ID: 920563518

View in Genome Browser
Species Human (GRCh38)
Location 1:206956235-206956257
Sequence GTTGGCCAACTCTTCAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920563518_920563526 20 Left 920563518 1:206956235-206956257 CCTTTACTGAAGAGTTGGCCAAC 0: 1
1: 0
2: 0
3: 14
4: 116
Right 920563526 1:206956278-206956300 CTTCCCCAAACAGTGATGTGAGG 0: 1
1: 0
2: 0
3: 21
4: 162
920563518_920563522 -3 Left 920563518 1:206956235-206956257 CCTTTACTGAAGAGTTGGCCAAC 0: 1
1: 0
2: 0
3: 14
4: 116
Right 920563522 1:206956255-206956277 AACCCCGGGTTTAGTGCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920563518 Original CRISPR GTTGGCCAACTCTTCAGTAA AGG (reversed) Intergenic
902652762 1:17847217-17847239 CTTGGCAACCTCTTCTGTAAAGG + Intergenic
905228615 1:36496509-36496531 GTTGGCAAACTTTTTTGTAAAGG - Intergenic
905663175 1:39744257-39744279 TGTGGCAAACTCTTCAGTGAAGG - Intronic
907363624 1:53942558-53942580 GTTGGCAAACTTTTTTGTAAAGG - Intronic
908000897 1:59677733-59677755 GTTGGCCAATCTTTCATTAAGGG - Intronic
908155836 1:61351919-61351941 GTTGGACAAATATTCAGTTAAGG + Intronic
908973508 1:69867181-69867203 GTTGGCAATATCTTCACTAAAGG - Intronic
910303338 1:85733310-85733332 GTCGGCAAACTCTTCTCTAAAGG + Intronic
912630704 1:111244282-111244304 GTTGGCAAACTTTTCTGTAAAGG - Intergenic
915670450 1:157484723-157484745 GTAGGCAAACTTTTCTGTAAAGG - Intergenic
920372254 1:205486345-205486367 GTTGGCAAGCTTTTCTGTAAAGG + Intergenic
920447759 1:206032460-206032482 GTTTCCCAAGACTTCAGTAATGG - Intergenic
920563518 1:206956235-206956257 GTTGGCCAACTCTTCAGTAAAGG - Intergenic
921431192 1:215068093-215068115 GATATCCAACTCTTCAGTAAGGG + Intronic
921576952 1:216846386-216846408 GTTGGCAAACTTTTCTGTAGAGG + Intronic
923509577 1:234638623-234638645 GTTTGCCAAATCTTTGGTAATGG - Intergenic
1063938628 10:11105468-11105490 CATGGCCAACTCTTCTGGAAGGG - Intronic
1064027718 10:11861785-11861807 CATGGCCAACTCTTTGGTAAAGG - Intronic
1064946583 10:20797124-20797146 GTTAGCTGACTCTTCAGTCATGG - Intronic
1065468456 10:26050914-26050936 GTTGTCCAACTCATAAATAAAGG + Intronic
1068082282 10:52334157-52334179 CTTGGCCATCTCTTATGTAAAGG + Intergenic
1071837940 10:89438424-89438446 GTTGGCAAAATTTTCTGTAAAGG - Intronic
1074946022 10:118281413-118281435 GTTGGCAAACCTTTCTGTAAAGG + Intergenic
1075079525 10:119373991-119374013 GTAGGCAAACTTTTCTGTAAAGG - Intronic
1078329562 11:10408386-10408408 GTTGGCGAACTATTCTGTAAAGG + Intronic
1081850234 11:46270652-46270674 GTTGGCCCCCTCTTCAGTTCTGG + Intergenic
1085637289 11:78168657-78168679 TTTGCCCAACTCTTTGGTAAAGG + Intergenic
1086773318 11:90796564-90796586 GTTGGCAGACTTTTCACTAAAGG + Intergenic
1088685895 11:112284427-112284449 GTTGGCTAAATCTTCAGATATGG + Intergenic
1090971065 11:131643471-131643493 GTTGGCCAGCTCTTGAGGAAGGG - Intronic
1091607366 12:1966088-1966110 GTTGGCAAACTCTTCTCAAAGGG - Intronic
1091671256 12:2453731-2453753 GTCAGCCAACTTTTCTGTAAGGG + Intronic
1093957057 12:25232353-25232375 GTTGGCAAACTTTTCTATAAAGG - Intronic
1095119627 12:38401547-38401569 GTTGACAAACTTTTCTGTAAGGG + Intergenic
1098418746 12:70268003-70268025 GTTGGCAAACTTTTTCGTAAAGG - Intronic
1101788444 12:107907025-107907047 GCTGCCCAACTCCTCAGTGATGG + Intergenic
1102456171 12:113072005-113072027 GTTGGCCAGCTCTGCAGCAAAGG - Intronic
