790 AGAGAAGCATCCAAGGAGCTTGG + Intergenic
1152063205 17:78094733-78094755 AAAGAACCACAGAAGCAGCCAGG - Intronic
1152309702 17:79542427-79542449 AATGAATCAGCGAAGAAGCTGGG + Intergenic
1152417617 17:80172772-80172794 GATGAAACAGAGAAGGAGATGGG - Intronic
1152650488 17:81490295-81490317 AGAGAGACAGGGAAGGAGCTAGG - Intergenic
1152724588 17:81938998-81939020 AAAAAAGGAGAGAAGGAGGCTGG + Intronic
1152868110 17:82736115-82736137 AAAGAAGCAGAGACATGGCTGGG + Intronic
1153185173 18:2478220-2478242 GAAGAAGGAGAGAAGGAGTCAGG - Intergenic
1153693034 18:7612931-7612953 ATGGAAGCAGAATAGGAGCTGGG - Intronic
1154228125 18:12527153-12527175 GAAGAAACAGTGGAGGAGCTTGG - Intronic
1154508467 18:15067468-15067490 ATAGAGTCAGAGATGGAGCTGGG + Intergenic
1155124128 18:22854326-22854348 AAAAAAGAAGAGGAGGAGCTGGG + Intronic
1155238218 18:23842607-23842629 AAAGAGGCATGGAAGGAGCCTGG - Exonic
1155317308 18:24584887-24584909 TAAAAAACAGAGAAGGAGATGGG + Intergenic
1155655192 18:28184411-28184433 AAAGAAGAAGAGAAAGAGGGAGG - Intergenic
1155993342 18:32303965-32303987 AAAGAAACAGAGAAAGAGGGAGG + Intronic
1156087831 18:33429305-33429327 AGAGAAGGAGAGAAGGAGACAGG + Intronic
1156087838 18:33429337-33429359 AGAAAAGCAGAGAAGGAGGGAGG + Intronic
1156471877 18:37382316-37382338 AGAGAGGCAGAGAAGGAGAGTGG - Intronic
1156522626 18:37734642-37734664 AAAGAAGAACAGAGGGAACTGGG - Intergenic
1156633027 18:38993585-38993607 AGAGAAGGAAGGAAGGAGCTAGG + Intergenic
1156698175 18:39793345-39793367 ACAGAAGCAGATAAAGAGCAAGG - Intergenic
1156783466 18:40880739-40880761 TAACAATCAGAGAAGGAGGTGGG - Intergenic
1156854994 18:41771281-41771303 AGAGAAGGAGAGAAGGAGACAGG + Intergenic
1156866451 18:41894166-41894188 AAGGAAACAGAGAGGTAGCTTGG - Intergenic
1156918175 18:42486016-42486038 AAAGAGGAAGAGAAGGAGAGGGG - Intergenic
1157014989 18:43701118-43701140 AAGGAAGGAGAGAAATAGCTTGG - Intergenic
1157154816 18:45255151-45255173 AAAGATGCAGAGAAAGAGAAAGG - Intronic
1157301486 18:46482919-46482941 AAAGGTGCTGAGAAGGAGCCAGG - Intronic
1158361396 18:56677851-56677873 GAGGAGGCAGAGAAGGAGATAGG - Intronic
1158534911 18:58299315-58299337 AAAGATGCAAAGACTGAGCTTGG + Intronic
1158950252 18:62487961-62487983 AGCTAAGCAGAGAAGCAGCTTGG + Intergenic
1159076036 18:63682960-63682982 AAAGAAGGAGGGAAGGAAGTAGG - Intronic
1159121833 18:64179958-64179980 AATGAAGCAGGGAAGGAGAGTGG + Intergenic
1159209113 18:65293227-65293249 AAAGAAGCAAAGTAGGCTCTCGG - Intergenic
1159285058 18:66337667-66337689 AAAGAAGCACAGAAGAGGGTAGG - Intergenic
1159573732 18:70149844-70149866 AGAGAAGCTGTGAAGGCGCTGGG - Intronic
1159732823 18:72053111-72053133 AATGAAGCATAGAATGAGCAGGG + Intergenic
1159834884 18:73325815-73325837 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1160190795 18:76712624-76712646 ACAGAATCTGAGAAGGAGCAGGG - Intergenic
1160191347 18:76716767-76716789 ACAGAATCTGAGAAGGAGCAGGG - Intergenic
1160544224 18:79642081-79642103 AAAGAGGGAGAGAAGGAACCAGG - Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1160672288 19:371456-371478 CCAGAAACAGAGGAGGAGCTGGG - Intronic
1160956962 19:1698298-1698320 AAATAAGAAGAGAAGGAAGTTGG + Intergenic
1161621296 19:5298715-5298737 AAAAAGGCAGACATGGAGCTGGG - Intronic
1161661556 19:5549667-5549689 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1161920017 19:7259060-7259082 AAAGAAGGAGGGAAGGAGAAAGG - Intronic
1161955925 19:7495069-7495091 AAAGAAGGAGGGAAGGAGGGAGG - Intronic
1162922040 19:13908914-13908936 AAAGAAAGAGAGATGGAGCCGGG - Intronic
1163716520 19:18875788-18875810 AAAGAAGAAGAGAAAGCCCTGGG + Intronic
1163906876 19:20155744-20155766 AGAAAAGCAGAGAAGGTGTTGGG - Intergenic
1164165944 19:22674996-22675018 AAAGAATTAGAGAAGCAGCCGGG + Intergenic
1164250267 19:23469575-23469597 AAAGGAGGAGAGAAGGAGAATGG - Intergenic
1164462062 19:28457438-28457460 ACACAGGCAGAGAAGAAGCTTGG + Intergenic
1164465948 19:28487716-28487738 AAAGAAGAAGAAAAGGAGGGAGG + Intergenic
1164768979 19:30793348-30793370 CAAGAAGCAGAGAAGGGGGTTGG + Intergenic
1164816078 19:31204415-31204437 AAAGAAGGAGAGAGGGAGGTAGG - Intergenic
1165832566 19:38736761-38736783 AAGGATACAGAGAAGGCGCTGGG - Intronic
1165835191 19:38750768-38750790 AGAAAAGCAGAGAAGGGGTTGGG - Intronic
1165896892 19:39146903-39146925 AAGGAAGGAGAGAAGGAGAGAGG + Intronic
1166496488 19:43306548-43306570 AGAGGAGCAGAGAGGGAGCAGGG + Intergenic
1166499171 19:43328332-43328354 AGAGAAGGAGAGAAGGGGTTGGG + Intergenic
1166753929 19:45179193-45179215 AGAGAATCAGCGAAGGGGCTGGG + Intronic
1167056344 19:47113299-47113321 AAAGGAGCTGAGCAGGAGCGAGG + Intronic
1167104581 19:47422420-47422442 ACAGAAGGAGAGAAGGAGAGAGG - Intergenic
1167130477 19:47582114-47582136 AAAGAGGGAGAGAAGGAGGGAGG - Intergenic
1167248887 19:48390600-48390622 ACAGAAGGAGAGAGGAAGCTGGG + Intronic
1167627763 19:50603965-50603987 AAAGACGCTGGGAAGGAGCCAGG - Intergenic
1167628122 19:50605860-50605882 AAAGACGCTGTGAAGGAGCCAGG - Intergenic
1167628441 19:50607682-50607704 AAAGACGCTGGGAAGGAGCCAGG - Intergenic
1167699378 19:51033629-51033651 AAAGAAAAAGAAAAAGAGCTTGG + Intronic
1168212341 19:54899689-54899711 AGAGACACAGAGAAGGAGTTGGG + Intergenic
1168317843 19:55491758-55491780 AAGGAAGGAGAGAAGGAGGGAGG - Intronic
1168445248 19:56406067-56406089 AAAGAAGGAGAGAGGGAGGGAGG - Intronic
925178735 2:1802795-1802817 ACAGAAGGAGAGCAGGAGTTTGG + Intronic
925581279 2:5413966-5413988 AAAGACCCAGGGAAAGAGCTGGG - Intergenic
925828990 2:7877215-7877237 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
925903039 2:8522247-8522269 GAAGCAGCTGAGAATGAGCTAGG - Intergenic
926485919 2:13458012-13458034 ACAGAAGCAGAGAAGAAGCATGG - Intergenic
926503367 2:13681477-13681499 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
926809901 2:16746671-16746693 AAAGAAGGAGGGAGGGAGGTGGG - Intergenic
926809905 2:16746679-16746701 AAAGAAGGAAAGAAGGAGGGAGG - Intergenic
926815714 2:16796486-16796508 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
926815788 2:16796775-16796797 AAACAAGGAGAGAAGGGGTTGGG + Intergenic
926859486 2:17293119-17293141 AGAGTAGCAGTCAAGGAGCTGGG + Intergenic
926887424 2:17611036-17611058 AGAGAAACAGAGAAGGAGATAGG + Intronic
927737817 2:25537809-25537831 AAGGAAGCAAAGAGGGAGCGAGG + Intronic
927819753 2:26253485-26253507 AAAGAAGCAGAGAGACTGCTAGG - Intronic
927904968 2:26849160-26849182 GAAGAACGAGGGAAGGAGCTCGG + Intronic
928099499 2:28427796-28427818 AAAGAGACAAAGAAAGAGCTTGG + Intergenic
928455465 2:31416682-31416704 AAAGAAAGAAGGAAGGAGCTGGG + Intergenic
928598908 2:32884615-32884637 AAAGAGACAGAGAGGGATCTGGG + Intergenic
928648247 2:33377843-33377865 ACAGAAGGAGAGAAAGAGCGAGG + Intronic
928790265 2:34941826-34941848 AAAGAAGCACAACAGAAGCTAGG - Intergenic
928827813 2:35441641-35441663 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
928921729 2:36534319-36534341 AAAGAAGGAGAAAAGGAGGGAGG + Intronic
929170108 2:38923334-38923356 AAAGAAGAAGAGAAAGAGAAAGG + Intronic
929175362 2:38970132-38970154 AAAGAGGAAGAGAATGAGCGAGG - Intronic
929803725 2:45126757-45126779 ATAGAAGGAGAGAAGGAGGGTGG - Intergenic
930766247 2:55088740-55088762 AAAAAAGCAGAGATGGATCAAGG + Intronic
930954936 2:57194151-57194173 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
931047444 2:58371942-58371964 AAAGAAGGAGAGAAGTAGAATGG - Intergenic
931236778 2:60418807-60418829 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
