ID: 920563663

View in Genome Browser
Species Human (GRCh38)
Location 1:206957336-206957358
Sequence GAAGGCAGGACTAAGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920563659_920563663 27 Left 920563659 1:206957286-206957308 CCAGATATAAGGGGGTATTACTG 0: 1
1: 0
2: 1
3: 14
4: 167
Right 920563663 1:206957336-206957358 GAAGGCAGGACTAAGCCTTCTGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920563663 Original CRISPR GAAGGCAGGACTAAGCCTTC TGG Intergenic
900523646 1:3117858-3117880 GAATGCAGGACAAAGGCTCCAGG + Intronic
902545643 1:17188195-17188217 GCAGGCATGAAGAAGCCTTCTGG - Intergenic
902633645 1:17720596-17720618 GCAGACAGGACTAAGGGTTCAGG - Intergenic
904498714 1:30902114-30902136 GAAGGCAGGCCTCAGCCAGCTGG + Intronic
905232364 1:36522161-36522183 GAAGGCAGAACTCTGCCCTCTGG - Intergenic
905916282 1:41686666-41686688 GAAGACAGTATCAAGCCTTCTGG + Intronic
906205511 1:43984486-43984508 GAAGGAAGGAATAAGCGTACTGG + Intronic
906345718 1:45013100-45013122 GAAGACAGGGCTCAGCCTTGAGG - Intronic
907855953 1:58303654-58303676 CAAGGCAGGACTGAGCCTCCAGG + Intronic
911566371 1:99467151-99467173 GAAAAGAGGACTCAGCCTTCAGG + Intergenic
914404652 1:147358513-147358535 GAAGGAAAGACTAAGTCTGCTGG - Intergenic
914964469 1:152242117-152242139 AAAGGCAGCACTAGACCTTCAGG - Intergenic
916818648 1:168377001-168377023 GAAGGCAGGAATTGGCCTTGGGG + Intergenic
920563663 1:206957336-206957358 GAAGGCAGGACTAAGCCTTCTGG + Intergenic
920819131 1:209364105-209364127 GAAGTGAGCACTGAGCCTTCGGG + Intergenic
921265017 1:213414977-213414999 GAAGCCAGTGCTAAGCCCTCTGG - Intergenic
1063417281 10:5884227-5884249 GAACTGAGCACTAAGCCTTCAGG + Intronic
1063656831 10:7998968-7998990 GAAAACAGAACAAAGCCTTCAGG + Intronic
1068175022 10:53447070-53447092 GAAGACAGTACCAAGCCTTGAGG + Intergenic
1069370973 10:67747178-67747200 GAAGGAAAGACTAAGTCTGCTGG - Intergenic
1070282763 10:75061930-75061952 TAAGGCAGGACTGAGCCTCCAGG + Intergenic
1070899610 10:80016625-80016647 GTAGGCAGGACGAACCCATCAGG + Intergenic
1072454470 10:95563855-95563877 TAAGGGAGGCCTAAGGCTTCAGG + Intergenic
1073757265 10:106593901-106593923 GGAAGCAGGACTAAGACTCCTGG - Intronic
1073806938 10:107108512-107108534 GAAGACAGCACCAAGCCATCAGG + Intronic
1073923596 10:108487244-108487266 GAGGGCAGGACTAGTCCTACAGG - Intergenic
1074772618 10:116743178-116743200 GAAGGCGCGACTCAGCCTCCGGG - Intergenic
1074781795 10:116807571-116807593 GAAGGCAAGTCTACTCCTTCAGG + Intergenic
1075234441 10:120713844-120713866 GAAGGCAGGACAAAGCAGTGGGG + Intergenic
1075985743 10:126783670-126783692 GAAGGAAAGACTGAGCCTTAAGG - Intergenic
1076336787 10:129712208-129712230 CAAGGCAGGACCAGGCCTTGGGG + Intronic