1104700499 12:130899751-130899773 TATGGGTAACTCTTCAGTAATGG - Intergenic
1105735713 13:23268231-23268253 GGTGGCCAACAATTCTGTAAGGG + Intronic
1107337862 13:39374647-39374669 GTTGGCAAACACTTCTATAAAGG - Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1109614817 13:64818696-64818718 GTTGGCAAACTCGTCTATAAAGG - Intergenic
1111136559 13:84053376-84053398 GTTAGCTAAGCCTTCAGTAAGGG - Intergenic
1120162014 14:81156098-81156120 GTTGGCAAACTATTCTGTAAAGG - Intergenic
1129943786 15:79521602-79521624 GATTGCCAACTCTTCAGACAAGG - Intergenic
1132439887 15:101850403-101850425 GTTGGCAAACTTTTCTGTAAAGG + Intergenic
1133997598 16:10760178-10760200 ATTGGCAAACTTTTCTGTAAAGG + Intronic
1141898941 16:86977526-86977548 GCTGGCCTCCTCTTCAGTACTGG - Intergenic
1142963385 17:3565127-3565149 GTCAGCAAACTCTTCTGTAAAGG + Intergenic
1146862965 17:36321241-36321263 GTTGGCAAAATATTCAGTTATGG - Intronic
1147093294 17:38125324-38125346 GTTGGCAAAATATTCAGTTATGG - Intergenic
1147103913 17:38195164-38195186 GTTGGCAAAATATTCAGTTATGG + Intergenic
1150808021 17:68334589-68334611 GTTGGGCAATTCTTTAGTACTGG + Intronic
1156279089 18:35615882-35615904 GTTGGCAGACTTTTCTGTAAAGG + Intronic
1159386305 18:67729524-67729546 GATGGCCAACTTTTCAATCATGG - Intergenic
1163458287 19:17421512-17421534 GTTGGCAAACTTTTATGTAAAGG + Intronic
1165552639 19:36601816-36601838 GTTGGCAAACTTTTCTGTAAAGG + Intronic
925210134 2:2038460-2038482 GCTGGCCAACCATTGAGTAATGG - Intronic
925914009 2:8591681-8591703 GTTAACAAACACTTCAGTAATGG - Intergenic
932058298 2:68468252-68468274 TTTGGCAAACTTTTCTGTAAAGG - Intronic
932089426 2:68791771-68791793 GTGGGCCATCTCTCCAGTCAAGG - Intronic
934856300 2:97732520-97732542 GATGGCCAACTGTTCAGCCATGG + Intronic
936487480 2:112938662-112938684 ATTGGCCAAATCTACAGCAATGG - Intergenic
937471307 2:122176150-122176172 GTTGGCAAACTTTTCCTTAAAGG + Intergenic
943043216 2:182827526-182827548 GTTGACAAACTTTTCTGTAAAGG - Intergenic
943859602 2:192844023-192844045 GTTGTCAAACTTTTCAGTGAAGG + Intergenic
945781806 2:214184067-214184089 GTTTGCCAACTCTTTGTTAATGG - Intronic
1170057591 20:12223717-12223739 CTTGGAAAACTCTTCAGTCATGG - Intergenic
1171314816 20:24180372-24180394 GTTGGCCAACAGTTCAGGAGAGG - Intergenic
1171949885 20:31412009-31412031 CTGGGCAAACTCTTCAGTTAGGG - Intronic
1173439512 20:43063497-43063519 GTAGGACCAGTCTTCAGTAAAGG + Intronic
1175163068 20:57023041-57023063 GTTGGGGAACTGTTCTGTAATGG + Intergenic
1175262419 20:57682963-57682985 CTTCTCCAACTCTTCAGAAAAGG + Intronic
1175345467 20:58270117-58270139 TTTGGCCACCTTTTCTGTAAAGG - Intergenic
1175453078 20:59087243-59087265 GTTGGCAAGCTTTTCTGTAAAGG - Intergenic
1179778573 21:43684446-43684468 GTTGCCAAATGCTTCAGTAAGGG + Intronic
1180895981 22:19332496-19332518 GTTGACAAACTTTTCTGTAAAGG - Intronic
1182467190 22:30524838-30524860 GCTGGCCCACTCCTCAGGAACGG - Exonic
1183589220 22:38770166-38770188 GTTGGCCGAGTCTGCAGTCAAGG + Intronic
1184193834 22:42913113-42913135 GTTGCCCACCTCATAAGTAATGG - Intronic
1184624244 22:45710804-45710826 GTTGGCAAACTTTTCCATAAAGG - Intronic
1184636742 22:45838372-45838394 GCTGGCCAGCTCTTCAGCAGGGG - Intronic
952451251 3:33435072-33435094 GTTGGCAAACCTTTCTGTAAAGG - Intronic
953181110 3:40596223-40596245 GTGGGCCAAGCCTTCAGTCAGGG - Intergenic