931316782 2:61140491-61140513 AAAGAAACAGAGATGTAGCTGGG + Intergenic
931451105 2:62368488-62368510 AAGCAAGCAGAGAAGGATCCAGG + Intergenic
931565636 2:63613320-63613342 AAGGAAGAAGAGCAGGAGCAGGG + Intronic
931581926 2:63785278-63785300 AAAGAAGCAGAGGGGGAGAAGGG - Intronic
931625614 2:64253712-64253734 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
932193512 2:69762525-69762547 AAAGAAGCAGAGAAGAACAAAGG - Intronic
932367806 2:71164213-71164235 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932435362 2:71700060-71700082 ACTGAAGCAGAGGAGGACCTGGG - Intergenic
932564853 2:72899741-72899763 AAAGAAGGAGGGAAGGAGGGAGG + Intergenic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
933079112 2:77966288-77966310 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
933158005 2:78995086-78995108 AAAGCAGCTGAGAAGGAGGAGGG - Intergenic
933446178 2:82382685-82382707 AGGGCAGCAGAGAAGCAGCTTGG - Intergenic
933767955 2:85723627-85723649 TATGAAGCAGAGATGGGGCTTGG + Intergenic
933788607 2:85865029-85865051 GAACAACAAGAGAAGGAGCTGGG + Intronic
934173817 2:89561961-89561983 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
934284131 2:91636310-91636332 AAAGAAGAAGAGAGGGAGGGAGG - Intergenic
934877939 2:97943086-97943108 AAAGAAAGAAAGAAAGAGCTGGG + Intronic
934995374 2:98953096-98953118 AAAGAAGAGGAGAAGGAGGGCGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935705055 2:105849389-105849411 AAAGAAGGAAAGAAGGAGGGAGG + Intronic
935729333 2:106052083-106052105 AAAGGGGCAGAGATGGAGATGGG - Intergenic
936293054 2:111242024-111242046 AAAAAAGCAAAGAAGTGGCTGGG + Intergenic
936352474 2:111723660-111723682 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
937084879 2:119164872-119164894 AAAGAGGGAGAGAAGGAGGGAGG - Intergenic
937946494 2:127343228-127343250 AAAGAAACAGAAAAGGAGCCAGG + Intronic
938222503 2:129582258-129582280 AAAGAGACAGAGGAGGGGCTGGG + Intergenic
938789045 2:134660376-134660398 AAAGCAGCAGAGAGGGAGAGGGG + Intronic
938869897 2:135464267-135464289 AAAGAAGAACAAAAGGAGGTAGG - Intronic
939706413 2:145458784-145458806 CAAGAAGCAGACAACGAGATGGG + Intergenic
940018444 2:149131469-149131491 AAAGAAAGAGAGAAAGAGCGAGG + Intronic
940130373 2:150374671-150374693 AAATCACCAGAGAAGCAGCTGGG + Intergenic
940318314 2:152347886-152347908 AAAGAAACAGAAGAGGAGATGGG - Intronic
940372955 2:152922935-152922957 AAAGAAGAAGAGAAGGGGCAGGG - Intergenic
941145353 2:161837127-161837149 AAATAAATAGAGAAAGAGCTTGG + Intronic
941357370 2:164510852-164510874 AAAGAGGCACTGAAGGAGGTAGG + Intronic
941456360 2:165715040-165715062 AGAAAAGCAGAGAAGGTGTTGGG + Intergenic
941466985 2:165839559-165839581 AAGGAAGCAGAGATGGAGGGAGG + Intergenic
941555955 2:166981694-166981716 TAAGAAGAGGAGAAGGAACTGGG - Intronic
941982582 2:171475468-171475490 GAATAAGAAGAGAAGGGGCTGGG + Intronic
942307978 2:174627519-174627541 AAAGAAAGAGAGAAGGAGGGAGG - Intronic
942372558 2:175300817-175300839 AAAAAAGCAGAGGAAGAGGTTGG + Intergenic
942492254 2:176501159-176501181 AAAAAAGCAGAGAGGGAGGGCGG - Intergenic
942730456 2:179056308-179056330 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
943789571 2:191917207-191917229 AAAGGAGGAGAGAAAGAGCCAGG + Intergenic
943924216 2:193750806-193750828 AAAGAGGGAGAGAAGGAGAATGG - Intergenic
944405755 2:199381537-199381559 AAAGAAGGAGAGAAGGAGAAGGG - Intronic
944481237 2:200159904-200159926 AAAGGACCAGAGAAGTAGCTGGG + Intergenic
944550105 2:200837797-200837819 AAAGTAGCAGGGAGGGAGCAGGG + Intergenic
944824716 2:203470480-203470502 AAAGAAAAAGAAAAGGAGCAGGG + Intronic
944908926 2:204290340-204290362 AAAGAAGCAGGGAAAGAACAAGG + Intergenic
944925121 2:204456436-204456458 CAAGAAGCAGAGAAATACCTCGG + Intergenic
944971744 2:205001348-205001370 AAAGAACCAAAGAAAGAGTTAGG - Intronic
945485453 2:210390178-210390200 AAATGAGGAGAAAAGGAGCTGGG + Intergenic
945862921 2:215144401-215144423 AAAGAAGCAGAGAATGTGGAGGG + Intergenic
946303770 2:218843769-218843791 AAAGAAGAAAAGAGGGAGATGGG + Intergenic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946561425 2:220917849-220917871 AAAGAAGAAAACAAGGGGCTGGG - Intergenic
947018244 2:225645400-225645422 AATGAAGGAGAGAAGGAGGGAGG - Intronic
947057421 2:226122274-226122296 AAAGAAGAAGAGGAGGAAGTTGG + Intergenic
947325943 2:228976837-228976859 GAAGAAGGAGAGAAGGAGAAGGG - Intronic
947474815 2:230434609-230434631 ATAGAGGCAGATTAGGAGCTTGG + Intronic
947868922 2:233421629-233421651 AAGGAAGCAAGGAAGGAGGTGGG - Intronic
948536631 2:238651883-238651905 ACAAAAGGAGAGGAGGAGCTGGG + Intergenic
1168730070 20:69417-69439 AAAGCAGCAGTGGTGGAGCTTGG + Intergenic
1169151064 20:3289805-3289827 AATAAAGCAGAGAAGGGGCCAGG - Intronic
1169260759 20:4136373-4136395 AAAGAAGTAGTGAAGGAGTCAGG - Intronic
1169288484 20:4329017-4329039 AAAGGAGCAGACGAGGACCTTGG - Intergenic
1169924326 20:10766929-10766951 AAAGAAGCAGGGAGAGAGGTAGG + Intergenic
1169982839 20:11405731-11405753 AAAGAAGAATAAAAGGAGTTGGG + Intergenic
1170011414 20:11728090-11728112 AAAGCAGGAGAGTAGGAGGTTGG - Intergenic
1170105997 20:12754754-12754776 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1170194523 20:13676361-13676383 AAAGAATTAAAGAATGAGCTGGG + Intergenic
1170325647 20:15152389-15152411 AGAAAAGCAGAGAAGGGGTTTGG + Intronic
1170339731 20:15310753-15310775 AGTCAAGCAGAGAAGGGGCTTGG + Intronic
1170370183 20:15639832-15639854 AGAGAAGAAGAGAAGGAGGAAGG + Intronic
1170393641 20:15902870-15902892 AATCAAGCAGGGGAGGAGCTAGG + Intronic
1170408523 20:16064641-16064663 AAAGAGGCAGAGAAGGACTTGGG - Intergenic
1170412347 20:16105140-16105162 ATAGAAAAAGAGAAGGGGCTAGG - Intergenic
1170621295 20:17998567-17998589 AGAGCAGCAGAAAAAGAGCTGGG + Intronic
1170905613 20:20513264-20513286 AGAGAAGAAGAGAAGAAGTTTGG - Exonic
1172134572 20:32678378-32678400 AAAGAAAGAGAGAAGTGGCTGGG + Intergenic
1172228841 20:33323452-33323474 AAAGGCGCAGAGAAGGAAATGGG + Intergenic
1172304811 20:33873247-33873269 AGAAAAGGAGAAAAGGAGCTTGG + Intergenic
1172783534 20:37451287-37451309 AAAGGAGCAAAGGAGGAGATGGG - Intergenic
1172885088 20:38225611-38225633 AGAGAAGAAGAGAAGGAGTGGGG + Intronic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1173417010 20:42865794-42865816 AAAGAAGAAGGGAAGGAGCTGGG + Intronic
1173815683 20:45986504-45986526 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1173847775 20:46198937-46198959 AAACAAGGAGAGAAGGAGGCTGG - Intronic
1174048280 20:47749158-47749180 AGAAAGGCAGAGAAGGAGCTTGG + Intronic
1174364482 20:50048244-50048266 AAAGAAGAAGGGAAGGAGACAGG + Intergenic
1174657162 20:52181235-52181257 AAATAAACAGAGAGGGGGCTGGG - Intronic
1174748086 20:53084650-53084672 AGAGAAGGAGAGAAGGAGAGAGG - Intronic
1174814294 20:53673557-53673579 TATGAAGCAGAGAAGCAACTTGG - Intergenic
1174872949 20:54200545-54200567 AATAAAGCAGACAAGGTGCTTGG - Intergenic
1174921283 20:54705056-54705078 CAAGATGAAGAGAAGGGGCTGGG - Intergenic
1175283053 20:57818195-57818217 AAAAAAGCAGATAAGAGGCTTGG - Intergenic
1175293008 20:57890807-57890829 AAAGAGACAGTGAAGGAGATTGG + Intergenic
1175317334 20:58058172-58058194 CCAGAAGCAGAGCAGCAGCTAGG - Intergenic
1175413197 20:58784934-58784956 AGAGCAGCACAGCAGGAGCTTGG + Intergenic
1175786080 20:61712520-61712542 AGGGAAGAAGAGGAGGAGCTGGG - Intronic
1176518729 21:7808337-7808359 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1176789611 21:13304260-13304282 ACAGAGTCAGAGATGGAGCTGGG - Intergenic