1080136080 11:28856855-28856877 GAAGGCAGAACCAAGCCATTAGG + Intergenic
1080221550 11:29911243-29911265 GAAGGCAGGAGGAAGCTTTTGGG + Intergenic
1080279411 11:30539495-30539517 CAAAGCAGGACTAAACCTTATGG + Intronic
1080771302 11:35344647-35344669 GCAGCCAGGACTCAGCCTTTTGG - Intronic
1081380493 11:42408699-42408721 GAAGACTGGAATAAGACTTCTGG - Intergenic
1083134698 11:60661282-60661304 CAAGGCAGGAGTATGCCTTGAGG - Intergenic
1084731349 11:71075644-71075666 GAAGCCGGGTCTGAGCCTTCTGG - Intronic
1086908237 11:92441904-92441926 GAAGGTAAGACTAAGTCTTGGGG - Intronic
1087099525 11:94351071-94351093 TAAGGCAGGAATAGGCCATCTGG - Intergenic
1089461997 11:118659030-118659052 GCAGGCAGGACTCAACCTCCAGG + Intronic
1090117068 11:123984731-123984753 GGAGGAAGGACTAAGTCTGCTGG + Intergenic
1091663419 12:2401042-2401064 GAAGGGAGGACCAAGCCTTGGGG - Intronic
1091782141 12:3220650-3220672 GGCAGCAGGACTAAGCCTCCGGG - Intronic
1092275647 12:7059065-7059087 GCAGGCAGGAAGAACCCTTCGGG + Intronic
1094196095 12:27751575-27751597 GAAGGCAGGGGAGAGCCTTCTGG - Intronic
1095866457 12:46978121-46978143 TTTGGCAGGACTAAGCCTTTGGG + Intergenic
1096648161 12:53049245-53049267 GAAGGTAGTACTCAGGCTTCGGG + Exonic
1096878435 12:54648184-54648206 GAAGGCAGGGCCCAGTCTTCAGG + Intronic
1101232329 12:102754168-102754190 GAAGCCAGGACTAAGCCAGCAGG - Intergenic
1104539574 12:129650938-129650960 GGAGGCATGTCTAAGCCCTCAGG + Intronic
1108896276 13:55333244-55333266 GAAGACAGCACTAAGCCATGAGG - Intergenic
1109332170 13:60943453-60943475 GAAGACAGGACTGAGCCATGAGG - Intergenic
1111007812 13:82272293-82272315 TAAGGCAGTAATAAGCATTCAGG - Intergenic
1112467554 13:99657290-99657312 GAAGGGAGGGCTAAACCTTTTGG + Intronic
1113527751 13:110994099-110994121 GAAGGAAAGACTAAGTCTGCTGG - Intergenic
1116080467 14:40164221-40164243 GAAGGCAGGACTGATCTCTCGGG + Intergenic
1120935160 14:89888564-89888586 GAAGACAGCACCAAGCCTTGAGG + Intronic
1120946847 14:90006009-90006031 GTAGGCTGGACTATGCCATCGGG + Intronic
1121013838 14:90536472-90536494 GAAGGCAGGAGTCTGCTTTCAGG - Exonic
1122384421 14:101334232-101334254 GCAAGCAGGACTCAGCCTTTTGG - Intergenic
1124047266 15:26161770-26161792 GATGGCTGGACTCAGCATTCTGG + Intergenic
1129271553 15:74421796-74421818 GAAGGCAGCACCAAGCCATCAGG + Intronic
1131446779 15:92504683-92504705 GCAGGCAGGACAAAGACTTTCGG + Intergenic
1131666993 15:94581248-94581270 GAAAGCAGGACTCAGCCATTGGG + Intergenic
1132742872 16:1424321-1424343 GCAGGCGGGACGAAACCTTCCGG + Intergenic
1132891607 16:2207510-2207532 GCAGACAGGACTAAGCCATCGGG - Intronic
1133146787 16:3793274-3793296 GAAGGCAGCACTCAGGCTGCCGG + Intronic
1137478496 16:48831279-48831301 GAGGTCATGACTCAGCCTTCTGG - Intergenic