953630786 3:44614878-44614900 TTTGGCTAAATATTCAGTAAAGG - Intronic
955000596 3:54923836-54923858 GTTGGCAAACTTTTCTGTAAAGG + Intronic
962039636 3:131692688-131692710 GTTGGCAAACTTTTTAATAAAGG - Intronic
965397948 3:168183122-168183144 GTTGGCAAATTTTTCTGTAAAGG + Intergenic
966005031 3:175000361-175000383 GTTGGCAAACTTTTCTGTGAAGG + Intronic
970500287 4:16670075-16670097 GTTGGCAAACTTTTCTGTGAAGG - Intronic
976008643 4:80460542-80460564 GATGGCCAAAACTTCACTAATGG + Intronic
976581015 4:86737519-86737541 GTTGGTAAACTTTTCTGTAAAGG - Intronic
977892606 4:102329114-102329136 ATTAGCCAACTCTGAAGTAATGG + Intronic
978153913 4:105468223-105468245 GTTGGCAAAGTTTTCTGTAAAGG - Intronic
983483622 4:168306776-168306798 GTTGGCTAACACATCATTAAAGG + Intronic
986851650 5:11819735-11819757 CTTGGCAAACTCTCCAGGAATGG + Intronic
988858782 5:35255458-35255480 GCTTGCCAACTTTTAAGTAAAGG - Intergenic
992187746 5:74260178-74260200 GTGTGCCAACACTTCAGGAAGGG + Intergenic
994000075 5:94768873-94768895 TTTGGCTAAATATTCAGTAATGG - Intronic
1000347390 5:160325987-160326009 GTTGGCAAACTTTTTTGTAAAGG - Intronic
1006234849 6:32620476-32620498 TTTGGCTAAATATTCAGTAATGG - Intergenic
1009984127 6:70762399-70762421 GTTGGCAAACTTTTCCTTAAAGG - Intronic
1010284174 6:74055766-74055788 GTTGGCAAACTTTTCTGTAAAGG - Intergenic
1010595888 6:77763534-77763556 GTTGACCAACTGTTCAGCAATGG + Intronic
1015076338 6:129162956-129162978 GTTGGAAAACTTTTCTGTAAAGG - Intronic
1016892969 6:149024754-149024776 GTTATCAAACTCTTCAATAAAGG - Intronic
1019601465 7:1885833-1885855 GTGGGCCCACTCCTCAGGAAAGG + Intronic
1021748369 7:23767627-23767649 GCTGGCCAGCTCTTCTGTATTGG + Intronic
1023637145 7:42223656-42223678 GGTGGCCAACTTTACAGGAAGGG + Intronic
1024482517 7:49878939-49878961 CTTGGCAAACTTTTCTGTAAAGG - Intronic
1029029184 7:97450563-97450585 GTTGTCCAACTGTCCAGTCAAGG - Intergenic
1030133690 7:106225066-106225088 GTTGGCAAACTTTTCTGGAAAGG + Intergenic
1030639772 7:111991227-111991249 GTTGGTCAGCTCTCCATTAAGGG + Intronic
1031371227 7:120969234-120969256 GTAGACCAAGTGTTCAGTAAAGG - Intronic
1031642676 7:124184585-124184607 GTTGGCAATTTCTTCAGTACAGG - Intergenic
1037601784 8:20402702-20402724 CTTGGCAAATTCTTCAGTACAGG - Intergenic
1042039431 8:64577067-64577089 GTTGGCCAAAGCATCAGGAAAGG - Intergenic
1044114333 8:88315852-88315874 CTTGGCTAACTGTTCAGTGAAGG - Intronic
1044806174 8:96010609-96010631 GTTGGCCAATTCTCCAGGAAGGG - Intergenic
1048527495 8:135216444-135216466 GTAGGTCCACTCTTCAGTCAAGG + Intergenic
1049198353 8:141327515-141327537 GTTGGCCAACTCTTTCGGGAAGG + Intergenic
1049909928 9:256064-256086 CATGACCAACTCTTTAGTAAGGG + Intronic
1051866031 9:21683835-21683857 GTTGTCAAACTCATCATTAATGG + Intergenic
1058856969 9:109071899-109071921 GTTGGCAAATTTTTCTGTAAAGG + Intronic
1187307846 X:18113043-18113065 GTTGGCCAAGTCTCCATTAATGG + Intergenic
1188015087 X:25099534-25099556 GTTGGCAAACTTTTCTGTAAAGG - Intergenic
1188177910 X:27016881-27016903 GTTGGCAAAGTCTTCCTTAAAGG - Intergenic
1189710141 X:43802213-43802235 GTTGTCCCACTCTTCTGCAAGGG + Exonic
1190913483 X:54792779-54792801 TTTGCCCAAGTCTTCAGGAAAGG + Intronic
1194530009 X:95035787-95035809 GTTTGCCATAGCTTCAGTAAAGG + Intergenic
1196191091 X:112795622-112795644 GTTTGCCAACTTTTCTCTAAAGG - Intronic