1177244493 21:18504963-18504985 AGTGAAGCAGAGAAGCAGCTTGG + Intergenic
1177276104 21:18914307-18914329 AAAGAGGCCGAGAAGATGCTGGG - Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1178428680 21:32500082-32500104 AAAGCAGAAGAGTAGGTGCTGGG + Intronic
1178584714 21:33862455-33862477 AAAGAAGAAGAAAAGGATGTGGG + Intronic
1178652757 21:34438350-34438372 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1178826813 21:36024237-36024259 GAACAAGCAGAGAAGGATGTTGG - Intergenic
1178860643 21:36286104-36286126 CGAGTAGCAGAGAAGGAGATGGG + Intronic
1178960971 21:37064604-37064626 ATAGATTCAGAGGAGGAGCTGGG - Exonic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1179332391 21:40416514-40416536 AAATAAGCAGACAAAGAGTTTGG + Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1179521293 21:41947149-41947171 AAAGAAGGAGAGAGGGAGGGAGG - Intronic
1179533245 21:42034335-42034357 AAAAAAGCAGAGAAGGGGCCGGG - Intergenic
1179813468 21:43887143-43887165 GCAAAAACAGAGAAGGAGCTGGG - Intronic
1179857906 21:44171634-44171656 AAAGCAGCAGTGCAGGAGCCAGG - Intergenic
1179976718 21:44872720-44872742 AAAGAAGCAGTGAGGGCGCGGGG - Intronic
1180058191 21:45370340-45370362 AAAGGAGAAGACAAGGAACTTGG - Intergenic
1180103783 21:45603899-45603921 AAAGTAGAAGAGAAGGAGAAAGG - Intergenic
1180121351 21:45750533-45750555 AACGAAAGAGGGAAGGAGCTGGG - Intronic
1180923804 22:19538244-19538266 AAAGAAGGAGAGACGGAGAGAGG + Intergenic
1181013409 22:20055085-20055107 ACAGATGCAGAGAAAGAGCCAGG - Intronic
1181755504 22:25021611-25021633 AAGGAAGGAAGGAAGGAGCTAGG + Intronic
1182012515 22:27012369-27012391 AGAGAACCAGAGAGGGTGCTTGG + Intergenic
1182041599 22:27242473-27242495 AAAGAAGCAGAGGAGGAAGAAGG - Intergenic
1182113781 22:27743155-27743177 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1182293753 22:29301166-29301188 AAGGAAGCAATGAAGGAGATGGG - Intergenic
1182777962 22:32845022-32845044 AAAGAAGCAAGGAAGAGGCTGGG - Intronic
1182973009 22:34595280-34595302 AAAGAGGGAGAAAAGGAGATGGG + Intergenic
1183454154 22:37912357-37912379 GAAGTGGCTGAGAAGGAGCTGGG + Exonic
1183698496 22:39436769-39436791 AAAGAAGATGAGAGTGAGCTGGG - Intronic
1183833816 22:40435510-40435532 TCATGAGCAGAGAAGGAGCTTGG - Exonic
1183983889 22:41558639-41558661 GAAGAAGCAGGCAAGGGGCTAGG + Intergenic
1184753479 22:46502519-46502541 AAAGACGCAGAAAAGGAGGGAGG + Intronic
1184963715 22:47951067-47951089 AAAACAGCAGACAAGAAGCTAGG + Intergenic
1185136074 22:49073398-49073420 AATGAATGTGAGAAGGAGCTTGG + Intergenic
949162267 3:895221-895243 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
949227857 3:1715338-1715360 AAGGAATCTGAGAAGGAGATTGG - Intergenic
949516789 3:4814650-4814672 GAAGACGCAGAGGAAGAGCTGGG + Intronic
949670331 3:6392576-6392598 AAAAAAGTAGAGAAGCATCTAGG - Intergenic
949920511 3:8996557-8996579 AAGGAAGGAGGGAAGGAGGTGGG + Intronic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950079940 3:10214375-10214397 AAAAAAGCAAAAAATGAGCTGGG - Intronic
950801987 3:15560043-15560065 AGAGAGGCAGGGAAGGTGCTAGG + Intergenic
951091211 3:18576191-18576213 AAAGAAGCAGAACAGGAGTGAGG - Intergenic
951925569 3:27905653-27905675 AAAAAATCAGAGACAGAGCTGGG + Intergenic
952173983 3:30841653-30841675 AAGGAAGGAGAGAAGGAATTAGG + Intronic
952284353 3:31953877-31953899 AGAGGAGGAGAGAAGGAACTGGG + Intronic
952620450 3:35333255-35333277 AAAGAGGAAGAGAAAGAGGTAGG - Intergenic
953029511 3:39169387-39169409 AAAGAAACTGAGAGGGGGCTGGG + Intergenic
953177026 3:40562146-40562168 AGAAAAGCAGAGAAGGGGTTGGG - Intronic
953668133 3:44940629-44940651 AAAGAAACATAGAAGGGGCCTGG - Intronic
953679108 3:45026379-45026401 GAAGAGGCAGAGGAGGAGGTAGG - Exonic
953711345 3:45273642-45273664 AATGGGGCAGAGAAGAAGCTGGG + Intergenic
953724472 3:45385833-45385855 AATGAAGCAGACAAGTTGCTAGG - Intergenic
953805790 3:46066217-46066239 AAAGAAGCAGAGAGAGAGCGAGG - Intergenic
954103691 3:48397847-48397869 TAAGAAGCAAAGAAGGACCTGGG + Intronic
954341472 3:49957446-49957468 AAAGAAAATGAGAAGGGGCTAGG - Intronic
954596675 3:51830907-51830929 AGAGAAGCAGAGAAAGAGTGGGG - Intergenic
954652336 3:52172683-52172705 CAAGGAGAGGAGAAGGAGCTGGG + Intergenic
954957949 3:54538486-54538508 AAAGAAGCTGTGAAGGGGCAAGG - Intronic
955927450 3:64022382-64022404 GAAGATGCAGAGAAGAATCTAGG - Exonic
956030462 3:65031432-65031454 GAAGAAGCAGAGGAGAAGTTGGG + Intergenic
956037698 3:65113139-65113161 AAAAATGCTGAGCAGGAGCTAGG - Intergenic
956481255 3:69675920-69675942 CAGGAAGCATAGAGGGAGCTTGG - Intergenic
956709040 3:72024105-72024127 ATAAAAGCAGAGAAGGGGTTGGG - Intergenic
957047583 3:75388208-75388230 AAAGCAGAAGAGCAGGTGCTGGG - Intergenic
957106435 3:75894892-75894914 AAAGAACAAGAGAAGAAACTAGG - Intergenic
957174152 3:76783812-76783834 GAAGAAGCAGAGAAAGAGAAAGG - Intronic
957248393 3:77740915-77740937 ACAGAAGAAGAAAAGGAGCCAGG - Intergenic
957481739 3:80806712-80806734 AATGAAGGAGGGAAGGAGCAGGG - Intergenic
958436594 3:94104283-94104305 AGAGAAGCAGAGAAAGGTCTGGG - Intronic
958577475 3:95971325-95971347 GAAGAAGAAGAGAAGGATTTTGG - Intergenic
958806908 3:98822710-98822732 AAGGAAGCAGACAACCAGCTGGG + Exonic
959174879 3:102894879-102894901 AAAGAAGAAGGGAAGGAGAGAGG - Intergenic
959461464 3:106630885-106630907 AAAGAAGCAGAAAAAAAGATAGG + Intergenic
959540694 3:107534468-107534490 GAAGAAGAAGAGAAGGAGGGAGG - Intronic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959827050 3:110810415-110810437 AAAGAATCAGAGATGGAGTAGGG + Intergenic
960080039 3:113531999-113532021 AAAGAGGCAGGTAAGGAGCAGGG - Intergenic
960211815 3:114977420-114977442 AAAGAAGCAGAGAACAAGGTAGG + Intronic
960328194 3:116322815-116322837 AGAGAAGCAGAGAAAGAGGAAGG - Intronic
960520732 3:118652045-118652067 AAAGCAGCTGTGAAGGAGCCAGG - Intergenic
960788967 3:121405293-121405315 AAAAAAGCAGAAAAGAAGATAGG - Intronic
960792412 3:121448107-121448129 AGAGGAGTAGAGAAGGAGATAGG - Intronic
960815317 3:121665931-121665953 GAAGCAGGAAAGAAGGAGCTAGG - Intronic
960923143 3:122768608-122768630 AAAAAGGCAGAGAAGGTGCCAGG + Intronic
961112400 3:124296279-124296301 AAAGAAGAAGGTAAGAAGCTTGG - Intronic
961164930 3:124757080-124757102 CCAGAAGCAGAGAAGGGGTTGGG + Intergenic
961228275 3:125274679-125274701 AAAGGGGCAGAGAATGGGCTTGG + Intronic
961516954 3:127443983-127444005 ACACAAGCAGCGAATGAGCTTGG - Intergenic
961534413 3:127560946-127560968 AAACAAGCAGAGAAGGGGAAGGG - Intergenic
961554564 3:127689256-127689278 AAAGAAGAAGAGAGTGAGATGGG + Exonic
961660223 3:128464780-128464802 AAAGAAGGAGGGAAGGAGGGAGG - Intronic
961711787 3:128833733-128833755 AGAAAAGCAGAGAAGGTGTTGGG + Intergenic
961971330 3:130971728-130971750 AAAGAAGCAGCAAAGGTACTTGG - Intronic
962282014 3:134059259-134059281 TGAGAAGCAGAGAAGGAGAGTGG - Intergenic
962668212 3:137678225-137678247 AAAGAAAGAGAGAAGGAGAGAGG + Intergenic
962828829 3:139122063-139122085 ACACTAACAGAGAAGGAGCTGGG - Intronic
963123829 3:141797424-141797446 AAAGGCGCAGAGGAGCAGCTGGG + Intronic
963656647 3:148060638-148060660 AAAGCAGCAGAGAAAGCACTTGG - Intergenic
963684081 3:148415172-148415194 AGACAAGCAGAGAAGGGGTTGGG - Intergenic
964321330 3:155500848-155500870 CAACATGCAGAGAATGAGCTGGG + Intronic
964343195 3:155730199-155730221 AAGGAAATAGAGAAGGAGATGGG + Intronic
964362856 3:155916401-155916423 AAAGGAGGAAAGGAGGAGCTGGG - Intronic
964466116 3:156995386-156995408 AAAGAAGAAGAATAGGAGTTAGG - Intronic