1139532118 16:67547516-67547538 TCACGCAGGACTCAGCCTTCTGG - Intergenic
1140060803 16:71568083-71568105 GAAGGCTGGACTAGGCCTTGCGG - Exonic
1145220238 17:21082639-21082661 GAAAACAGGATTATGCCTTCAGG - Intergenic
1146480771 17:33203244-33203266 AGAGGCAGGACTAAGCTTTGGGG - Intronic
1150545830 17:66155958-66155980 GAAGGAAGGTTTAAGTCTTCTGG - Intronic
1151065074 17:71139447-71139469 GAAGGCAAGAATAAGCCTTGTGG + Intergenic
1152961988 18:85651-85673 CAAGGCAGGACTGAGGCTCCAGG + Intergenic
1156237946 18:35222169-35222191 TAAGGCAGGAATTAGCCATCTGG - Intergenic
1157543058 18:48525739-48525761 GAGGGCAGGATTAAGTATTCTGG + Intergenic
1157704073 18:49787308-49787330 GAAAGCAGGACTGAGTCTTAAGG - Exonic
1158204674 18:54979493-54979515 AAAGGCAGGGCTAAGGGTTCAGG + Intergenic
1159080103 18:63726932-63726954 GAAGGCAGGACTTGGCCGTCAGG - Intergenic
1159096296 18:63906201-63906223 GAAGGCAGCACCAAGCCATAAGG - Intronic
1160139441 18:76307930-76307952 GAAGGAAGGAGAAAGGCTTCTGG - Intergenic
1161967806 19:7558298-7558320 GAGGGCAGGACTCAGCCTGTGGG - Intronic
1162937605 19:13989192-13989214 GGAGGCAGGACTGAGCCTGGCGG + Intronic
1163044171 19:14626936-14626958 GTGGGCAGTACGAAGCCTTCAGG + Intronic
1163472637 19:17506234-17506256 GAAGGCAGGACTCGGCCAGCCGG + Intergenic
1165139334 19:33689513-33689535 GAAGCCAGGACTCTGCCTGCCGG - Intronic
1165265051 19:34654931-34654953 GCAGGCAGGAAGAATCCTTCGGG + Intronic
1166250864 19:41570042-41570064 GAAGCCAGGACTCAGCCTCCAGG + Intronic
1167372155 19:49089562-49089584 GAAACCAGGACTAAGTGTTCAGG - Intronic
1168139446 19:54375445-54375467 GAAGGAAGAACTAAGCCTCATGG - Intergenic
928126649 2:28621009-28621031 GAAGGCAAGACTGAGACATCAGG + Intronic
930487660 2:52027519-52027541 TAAGGCAGGAATCAGCCATCTGG + Intergenic
931891940 2:66682798-66682820 GAAGGCAGGTCTGAGACCTCAGG - Intergenic
936960605 2:118070007-118070029 GCAGGCAGGACTAAGCTTAGAGG + Intergenic
937775417 2:125770039-125770061 AGAGGCAGGACAAAGCCTTGGGG + Intergenic
939569219 2:143820353-143820375 GAAGGGAGGACAAAGACATCGGG + Intergenic
941088502 2:161146920-161146942 GAAGGAAAGACTAAGTCTGCTGG + Intronic
942141361 2:172980418-172980440 GAAGGTAGAACAAAGCCTTGGGG + Intronic
942799987 2:179863344-179863366 CAAGGCAGGATTAAGGCCTCTGG + Intergenic
942891748 2:180998367-180998389 GAAGGCATGTCTAAGGATTCAGG + Intronic
945826997 2:214733047-214733069 GAAGGTAGGACTAGCTCTTCAGG - Intronic
946111475 2:217421775-217421797 GAATCCAGGGCTTAGCCTTCTGG + Intronic
948729655 2:239954856-239954878 GAACGCAGGACTCACACTTCCGG - Intronic
1170767560 20:19303796-19303818 GAAGGCAAGACTTAGCCTCAGGG - Intronic
1171157915 20:22893508-22893530 GAAGACAGCACTAAGCCATGAGG - Intergenic
