ID: 920561148

View in Genome Browser
Species Human (GRCh38)
Location 1:206939351-206939373
Sequence CCGGGTGTGCCGGTTGACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920561140_920561148 -3 Left 920561140 1:206939331-206939353 CCCTGCCGGCACCAGTACTTCCG 0: 1
1: 0
2: 1
3: 3
4: 50
Right 920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 40
920561144_920561148 -8 Left 920561144 1:206939336-206939358 CCGGCACCAGTACTTCCGGGTGT 0: 1
1: 0
2: 1
3: 3
4: 71
Right 920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 40
920561141_920561148 -4 Left 920561141 1:206939332-206939354 CCTGCCGGCACCAGTACTTCCGG 0: 1
1: 1
2: 1
3: 2
4: 44
Right 920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 40
920561139_920561148 6 Left 920561139 1:206939322-206939344 CCTCTAGCTCCCTGCCGGCACCA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 40
920561138_920561148 9 Left 920561138 1:206939319-206939341 CCACCTCTAGCTCCCTGCCGGCA 0: 1
1: 0
2: 1
3: 22
4: 235
Right 920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920561148 Original CRISPR CCGGGTGTGCCGGTTGACAG AGG Exonic
900510858 1:3060449-3060471 CGGGGTGTGCAGGGTGGCAGAGG - Intergenic
900583250 1:3419594-3419616 CAGGGTGTGTCTGTTCACAGAGG + Intronic
900796944 1:4713654-4713676 CGGGCTGTGCCTGTTAACAGAGG - Intronic
901385746 1:8907759-8907781 CCGGGTGTGAGGCTTCACAGCGG - Intergenic
902742417 1:18448074-18448096 CCAGGTGAGCCGCTTGACAGGGG - Intergenic
906117781 1:43367467-43367489 CCGGGTGTGTGGGTTGATATTGG - Exonic
911864872 1:103005845-103005867 CCGGGTCTGCCAGGTGACAAAGG - Exonic
920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG + Exonic
924425725 1:243948219-243948241 CCAGGTGTGGTGGTTGACACCGG - Intergenic
1063317558 10:5021146-5021168 CAGGGCGTTCCTGTTGACAGAGG - Intronic
1069999522 10:72365905-72365927 CCGGGTGTGGTGGTGCACAGTGG + Intergenic
1073180497 10:101580210-101580232 CTGGGTGAGCAGGTTGACAGAGG - Intronic
1073422273 10:103434096-103434118 CCTGGTGTGTGGGTTTACAGTGG + Intronic
1082032935 11:47619661-47619683 CCGGGTGTGATGGTTCACACCGG + Intronic
1084476266 11:69391427-69391449 CCGGGTGTGCTGGGAGACATGGG - Intergenic
1084696694 11:70760016-70760038 CCGGCTCTGCCGGTTTACAGAGG + Intronic
1089206016 11:116763312-116763334 CTGGGTGTGGGGGTGGACAGAGG - Intronic
1100482224 12:94990186-94990208 CAGGATGTGCAGGTTGACATAGG - Intronic
1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG + Exonic
1117202818 14:53409987-53410009 CCTGGTGAGCTGGTTTACAGGGG + Intergenic
1119555058 14:75546747-75546769 CCGGGTCTCCAGGTGGACAGGGG - Exonic
1122507246 14:102239487-102239509 CCTGGTGTGCCTGTTTGCAGAGG - Intronic
1135040941 16:19115906-19115928 CCGGGCGTGCCCGTCGAAAGCGG - Exonic
1148673784 17:49433076-49433098 CTGTGTGTGCTGGATGACAGTGG - Intronic
1152919636 17:83059511-83059533 CTGGGTGTGCCAGGTGGCAGTGG - Intergenic
1156245115 18:35290351-35290373 CCGGGTGTGAGGCTTCACAGCGG + Intergenic
1156501178 18:37559460-37559482 CTGGGAGTGCCCGTTTACAGTGG - Intronic
1159914616 18:74177257-74177279 CCGTGTGTGCCCGAGGACAGTGG + Intergenic
1160710831 19:550255-550277 CCGGGTCTGCAGGCTGGCAGGGG + Intergenic
1163284081 19:16335445-16335467 GCGGGTGTGCCGGGTGTGAGCGG - Intergenic
927467124 2:23345713-23345735 ACGGGTCTGCAGGTTGACTGGGG + Intergenic
945977099 2:216279575-216279597 CCGGGTCTCCCTGTTGGCAGAGG - Intronic
948776154 2:240290028-240290050 CCGGCTGTGACAGATGACAGGGG - Intergenic
1170550452 20:17471789-17471811 CTGGCTGTGCCGCTTGACAGAGG + Intronic
1176045656 20:63091320-63091342 CCGTGTCTGCCTGTGGACAGAGG + Intergenic
1183316998 22:37142346-37142368 CAGGGTGGGCCGGATGCCAGGGG - Intronic
1184177457 22:42796321-42796343 CGGGGTGTCCCGGTTGAAAATGG - Intergenic
1184432466 22:44449507-44449529 CCGGGTCTGCAGGTTGACTGTGG - Intergenic
968561064 4:1282736-1282758 ACGGCTGTACCGGTTAACAGTGG + Intergenic
975269802 4:72418483-72418505 CCAGGAGTCCAGGTTGACAGTGG + Intronic
999436263 5:151565994-151566016 CCGGGTGGACCTGATGACAGGGG - Exonic
1017801158 6:157897655-157897677 CCGGGTGTGGCGGTGGGCGGTGG - Intronic
1033132016 7:138752769-138752791 CCAGGAGTGCCAGTTGGCAGCGG + Exonic
1057216713 9:93232609-93232631 CCGGGGCTGCCGCTTCACAGTGG - Intronic
1060759953 9:126238630-126238652 ACGGGTGAGCCAGGTGACAGGGG + Intergenic
1203790170 EBV:147146-147168 CCGGGTGAGGCGGTTGTCACAGG + Intergenic