965118165 3:164518728-164518750 AAAGAAGTAGAGAAAGACATAGG - Intergenic
965136506 3:164778327-164778349 AAAGAGGAAGGGAAGGAGTTAGG + Intergenic
965584759 3:170307728-170307750 AAAGAAGTAGAGATGGGGCATGG - Intergenic
965954502 3:174352316-174352338 AAAGAAACAGAGAAGGAAAGAGG + Intergenic
966191352 3:177274326-177274348 GGGGAAGCAGAGAAGGAGCCTGG - Intergenic
966279029 3:178208329-178208351 AGAAAAGCAGAGAAGGGGCAGGG - Intergenic
966279095 3:178208547-178208569 AGAGACACAGAGAAGGGGCTGGG - Intergenic
966472958 3:180312340-180312362 AAGGAAGGAGAGAAAGAGCAAGG - Intergenic
966854440 3:184184440-184184462 TAAGAATTAGAGAAAGAGCTGGG - Intronic
966921534 3:184614940-184614962 GAAGAAGCAGAGAGGAAGCCGGG - Intronic
967017498 3:185495398-185495420 AAAAAAGCAGTGAAGGAGGAGGG - Intronic
967091450 3:186138116-186138138 ATAGAAACAGAGTGGGAGCTGGG - Intronic
967149884 3:186638778-186638800 AAAGAGGTTGAGAAGGATCTGGG - Intronic
967187401 3:186956556-186956578 ACAGAAGCAGAAAAAGTGCTGGG - Intronic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967557628 3:190877128-190877150 AAAGACGCTGGGAAGGAGCCAGG + Intronic
967605348 3:191438492-191438514 AAAGAAGGAGAGAGGGAGGGAGG - Intergenic
967770716 3:193330728-193330750 AAAGAAGCAGAGGAGGAGAGAGG + Intronic
967864965 3:194182466-194182488 AAAAAAGCTGAGAAGGAGAAAGG + Intergenic
968217800 3:196908526-196908548 AAAGAACTAGAGAAGCGGCTGGG + Intronic
969054807 4:4394970-4394992 GCAGAGGCAGAGTAGGAGCTGGG + Intronic
969334988 4:6502518-6502540 AAGGAAGCAGGGAAGGAGGGAGG - Intronic
969342737 4:6552568-6552590 TCAGAATCAGAGAAGGAGATGGG - Intronic
969628844 4:8323487-8323509 AGAGAACCAGAGAAGAAGCTGGG - Intergenic
969726043 4:8918761-8918783 AAAGAAGGAAGGAAGGAACTGGG - Intergenic
969823477 4:9738238-9738260 AAAGCAGAAGAGCAGGTGCTGGG + Intergenic
969872869 4:10115917-10115939 GAAGGAGCAGACAAGGACCTGGG + Intronic
969873638 4:10120111-10120133 AAAGGGCCAGAGAAGTAGCTGGG - Intergenic
970570644 4:17378363-17378385 AAAGAAGGAGGGAAGGAGAAAGG + Intergenic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971037241 4:22707101-22707123 AAAGAAGGAGATACGGAGCTGGG + Intergenic
971110593 4:23580960-23580982 AAACTAGCACAAAAGGAGCTTGG + Intergenic
971118286 4:23674460-23674482 AAAGATGCAGAGAACAACCTAGG - Intergenic
971180386 4:24324390-24324412 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
971343398 4:25790709-25790731 AAAGAAGGAGAGAGGGAGGGAGG + Intronic
971444834 4:26732161-26732183 AACGAAGCAGAGTAGAAGCAAGG - Intronic
971464007 4:26934971-26934993 AAAAAAGCAGAGAATGAGTGAGG + Intronic
971576178 4:28278539-28278561 AAAGAAGTGAAGAAGAAGCTTGG - Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
971967807 4:33584107-33584129 AAAGAAACAGAGAAAGATTTAGG - Intergenic
972357995 4:38299233-38299255 AAAGAAGCAGAGAAAGAGAAAGG + Intergenic
972490039 4:39578698-39578720 AAAATAGCAGAGAATGGGCTGGG + Intronic
972679614 4:41292949-41292971 AAAGAGGGAGAGAAGGAGGGAGG + Intergenic
972745546 4:41928854-41928876 AAAGAAACACAGTAGGGGCTAGG + Intergenic
973248527 4:48036931-48036953 AAAGAAGAAGAGAAAGGGCCAGG + Exonic
973534314 4:51866086-51866108 AGAGAGGCAGAGAATGCGCTAGG + Intronic
973772864 4:54222703-54222725 AAGGAAGCAGGGAAGGAGGGAGG - Intronic
973887989 4:55342100-55342122 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
973977914 4:56281452-56281474 AATGCAGCAGAACAGGAGCTAGG + Intronic
973981966 4:56314888-56314910 AGAGCAGCAGGGAAGGAGCGGGG + Exonic
974321233 4:60352926-60352948 AAAGAAGGCAAGAAGTAGCTGGG + Intergenic
974352747 4:60771614-60771636 GAAGAGGTAGAGAAGGAGTTGGG - Intergenic
974428561 4:61768823-61768845 AGAAAAGCAGAGAAAGGGCTGGG + Intronic
975122316 4:70742438-70742460 AAAGTAGGAGAGGAGGAGGTGGG - Intronic
975393109 4:73843040-73843062 AAAGAGGAAGAGAAGGACCCAGG + Intronic
975713703 4:77185914-77185936 AGATAAACAGAGAAGGAACTGGG - Intronic
975810943 4:78168939-78168961 ACAGAAGAAAAGAAGGAACTGGG + Intronic
976317623 4:83675724-83675746 ACAGAAACAAAGAAAGAGCTAGG + Intergenic
976549465 4:86378234-86378256 AGTGAGGGAGAGAAGGAGCTAGG - Intronic
976875884 4:89852959-89852981 ATAGAAGTGGAGAAGGAGCTGGG - Intergenic
977198594 4:94089158-94089180 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
977593318 4:98850842-98850864 AAAGAAGGAGGGAAGGAGGGAGG + Intergenic
977839596 4:101686575-101686597 AATGAAGGAAAGAATGAGCTAGG - Intronic
978157891 4:105510268-105510290 CAAGAAGTAGAGAAGTGGCTGGG - Intergenic
978161458 4:105553000-105553022 AACGTAGCAGAAATGGAGCTGGG - Intronic
979046984 4:115879605-115879627 ACAGAGGCAGAGAAAGAGCAGGG + Intergenic
979379654 4:119994600-119994622 AGACAAGGAGAGAAGGAGTTGGG - Intergenic
979495676 4:121380273-121380295 AGAGAAGGAGCGAAGGAGCGGGG + Intronic
979993555 4:127404411-127404433 ACAGAAGCAGGGAAGAAGCAAGG + Intergenic
980011869 4:127604929-127604951 AAAGAAATAAAGAAGGAGCTAGG + Intergenic
980427442 4:132644752-132644774 ACAGTAGCAGAGAGGGAGCTAGG - Intergenic
980521017 4:133934568-133934590 AAAGACTCAGAGGAGGAGCAAGG + Intergenic
980972712 4:139581798-139581820 AAATGAGCAGAGAAGTAGCAGGG - Intronic
981675433 4:147338217-147338239 AAAGAACAAGAGAAGGGGCTGGG + Intergenic
981823511 4:148913531-148913553 AAAGAACAAGACAAGGATCTTGG - Intergenic
982314726 4:154020643-154020665 AAAGAAGCAAGGAAGGATCCTGG - Intergenic
982354747 4:154453659-154453681 AAAGAAGGAAGGAAGGAGGTTGG - Intronic
983219780 4:165032889-165032911 CAAGAATCAGAGTAGGAGCCAGG + Intronic
983365011 4:166775317-166775339 AAAGAAGCAGAGATGAAAATGGG - Intronic
983414878 4:167440354-167440376 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
983999042 4:174218112-174218134 AAATAAACAGGGAAGGAACTGGG - Intergenic
984007610 4:174332163-174332185 AAAGTAGCAGGGAAAGAGCTGGG + Exonic
984099210 4:175465966-175465988 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
984195743 4:176656856-176656878 AAAGAAACAGAGAAGTGGCTGGG - Intergenic
984399933 4:179249650-179249672 AATAAAGCAGAGAAGGGGATGGG + Intergenic
984519025 4:180778152-180778174 AAAGTAGAAGAGAAGTTGCTGGG - Intergenic
984612338 4:181855871-181855893 AAGCAAGGAGAGAAGGAGGTAGG + Intergenic
985158182 4:187014962-187014984 GATGCAGCAGAGAGGGAGCTTGG + Intergenic
985229322 4:187798466-187798488 AAAGAGGCAGCGAAGCAGGTAGG + Intergenic
985435564 4:189926991-189927013 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
985494781 5:198308-198330 AAACAGGCAGGGAAGGTGCTGGG + Exonic
985669354 5:1199170-1199192 ATAGAGGCAGAGAAGGAGAGAGG - Intergenic
985770732 5:1808589-1808611 AGAGAAGCAAAGACGAAGCTGGG - Intronic
986288677 5:6380003-6380025 AAAGAAGCAAAGAACAAGCATGG + Intergenic
986618279 5:9642938-9642960 AAAGAAAGAGAGAAGGAGGGAGG - Intronic
986905614 5:12491013-12491035 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
987163855 5:15173621-15173643 AAAGAAGCACTGAAGGGACTAGG + Intergenic
987210539 5:15677512-15677534 AAAGAAGGAGAAAAGGAGGGAGG + Intronic
987295354 5:16545638-16545660 AAGGAAGCTGACAGGGAGCTTGG - Intronic
987487339 5:18539485-18539507 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
987498295 5:18673392-18673414 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
987905904 5:24076934-24076956 AAAGAAGAAAAGAAGATGCTAGG + Intronic
988122776 5:26989423-26989445 AAAGGAGCAAAGAAGCAGTTCGG + Intronic
988230994 5:28479427-28479449 AAAAAAGCAGAGAAGGAAAAGGG - Intergenic