1172103086 20:32497435-32497457 GAAGGCTTGACAAAGCCATCAGG + Intronic
1172779752 20:37429231-37429253 GAAGGAAGGACATAGCCTTGTGG - Intergenic
1173091282 20:39974721-39974743 GAAGGAAAGACTAAGTCTGCTGG + Intergenic
1174052735 20:47778594-47778616 GTAGGCAGCACGATGCCTTCTGG - Intronic
1174812176 20:53655463-53655485 GAAGGCAGGGCTAAGCTTCAGGG - Intergenic
1175351037 20:58318303-58318325 GAAGGCAACAGTAAGCCTCCAGG - Intronic
1176206723 20:63892829-63892851 GAAGAGGGGACTGAGCCTTCAGG - Intergenic
1177005163 21:15663603-15663625 GAAGGCAGGGCTGGGCCTCCAGG + Intergenic
1177863181 21:26479169-26479191 AAAGACAAGACTGAGCCTTCAGG + Intronic
1177996253 21:28103005-28103027 GAAAGCCACACTAAGCCTTCTGG - Intergenic
1178142327 21:29698417-29698439 GAAGGCAGGACTGAGAGCTCAGG + Intronic
1179432394 21:41332070-41332092 GAAGGCAGCACCAAGCCATGAGG - Intronic
1181671317 22:24426789-24426811 GAAGGCAGGACCCTGGCTTCGGG + Intronic
1184066859 22:42126202-42126224 GAGGGCAGGACTCAGCCTGGAGG - Intergenic
1184069587 22:42139908-42139930 GAGGGCAGGACTCAGCCTGGAGG - Intergenic
1185029562 22:48434544-48434566 AAAGGCAGGACAAAGCCCCCGGG + Intergenic
1185029576 22:48434583-48434605 CAAGGCAGGACGGAGCCCTCGGG + Intergenic
949712317 3:6885563-6885585 GGAGGCAGGACTAGGCTTTGGGG - Intronic
949792324 3:7806674-7806696 GAAGGCTGGATTCAGCCTGCAGG - Intergenic
950217265 3:11168506-11168528 GAAGGCAGGACTGAGCATAAGGG + Intronic
950445471 3:13034998-13035020 GAAAGCAGGACAGAGCCTCCAGG - Intronic
953570346 3:44066503-44066525 GAAGGCAAGACTAGGCCTGTGGG + Intergenic
953661209 3:44893241-44893263 GAAGGGAGGACTCTGCCTACAGG - Intronic
953921659 3:46956094-46956116 GAAAGCAGACCTAAGCCTTAGGG - Intronic
956355447 3:68387181-68387203 GAAAGCAGGACTAAAAGTTCTGG + Intronic
956715909 3:72079833-72079855 GTAGACAGGACTAACCCTCCTGG - Intergenic
959066967 3:101667270-101667292 CAAGGCAGGAGTATCCCTTCAGG - Intronic
962442109 3:135429798-135429820 GAAGGCAGTTCTCAGGCTTCTGG - Intergenic
962599507 3:136980641-136980663 GGAGGAAGGGCTATGCCTTCAGG - Intronic
967574679 3:191076584-191076606 TGAGACAGGACTAAGCCTCCAGG + Intergenic
967915698 3:194576611-194576633 GAAGGCAGGAGGAACCCTTGAGG + Intergenic
968542764 4:1176226-1176248 GAAGGCAGGATAGAGACTTCTGG - Intronic
970372656 4:15423680-15423702 AAAGGCAGGCATAAGCCTGCAGG - Intronic
970383514 4:15532355-15532377 GAAGGCAGGCCTAAGTCTGGAGG - Intronic
973980025 4:56300343-56300365 GAGGGCAGGACTATGGCTTTGGG - Intronic
975720737 4:77246373-77246395 GAAGGGAGAAGTAAGCCTTCAGG + Intronic
978337227 4:107682422-107682444 CAAGGCAGCACTTTGCCTTCTGG - Intronic
979301075 4:119088122-119088144 GAAGGCAGGACTTAACCTAGAGG + Intergenic