988518953 5:31929210-31929232 AATGAATCAGAGAAGCAGGTTGG - Intronic
989428765 5:41327275-41327297 GAAGAAGCAGAAAAGGTGTTTGG + Intronic
989602617 5:43213922-43213944 AAAGAAAGAGAGAAAGAGCTAGG - Intronic
989710362 5:44389562-44389584 AAAGGGGCAGAGAAGGGGGTGGG + Intronic
989810670 5:45669224-45669246 AAAGAAGAAGAGATGGAGTCAGG + Intronic
989955266 5:50351696-50351718 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
990110596 5:52318314-52318336 AAAGAAGGGAAGGAGGAGCTAGG - Intergenic
990321760 5:54636571-54636593 CAAAAAGCAGAGTAGGGGCTGGG - Intergenic
990546807 5:56830357-56830379 CAAGAAACAGAGACGGAACTTGG - Intronic
990566661 5:57036564-57036586 AGAGAAGCAGAGAAGGAGAAAGG + Intergenic
990663163 5:58041755-58041777 AAAGAGACTGAGAAGGAGCAGGG + Intergenic
991105329 5:62836528-62836550 AAAGAAGAAGAGGAGGAGGAAGG + Intergenic
991639332 5:68737790-68737812 AGAGAAGGAAAGAAGGAACTTGG + Intergenic
992018822 5:72602405-72602427 AAAGGAGCAGAGTGGAAGCTGGG - Intergenic
992021082 5:72624912-72624934 AAAGAAACAGAGAAGAGGATGGG + Intergenic
992206490 5:74435160-74435182 AATGCAGCAAGGAAGGAGCTGGG + Intergenic
992439821 5:76788361-76788383 CAAAAAGCAGAGAAAGAACTCGG + Intergenic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992617795 5:78562036-78562058 AAAGAGGCACAGAAAGAGCCTGG + Intronic
993192551 5:84699645-84699667 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
993316102 5:86408059-86408081 AAAGAAGGAGAGAACGAGAAAGG + Intergenic
993777425 5:92017115-92017137 AATGAAGCAGAGCAGGAGCATGG + Intergenic
994164593 5:96595592-96595614 AAAGAAGCAGAGACAGTGATGGG + Intronic
994754139 5:103774115-103774137 AAAGAAACTGAGAAGGAACCAGG + Intergenic
995574746 5:113517679-113517701 AAAAAAAGAGAGAAGGAGCTAGG - Intronic
995806903 5:116063513-116063535 AAAATAGCAGAGAAGAAGATGGG + Intergenic
996101220 5:119447738-119447760 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
996185246 5:120465526-120465548 AAAGAAGCAGAGAAGGTGTCAGG + Intronic
996313009 5:122128356-122128378 AAAGAAGAAGAAGAAGAGCTTGG - Intergenic
996824143 5:127662226-127662248 AAAGAAACAGAGAAGCAGAGAGG + Intergenic
996927712 5:128847533-128847555 AAGGAGGCAGAGAAAGAGTTAGG + Intronic
997013664 5:129905706-129905728 AGAGAAGCAGCGGAGGGGCTGGG - Intronic
997274990 5:132578106-132578128 AAAAAATCAGAGATGGGGCTGGG - Intronic
997357118 5:133269935-133269957 AGAGAAGCAGAGCAGGTGCGTGG - Intronic
997406758 5:133655111-133655133 AAAGAAGCACAGGAGGAAATAGG - Intergenic
997828523 5:137129228-137129250 GGGGAAGAAGAGAAGGAGCTCGG - Intronic
998080136 5:139268281-139268303 AAAGAAGAAGAGAGGTAGCCAGG + Intronic
998251523 5:140556971-140556993 TGAGCAGCAGAGAAGGGGCTCGG + Intronic
999019220 5:148144635-148144657 AAAGGGGAAGAGAAGGAGCAGGG - Intergenic
999026671 5:148241024-148241046 AAAGAAGCTTAGAAAGAGCTAGG - Intergenic
999151260 5:149427694-149427716 AAAGAAGTAAAGGAGGGGCTGGG + Intergenic
999315578 5:150581932-150581954 ACAGAAGAAAAGAAAGAGCTTGG + Intergenic
999619033 5:153454244-153454266 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
999690287 5:154140546-154140568 CCAGAGGCAGAGATGGAGCTAGG - Intronic
999763581 5:154721534-154721556 AAAGGAGCTGGGAAGCAGCTGGG + Intronic
1000102392 5:158028720-158028742 AAAGAACAAGAGAAGGAGAGGGG - Intergenic
1000376349 5:160585806-160585828 GAAGAAGAAGAGAAGGCACTGGG - Intronic
1000519576 5:162279926-162279948 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1000872009 5:166588572-166588594 AAAGAAGAAGAAAAGGAGATGGG - Intergenic
1001324530 5:170712450-170712472 AAAGAAGCAGAGAGGGGGAATGG + Intronic
1001404590 5:171467011-171467033 AAATAAACAGAAAAGGAACTGGG + Intergenic
1001695896 5:173669586-173669608 AAAGAAGGAGGGAAGGAGAAGGG - Intergenic
1002397718 5:178971144-178971166 AAAGAGGCAGAGGAGAGGCTCGG + Intergenic
1002611134 5:180419276-180419298 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1003060892 6:2861305-2861327 AGAGAAGAAGAGAAGGAGAAGGG - Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004395095 6:15240833-15240855 AAAGAAAGAAAGAAAGAGCTGGG - Intergenic
1004496407 6:16167419-16167441 AAAGGAACAGAGAAATAGCTTGG - Intergenic
1004544954 6:16588781-16588803 AAAGAAGGAGGGAAGGAGGAAGG + Intronic
1004566144 6:16799630-16799652 AAAGAAGCAGGGACAGAGCCTGG + Intergenic
1004575059 6:16887118-16887140 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1004725626 6:18308824-18308846 AAAGAAGCAGGGAGGGAGGGAGG - Intergenic
1004737400 6:18421517-18421539 AAAAAAGAAGAGAAGAATCTGGG - Intronic
1005087567 6:22022541-22022563 AAAGAGGCAGAGAAGCAGGAAGG - Intergenic
1005857652 6:29874816-29874838 AAAGAAGGAGGGAAGGTGATAGG - Intergenic
1006182893 6:32164555-32164577 TAAGAAGGAGAGGAGGGGCTGGG - Intronic
1006202950 6:32313086-32313108 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006203607 6:32319566-32319588 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006474031 6:34243907-34243929 AGAGAAACAGCGAAGGAGCTGGG + Intronic
1006519641 6:34563812-34563834 AATGAAGCAGGAAAGGAGCATGG + Intergenic
1006577794 6:35058770-35058792 CAAGAATCAGAGAAGTAGGTTGG + Intronic
1006640682 6:35488151-35488173 GGAGCAGCAGAGAAGGTGCTTGG + Intronic
1006732717 6:36248120-36248142 AAAGAAGCAGAGAAAATGTTTGG + Intronic
1006847825 6:37075093-37075115 AAGGATGCAGAGAAAGATCTTGG - Intergenic
1006910422 6:37559894-37559916 AGAGAAGCAGAGACGCAGCGAGG - Intergenic
1006937345 6:37727785-37727807 AAAAAAACAGACAAGCAGCTGGG - Intergenic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007069038 6:39021527-39021549 AAAGAACCGGGGAAGGTGCTTGG + Intronic
1007092718 6:39194126-39194148 AAAGAAGCAGAAAAAGAGGTGGG + Intronic
1007337862 6:41167603-41167625 ACAGAATCAAAGAAGGAACTGGG - Intergenic
1007460478 6:42014627-42014649 AAATAAGATGGGAAGGAGCTGGG + Intronic
1007724430 6:43906490-43906512 AAAGATGCAGAGTAGGGGCCGGG - Intergenic
1007913455 6:45538541-45538563 AAATTAGGAGAGAAGGAACTAGG - Intronic
1007985919 6:46206678-46206700 CCAGAAGCAGAGAAGGGGATGGG + Intergenic
1008350515 6:50484287-50484309 AAAGAGACAGAGAAGGAACAGGG + Intergenic
1009349101 6:62652389-62652411 AAAGAAGGTGAGAAAGAGGTAGG - Intergenic
1009777420 6:68222567-68222589 GAAGAAGAAGGGAAGGAGGTAGG + Intergenic
1009865083 6:69387300-69387322 AGAGAAGCAGAGAGGGAGAGAGG + Intronic
1010615821 6:78010942-78010964 AAAGAAGGAGAGAGGGAGAGAGG - Intergenic
1010732350 6:79404533-79404555 AGAGAGGCAGAGAGGAAGCTTGG + Intergenic
1010827080 6:80486969-80486991 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1010981003 6:82369458-82369480 AAGGAAAAAGAGTAGGAGCTTGG + Exonic
1011038524 6:83003994-83004016 AAAGATACAGAGAAGTAGTTAGG - Intronic
1011262473 6:85483769-85483791 AGAGAAGCCCAGAAAGAGCTTGG + Intronic
1011350668 6:86419991-86420013 GATGAAGCAGTGAAGGAACTAGG - Intergenic
1011454144 6:87528691-87528713 ATAGAAGCAGAGAAGTAGAATGG + Intronic
1011581630 6:88873204-88873226 AACGAGGCAGAGAAGCTGCTTGG - Intronic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1011986765 6:93457041-93457063 AAAGGAGCAGAAAAGGAGACAGG - Intergenic
1012066708 6:94558480-94558502 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1012157290 6:95835483-95835505 GAAGAAGTATACAAGGAGCTTGG - Intergenic
1012949243 6:105500607-105500629 AAAGATGGAGAGAAAGAACTGGG - Intergenic
1013015025 6:106153152-106153174 AAAGAACCAGAGAAAAAGCATGG + Intergenic
1013177976 6:107693435-107693457 AAAGAAGGAGAGAAGCGGCTGGG - Intergenic
1013335491 6:109155036-109155058 AAAGAAGCAAAGAAAGAAGTGGG + Intronic
1013367811 6:109448316-109448338 AAGGTGGCAGAGAATGAGCTGGG - Exonic
1013516269 6:110889156-110889178 TAGGAAGCAGAGAATGAGTTAGG + Intronic
1014421208 6:121247513-121247535 AAAGAAACAGAGTAGGAGAATGG + Intronic
1014685576 6:124495780-124495802 AAAGAATCAGAGATGGATCCTGG - Intronic
1014914352 6:127127694-127127716 GAAGAATCAAAGAAGGACCTTGG - Intronic
1015058123 6:128929205-128929227 GAAGAAGCTCAGAAGGCGCTGGG - Intronic
1015190862 6:130470672-130470694 AAAGCAGCAGACCAGGAGCTGGG + Intergenic
1015242044 6:131035432-131035454 AAGGAAGCAGAAGAGGAGATGGG - Intronic
1015266572 6:131296633-131296655 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1015277987 6:131403988-131404010 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1015820258 6:137253176-137253198 AAAGAAGGAAAGAAGAGGCTGGG - Intergenic
1016373169 6:143394824-143394846 AAAGAAGAGGAGGAGGAGTTGGG + Intergenic
1016383822 6:143512101-143512123 ACAGAGGCCGAGAAGGATCTAGG - Intergenic
1016603380 6:145889348-145889370 AAAAAAGTAGAGATGGAGGTAGG + Intronic
1016660069 6:146567950-146567972 AAAGAAGCAGAGCTGGTGTTGGG - Intergenic
1016823256 6:148365652-148365674 ACTGAAGGAGAGATGGAGCTAGG + Intronic
1016853099 6:148640949-148640971 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1017015508 6:150096366-150096388 AAAGGAGCAAAGCATGAGCTGGG - Intergenic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017807823 6:157961738-157961760 AAAGAAGAGGATTAGGAGCTGGG - Intergenic
1018304369 6:162439369-162439391 AAAGAAGCAGAGAGGAAGGGAGG - Intronic
1018394650 6:163368908-163368930 AAACAAGCAGAGAAGGCCCAGGG - Intergenic
1018468424 6:164074024-164074046 AAAGAGACAGAGAAGGAAGTGGG + Intergenic
1019073948 6:169371650-169371672 AGTGAAGGAGAGAAAGAGCTAGG + Intergenic
1019901964 7:4027991-4028013 AAAGGAGCAGAGAGGAAGGTAGG + Intronic
1020305586 7:6831612-6831634 AAAAATGCAAAGAATGAGCTGGG - Intergenic
1020314676 7:6897011-6897033 AAAGCAGAAGAGCAGGTGCTGGG - Intergenic
1020676283 7:11188755-11188777 AAAGAAGCTGAGTAAGTGCTGGG + Intergenic
1020684324 7:11274642-11274664 AAAGAAGAGGAAAAGGAGCCAGG - Intergenic
1020908793 7:14101931-14101953 AAAGGAGCAGAGAAGGTGCTGGG - Intergenic
1021200792 7:17726846-17726868 AATGAGGCAGAGAAGGAGGGAGG - Intergenic
1021592623 7:22280333-22280355 AGTGAAGCAGAGGAGGAGGTAGG + Intronic
1021845528 7:24758755-24758777 AATAAAGCAGAGGAGGAACTAGG - Intergenic
1022141899 7:27499988-27500010 AAGGAAACAGCCAAGGAGCTTGG - Intergenic
1022185025 7:27958861-27958883 AGACAAGCAGGGAAGGAGCTGGG + Intronic
1022372669 7:29785878-29785900 AGACATGGAGAGAAGGAGCTGGG - Intergenic
1022406345 7:30093788-30093810 AAGGAAGCAGAGGAGCTGCTTGG - Intronic
1022433840 7:30358815-30358837 AGAGAATCAGTGGAGGAGCTGGG - Intronic
1022749221 7:33205652-33205674 AAAGAGGCAGTGAAGCAGCAAGG + Intronic
1023024231 7:36036443-36036465 AAAAAAAAAGAAAAGGAGCTGGG - Intergenic
1023301022 7:38771289-38771311 AAAAAAGCAGAAAAGGAGGGAGG + Intronic
1023391485 7:39715363-39715385 AGAGAGTCAGAGAAGGAGATGGG + Intergenic
1023602318 7:41892140-41892162 AAGAAAGCTGAGAAGGAGTTGGG + Intergenic
1023658241 7:42447831-42447853 ATCGAAGCAGAGAAAGAGATTGG + Intergenic
1023709511 7:42976822-42976844 AAAAAAGAAGAGAGAGAGCTAGG - Intergenic
1023729247 7:43174471-43174493 AAGGAAGCAGAGAAGTAATTAGG - Intronic
1023956123 7:44888148-44888170 AAGAAACCAGAGAAGGAGCTGGG - Intergenic
1024588661 7:50862351-50862373 AAAGAACCAGAGAGGAAACTTGG - Intergenic
1024672817 7:51612163-51612185 AAAGCAGCAGAGAGGGAGGGAGG + Intergenic
1024697458 7:51871178-51871200 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1024773934 7:52759933-52759955 AGAGAAGGAAAGAAGGAGGTAGG + Intergenic
1024826142 7:53392021-53392043 AAAGAAGTAGGGAAGGCCCTCGG - Intergenic
1024920006 7:54545768-54545790 AAAGGAGAAGAGAAGGAGAGAGG + Intronic
1024938681 7:54739785-54739807 AAAGCAGCAGAAACGGAGGTGGG + Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1026178271 7:68016569-68016591 AAAGAAGGACAGAAGGAGGGAGG - Intergenic
1026232853 7:68500347-68500369 AAAAAAGAAGATAAGGGGCTGGG + Intergenic
1026545884 7:71321825-71321847 AAGGAAGGAGGGAGGGAGCTGGG - Intronic
1026563655 7:71471612-71471634 AAAGGAGAAGAGAAGGATCTAGG - Intronic
1026955012 7:74371592-74371614 AGAGAAGGAGAGAAGGAGGGAGG + Intronic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1027024999 7:74844846-74844868 AAAAATGCAGAAAATGAGCTGGG - Intronic
1027062765 7:75099273-75099295 AAAAATGCAGAAAATGAGCTGGG + Intronic
1027386368 7:77663079-77663101 AAAGAAGGAGAGAAGAAGGAGGG + Intergenic
1027710573 7:81595575-81595597 AATGAAGGAGAGAAGGGACTGGG - Intergenic
1028633514 7:92961972-92961994 AAAGAAGGATAGCAGGGGCTCGG + Intergenic
1029204892 7:98863675-98863697 AGAGAAGCAGGGAAGGAGGAAGG - Intronic
1029486927 7:100848921-100848943 AAAGAAAGAAAGAAAGAGCTAGG + Intronic
1029633855 7:101770789-101770811 AAAGAAGGAGAGAAGAAGGAAGG - Intergenic
1030288993 7:107853940-107853962 ACAAACGCAGAGAAGGACCTGGG + Intergenic
1030313520 7:108091684-108091706 AAAGGAGCAAAGAAGTAGCCAGG + Exonic
1030441856 7:109596593-109596615 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1030468232 7:109929960-109929982 AAAGCAGCAGAGAAGGGAGTAGG + Intergenic
1030872996 7:114780755-114780777 AGATAATCAGAGAAGGAGCAGGG - Intergenic
1031120566 7:117716841-117716863 AATGAAGCAGTGAGGGAGCGGGG + Intronic
1031348682 7:120701395-120701417 CAAGAAGCAAAGTAGGCGCTAGG + Intronic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1031526338 7:122825553-122825575 ACAGAAGCAGAGAAAGAACAAGG + Intronic
1031810808 7:126366470-126366492 AAATGAGCAGAGAGAGAGCTGGG + Intergenic
1032169037 7:129568996-129569018 AAAAAAACAGAAAAGGGGCTGGG + Intergenic
1032207350 7:129879157-129879179 AAAAAAGCAAAGTAGGATCTAGG + Intronic
1032270827 7:130403383-130403405 AATGAGGCAGAGGAAGAGCTGGG + Intronic
1032773442 7:135084496-135084518 ATAGAAGCAGAGAAGGATAGAGG - Intronic
1033039071 7:137901890-137901912 AAAGAAAAATAGAAGGAGCTGGG + Intronic
1033909627 7:146247908-146247930 AGAAAAGCAGAGAAGGGGTTGGG + Intronic
1034181948 7:149146282-149146304 AGAGCAGCAGAGATCGAGCTTGG - Intronic
1034238345 7:149590273-149590295 AAAGCAGGAGAGAAGGAGAGAGG - Intergenic
1034241439 7:149614266-149614288 AAAGTAGGAGAGAAGGAGAGAGG - Intergenic
1034657346 7:152740130-152740152 AAAGAAGAAAAGAAGGAGGGAGG - Intergenic
1034659421 7:152756675-152756697 ACACAAGAAGAGAAGCAGCTGGG + Intergenic
1034857349 7:154564032-154564054 AAAGAACCAGCGAGGGAGGTAGG + Intronic
1034955589 7:155332415-155332437 ACAGCAGCAGAAATGGAGCTGGG - Intergenic
1035065705 7:156103730-156103752 AATGAGCCAGAGAAGGAACTGGG + Intergenic
1036443328 8:8800637-8800659 AGATAAGCAGGCAAGGAGCTAGG - Intronic
1036631583 8:10519543-10519565 AATGAAGCAGAGAAGGGCATGGG - Intergenic
1037097990 8:15008643-15008665 AAGGAAGGAGGGAAGGAGATGGG + Intronic
1037408061 8:18565021-18565043 AAAGAAGCAAGGAAAGACCTAGG + Intronic
1037663204 8:20944400-20944422 AGAAAAGAGGAGAAGGAGCTGGG + Intergenic
1037674231 8:21040423-21040445 ACAGAAGCAGAGAGGGAGGGAGG - Intergenic
1037690563 8:21178004-21178026 AAGGTAGCAGTGAAAGAGCTAGG - Intergenic
1038071318 8:24017253-24017275 GAGGAAGCAGAGGAGCAGCTTGG - Intergenic
1038318393 8:26507509-26507531 AGAGAAGGAGAGAAGGAGGAAGG + Exonic
1038415950 8:27396139-27396161 CAAGGATGAGAGAAGGAGCTGGG - Intronic
1038895736 8:31779701-31779723 ATAGAAGCTGATAAGGAGCCAGG + Intronic
1038928853 8:32170904-32170926 GAGGAAGCAGGGAAGGATCTGGG - Intronic
1039079420 8:33721103-33721125 TAAGAAGAAGAGATTGAGCTGGG - Intergenic
1039192929 8:34997598-34997620 AAAGAAACAGAGAAAGAGAGAGG + Intergenic
1039301379 8:36212599-36212621 AAAGAGGGAGAGAAAGATCTGGG - Intergenic
1039467676 8:37796177-37796199 AAAGTAGATGAGAAGGAGCAGGG - Intronic
1040013890 8:42684844-42684866 AAAGAACTAGAGAAGTGGCTGGG + Intergenic
1040112000 8:43570759-43570781 GAAGAAGGAGACAAGGAGCCAGG - Intergenic
1040534667 8:48298045-48298067 AAAGGTGCAGAGAAGAAGCCAGG - Intergenic
1040544635 8:48388656-48388678 AAAGAACCAGAGAAGAGGTTGGG - Intergenic
1040551968 8:48444758-48444780 AAACAAACAGAGAATTAGCTGGG - Intergenic
1040949701 8:52925086-52925108 AAAGAGGAAGAGGAGGAGCCAGG - Intergenic
1041072516 8:54138985-54139007 AAAAAAGCAGAAAATTAGCTGGG - Intronic
1042637469 8:70894438-70894460 AAATAAACAGAGAAGTGGCTGGG - Intergenic
1042672765 8:71282641-71282663 GAAGAGCCAGAGAAGGAGATTGG - Intronic
1042700240 8:71604564-71604586 AAAGAAACTGAGAGTGAGCTAGG - Intergenic
1043187658 8:77175053-77175075 GAAGAAGTAGGGAAGAAGCTGGG - Intergenic
1043359265 8:79451916-79451938 ACTGAAGCAGGGAAGGAGCAGGG + Intergenic
1043595828 8:81883657-81883679 AAAGGAGAAGAGAACTAGCTAGG + Intergenic
1043602514 8:81957884-81957906 AAGTAGGAAGAGAAGGAGCTGGG - Intergenic
1044148675 8:88746749-88746771 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1044163014 8:88944458-88944480 AAAGAAGGAGAGAAGCAGTGAGG - Intergenic
1044300012 8:90572842-90572864 AAGGAAGCAGAGAAAGAGAGAGG + Intergenic
1044416920 8:91949179-91949201 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1044516809 8:93148447-93148469 AAAGATTCAGAGATGTAGCTGGG - Intronic
1044588421 8:93890085-93890107 AAAGAAGCAGGGGAGGAGGAAGG - Intronic
1044825630 8:96194180-96194202 GAAGAAGCAGAGTAGGAAGTTGG + Intergenic
1044985531 8:97753350-97753372 AAAGAAGAAGAAAAGGAGCCAGG + Intergenic
1045169562 8:99649326-99649348 AAAGGAGAAGAGAAAGAGATTGG - Intronic
1045325839 8:101117095-101117117 ATGGAAGCTGAGAAGGAGGTCGG - Intergenic
1045505023 8:102772234-102772256 AAAGAAAGAGAGAAAGAGGTAGG + Intergenic
1045644619 8:104287119-104287141 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1045943778 8:107770925-107770947 CAAGAAGCAGAGAAGTAGCCTGG + Intergenic
1045964745 8:108012013-108012035 TAAGAAAAAGAGAAAGAGCTGGG + Intronic
1046236307 8:111428100-111428122 AAGGAAGGAAAGAAGGAGCAAGG - Intergenic
1046511918 8:115213409-115213431 AGAAAAGCAGAGAAGGGGGTTGG - Intergenic
1046544869 8:115637192-115637214 CAAGAAACAGAGAAGAAGCTAGG + Intronic
1046559107 8:115815769-115815791 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1046614300 8:116459310-116459332 AAAGAAGAATAAAATGAGCTAGG + Intergenic
1046880538 8:119301771-119301793 AAAGGATCAGAGAAGGGGATGGG + Intergenic
1047342947 8:124000293-124000315 AAAGAAGCACTGAAGAAGGTAGG - Intronic
1047444889 8:124910826-124910848 GAAATAGCAGAGAAAGAGCTTGG - Intergenic
1047699120 8:127432633-127432655 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1047748735 8:127864481-127864503 AAAGAATAAGAGAAGGAGCGAGG - Intergenic
1047829705 8:128616440-128616462 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1047928600 8:129704409-129704431 AAGGGAGGAGAGAAGGAGGTAGG - Intergenic
1047940763 8:129825728-129825750 AAAGAAGAAGAAAAAGATCTGGG - Intergenic
1048296437 8:133218027-133218049 AAAAAAGCAGAGGAAGCGCTGGG - Intronic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048778462 8:137974228-137974250 TAAGATGCAAAGAAAGAGCTTGG - Intergenic
1049123688 8:140765994-140766016 AAGGAAGCAGTGAGGGTGCTAGG - Intronic
1049167394 8:141135129-141135151 AAAGAAAGAAAGAAAGAGCTGGG - Intronic
1049766918 8:144359157-144359179 AAAGAAACAGAGAAACAGATAGG - Intronic
1049807432 8:144547357-144547379 CATGAAGCAGAGGAGCAGCTGGG - Exonic
1050154690 9:2653800-2653822 GAAGAAGTATAGAATGAGCTTGG - Intronic
1050519166 9:6479142-6479164 AAAGAAGCAGAGAACGGGGTAGG - Intronic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1050644428 9:7703406-7703428 AAAGAAGCACTGAAGAGGCTAGG - Intergenic
1051106513 9:13587030-13587052 AAAGAAAGAGAGAAGGAGAATGG - Intergenic
1051408510 9:16764894-16764916 AAAGAAGGAGGGAAGGAGGGAGG + Intronic
1051408924 9:16768964-16768986 GAAGAAGCTGAGAAGTAGGTAGG + Intronic
1051716165 9:19987029-19987051 AAAGAAGCAGAACAGGAGAATGG + Intergenic
1051953569 9:22663085-22663107 AAAAAAGCAGAGAAGGGGTCAGG + Intergenic
1052174658 9:25443669-25443691 AAAGAAGGAGAGAGGGAGGGAGG - Intergenic
1052376431 9:27723052-27723074 ACAGAAGTAGAGAAGGAGGCTGG - Intergenic
1052497467 9:29245778-29245800 AAAGCAGCATAGAAGGAGGAGGG - Intergenic
1052851412 9:33380665-33380687 AAAGAAGGAGAGAGGGAGGAAGG - Intergenic
1052936064 9:34094107-34094129 TAAGAAGAAGAGAAAAAGCTGGG + Intronic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1053472446 9:38356646-38356668 AAAGAAGTAGACATTGAGCTGGG - Intergenic
1054187813 9:61967013-61967035 AAGGAAGCAGAGCAGCAGCCAGG + Intergenic
1054650702 9:67621568-67621590 AAGGAAGCAGAGCAGCAGCCAGG - Intergenic
1054710312 9:68504455-68504477 AAAGAAGCAGGAAAAGAGATAGG - Intronic
1054717773 9:68574084-68574106 TAAGAAGAAGAGAAGCAACTGGG + Intergenic
1054807655 9:69409313-69409335 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1054853543 9:69873628-69873650 AAAGAAGCAGAGAACTAATTTGG - Intronic
1055196221 9:73597571-73597593 AGAGAAAAAGAGAAGGAGCTAGG + Intergenic
1055230824 9:74063128-74063150 AAGGAACAAGAGAAGGAACTAGG - Intergenic
1055561253 9:77523712-77523734 AGAGGGGCAGCGAAGGAGCTAGG + Intronic
1055636153 9:78281318-78281340 AAAGAGGCAGAGAAGCCTCTTGG + Intergenic
1055702129 9:78956471-78956493 AAAAAAGCAGATAAGGAGCAGGG + Intergenic
1055738675 9:79361784-79361806 AAAGAAGTAGGGAAGGAGGGAGG + Intergenic
1055954520 9:81761513-81761535 AATGAAGCAGAGAAAGAGGGGGG - Intergenic
1055956191 9:81775841-81775863 AAAGAAGTAGGGAAGGAGGAGGG - Intergenic
1056032782 9:82570263-82570285 AGTGAGGAAGAGAAGGAGCTTGG + Intergenic
1056114650 9:83430175-83430197 ACAGGAGCAGGGAAGGAGTTAGG - Intronic
1056221566 9:84455008-84455030 AAAGAAGCAGAGAATTGGCAGGG + Intergenic
1056323602 9:85459323-85459345 AGACAAGGAGAGAAGGGGCTGGG - Intergenic
1056437402 9:86587845-86587867 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1056634990 9:88324231-88324253 AAAGAAGGAAAGAAGAGGCTGGG + Intergenic
1056689044 9:88790347-88790369 AAGGAAGTAGAGATGGTGCTGGG + Intergenic
1056721910 9:89079631-89079653 AAAGTAGCACAGAAGCAGCTGGG - Intronic
1056737093 9:89219326-89219348 AAGGCAGCAGGGAAGGAGGTGGG - Intergenic
1056885922 9:90443773-90443795 CAAGAAGCAGAGAGGGGCCTGGG - Intergenic
1056888356 9:90466281-90466303 AAAAAGGGAGAGAAGGAGCATGG + Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057274098 9:93667151-93667173 CAAGAAGGAGAGTGGGAGCTCGG + Exonic
1057470687 9:95353602-95353624 AAAGAAGGAGAGAAAGAGGAAGG - Intergenic
1057683802 9:97215789-97215811 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1057916468 9:99059469-99059491 AAAGAGGAAGAGAAGGCTCTAGG - Intronic
1058081027 9:100701204-100701226 ATAGAAGCAGAAAATGAGCAGGG + Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1058574503 9:106385938-106385960 AAAGAAGAAGAAAAGGAGTGGGG - Intergenic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059127479 9:111705410-111705432 AAAAAAAAAGAGAAAGAGCTGGG - Intronic
1059295507 9:113266573-113266595 AAAGAACCAGAGAGGCAGCTCGG - Intronic
1059302329 9:113323944-113323966 AAACAAACAGAGCAGGAGTTGGG - Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1059468019 9:114481667-114481689 GAAGGAGCAGAGAAGGAGGCAGG - Intronic
1059574457 9:115474538-115474560 AGAAAAGCAGAGAAGGGGTTTGG - Intergenic
1059606873 9:115843751-115843773 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1059750698 9:117244686-117244708 AAGGAAGGAGAGAAGGAGAAAGG + Intronic
1059863655 9:118490220-118490242 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1060044988 9:120332807-120332829 AAAGAGCAAGAGAAGGAGCCAGG + Intergenic
1060335829 9:122720966-122720988 AAAGAGACAGAGAAGAAACTGGG + Intergenic
1060372670 9:123089172-123089194 AAAGCAGCACAGAAGAAGGTAGG + Intronic
1060783781 9:126433258-126433280 AAAGGATCTGAGAAGGGGCTGGG - Intronic
1060891648 9:127193041-127193063 AAAGATCCAGTGAAGGACCTTGG + Intronic
1060938309 9:127528551-127528573 AGAGCAGCAGGGAGGGAGCTGGG - Intronic
1061035709 9:128113288-128113310 AAAGAAATAGAGAAGGGGCCAGG + Intergenic
1061087709 9:128409028-128409050 AAAGCAGCAGACAAAGAGCCGGG - Intergenic
1061153927 9:128845760-128845782 AAAGAAGAGGAGCAGGAGGTGGG + Intronic
1061441883 9:130610492-130610514 ACAGAAACAGAGAATTAGCTGGG - Intronic
1061498240 9:130987870-130987892 AAAGAGGCAGGGAAGGAGGTGGG + Intergenic
1061977640 9:134078584-134078606 AAAGAAGCAGTGGAGGAACAGGG + Intergenic
1062143958 9:134978786-134978808 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062143965 9:134978813-134978835 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062144002 9:134978925-134978947 AAGGAAGGAGAGAAGGAGGGAGG + Intergenic
1062477517 9:136736109-136736131 AAGGAAGAAGGGAAGGAGCTGGG - Intergenic
1062512338 9:136913799-136913821 AAAGATGGAGAGGAGGGGCTGGG - Intronic
1203772654 EBV:57517-57539 GAAGAAGTGGAGAAGGAGCCGGG + Intergenic
1203772665 EBV:57568-57590 GAAGAAGTGGAGAAGGAGCCGGG + Intergenic
1185575331 X:1167958-1167980 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1185680077 X:1881279-1881301 AAAGAAGGAGTGAAGGAGGGAGG + Intergenic
1185834065 X:3328967-3328989 AAGGAAGGAAAGAAGGAGCGAGG + Intronic
1186320216 X:8416150-8416172 TCAGAATCAGAGAAGGAGATGGG - Intergenic
1186341358 X:8649504-8649526 AATAAAGCAGAGGAGGAGATGGG - Intronic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1187631613 X:21179087-21179109 AAAAAGGCAGAGAAAGAGCTAGG + Intergenic
1187969679 X:24647212-24647234 AAAGAAGGGGAGAAGAAGCGGGG - Exonic
1188079195 X:25815401-25815423 AGAGAAGGAGAGAAGGAGAGAGG - Intergenic
1188079211 X:25815487-25815509 AGAGAAGGAGAGAAGGAGAGAGG - Intergenic
1188578153 X:31678602-31678624 AAAGAAGAGAAGAATGAGCTGGG + Intronic
1189207258 X:39252557-39252579 AAAGAAGAAGAGGAGGAGAAAGG + Intergenic
1189597824 X:42588724-42588746 AAAGAAAAAGTGAAGGACCTTGG - Intergenic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1189752594 X:44237782-44237804 AAAGGAGCAAACAAGGAGGTAGG - Intronic
1189767299 X:44384710-44384732 AGAGAAATAGAGAGGGAGCTGGG - Intergenic
1189849377 X:45163818-45163840 ATAGAACCTGATAAGGAGCTAGG - Intronic
1190054662 X:47174679-47174701 AGAGACGGAGAGAAGCAGCTGGG - Intronic
1190313484 X:49134049-49134071 AAAGAAGGAAAGAAAGAGCCTGG - Intergenic
1191670558 X:63744952-63744974 ATAGAGGCAGAGGAGGAGCTAGG - Intronic
1191767131 X:64710155-64710177 GAAGCAGCAGAGAAGGAGAGAGG - Intergenic
1192073342 X:67963806-67963828 AAGGAGGCAGAGAAAGAGATAGG + Intergenic
1192106008 X:68317648-68317670 GAAGAAGAAGAGAAGGAGGAAGG + Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192258622 X:69488990-69489012 GCAGAAGCAGAGAAAGAGATAGG - Intergenic
1192259979 X:69500063-69500085 GAAGAAGAAGGGAAAGAGCTAGG - Intergenic
1192361185 X:70440911-70440933 GAAGAAGAAGAGAAAGAGCATGG + Intergenic
1192399143 X:70816873-70816895 GAAGAATCAGAGAATGAGCATGG + Intronic
1192458478 X:71297572-71297594 AAAGAACCTGAGAAGCAGCCAGG - Intronic
1192790370 X:74376515-74376537 AAAAAAGGAGAGAAGGATATTGG - Intergenic
1193395901 X:80982904-80982926 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1194114690 X:89881181-89881203 TAAGAAGCAGCCATGGAGCTTGG - Intergenic
1194285518 X:92006200-92006222 AAGGAAGTAGAGAAAGAGATAGG - Intronic
1194293780 X:92104763-92104785 AGAAAAGCAGAGAAAGAGTTGGG + Intronic
1194351123 X:92825663-92825685 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1194553365 X:95329134-95329156 GAAGAGGCAGAGAAGGATATGGG - Intergenic
1194693075 X:97010388-97010410 AAAGAAGCAGTGAAGAAGGTAGG - Intronic
1194892122 X:99393480-99393502 GAGGAAGGAGAGAAGGAGATAGG - Intergenic
1195037852 X:100986402-100986424 AAAGAAGCATAAAGGGAGATGGG - Intronic
1195138144 X:101931663-101931685 AGAGAGGCAGCGAAGGAGATGGG + Intronic
1195504137 X:105637339-105637361 AAAGAAGGAGAAATAGAGCTTGG - Intronic
1195694243 X:107655125-107655147 AGTGAGGCAGAGAAGGAGCACGG + Intergenic
1195729971 X:107956959-107956981 AAAGAACTAGAGAAGCAGCCGGG - Intergenic
1195904581 X:109830789-109830811 AAAGAACCACAGAAGGAAGTGGG + Intergenic
1195908843 X:109869748-109869770 AGAAAAGCAGAGAAGGGGTTGGG + Intergenic
1196299844 X:114041147-114041169 AGAAAAGCAGAGAAGGGGTTGGG - Intergenic
1196356849 X:114805077-114805099 AAAGAAGCAGAACAGAAACTAGG + Intronic
1196537203 X:116861361-116861383 AAAGAGGTAGAGAAAGAGATTGG - Intergenic
1197304370 X:124822834-124822856 ACAGAAGCAGAAAAGAATCTAGG + Intronic
1197698383 X:129575699-129575721 ACACCAGCAGAGAAGGAGTTAGG - Intronic
1197962963 X:132025040-132025062 AAAGAAGGAGGGAAGGAGAGGGG - Intergenic
1198167713 X:134073591-134073613 AAATAAGCAAGGAAGGAGATGGG + Intergenic
1198342069 X:135724412-135724434 AAAAAAGCATAGAATGGGCTGGG - Intergenic
1198345921 X:135758884-135758906 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198347835 X:135776383-135776405 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198349740 X:135793645-135793667 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198351643 X:135810921-135810943 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198353554 X:135828183-135828205 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198355459 X:135845439-135845461 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198357369 X:135862724-135862746 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198359283 X:135880003-135880025 AAAAAAGCATAGAATGGGCTGGG + Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1198820468 X:140642308-140642330 TAAGAGGCAGAGAAGGAGGCAGG - Intergenic
1198938755 X:141930031-141930053 GAAGAAGTAGAGAAAGAGATAGG - Intergenic
1198982124 X:142409894-142409916 GAAGAAGGAGAGAAAGAGCTAGG + Intergenic
1199818864 X:151424626-151424648 AAAGAAGAAGAGGAGGAGTGGGG + Intergenic
1199855531 X:151756151-151756173 AAAGAAGCAAGGAAGGAGGAGGG - Intergenic
1200467430 Y:3536579-3536601 TAAGAAGCAGCCATGGAGCTTGG - Intergenic
1200603085 Y:5230738-5230760 AAGGAAGTAGAGAAAGAGATAGG - Intronic
1200659449 Y:5942343-5942365 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201240743 Y:11954802-11954824 AAAGAGGCAGGGAAGGAGCTGGG - Intergenic
1201366330 Y:13210793-13210815 AAAGATGCAGAGTGGCAGCTGGG - Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201524678 Y:14919356-14919378 AAGGAAGGAGAGAAGGAACAAGG + Intergenic