981714044 4:147735092-147735114 GAATTCAGCAGTAAGCCTTCAGG - Intronic
983781213 4:171673012-171673034 GGAGGCAGGAATAAACCCTCAGG - Intergenic
984405188 4:179320194-179320216 GAAGACAGCACTAAGCCTTGGGG + Intergenic
986136004 5:4978513-4978535 GAAGACAGCACCAAGCCTTGAGG - Intergenic
986235035 5:5901632-5901654 AAAGGTAGGACTAAGTCTGCAGG + Intergenic
986333063 5:6732109-6732131 GAAGGCAGGGCAGAGCCTTGGGG + Intronic
987447854 5:18043494-18043516 GAACACAGGTCTAAGCCTTATGG - Intergenic
988830978 5:34987110-34987132 GCAGGCAGGAAGAAGCCATCAGG - Intergenic
991017996 5:61951704-61951726 GAGGGTAGGACTAAGCCCTGAGG - Intergenic
992162814 5:74018936-74018958 GAGGGCAGGTCTAAGCCATATGG - Intergenic
992782773 5:80143174-80143196 GAGGACAGGACTCAGCCTGCAGG - Exonic
994154246 5:96485081-96485103 GAAGGAAGGAGTGAGCTTTCAGG + Intergenic
998407583 5:141882834-141882856 GAAGGAGGGACCAAGCCTTAGGG + Intergenic
999596939 5:153215095-153215117 GAAGGAAAGACTAAGTCTGCTGG - Intergenic
999817984 5:155197059-155197081 GAAGACAGCACCAAGCCTTGAGG - Intergenic
1002313913 5:178331242-178331264 GAAGGCAGAAATGACCCTTCTGG + Intronic
1015127902 6:129774780-129774802 GTAGGCAGGACACTGCCTTCTGG + Intergenic
1017629537 6:156382989-156383011 GAAGACAGGACTAAGCCATGAGG - Intergenic
1018230787 6:161673359-161673381 GAAGTCAGGTGTGAGCCTTCTGG + Intronic
1020431575 7:8121170-8121192 GATGGCAGGACTAACCCCTGAGG + Intronic
1022601189 7:31761696-31761718 GAGGGTAGGACTAAGCCTTCAGG + Intronic
1024839854 7:53573820-53573842 GAAATCAGGTCTAAGCTTTCAGG - Intergenic
1030633243 7:111918438-111918460 GAAGGGGGGAATAAGCCATCTGG + Intronic
1031120533 7:117716580-117716602 GGAGTCAGCACTGAGCCTTCTGG - Intronic
1032155092 7:129461426-129461448 GAAGGCAGGACAAAGCCCTGGGG + Intronic
1033542107 7:142366720-142366742 GAAGACAGCACTAAGCCATGAGG + Intergenic
1037359843 8:18061612-18061634 GAAGGCTGGACTGTGCCTTCTGG - Intronic
1037760312 8:21737639-21737661 GGAGGCAGGACTGAGCCTCCTGG - Intronic
1041344623 8:56883979-56884001 GGAGAGAGGACTTAGCCTTCTGG + Intergenic
1049209527 8:141379059-141379081 GGAGGCAGGACACAGCCTTGAGG + Intergenic
1049574216 8:143382995-143383017 GGAGGCAGGACTGAGACCTCAGG - Exonic
1050299035 9:4238089-4238111 AAAGTCAGGAGTAAGCCTTTAGG + Intronic
1052163608 9:25293803-25293825 TAAGGCAGGAATAGGCCATCTGG - Intergenic
1054842879 9:69761640-69761662 AAAGGCTGGAGTTAGCCTTCTGG + Intergenic
1057299134 9:93866291-93866313 GAAGGCAGGAGTGAGGCTGCAGG - Intergenic
1057701150 9:97363982-97364004 CAAGGCAGGTCTGAGCCTGCAGG - Intronic
1059285035 9:113165254-113165276 GACTGCAGGACTAAGCCTGCAGG + Intronic
1060414871 9:123423194-123423216 GAAGGCAGGGCTGAGCTTTCGGG - Intronic
1061859098 9:133459078-133459100 GCAGGCTGGCCTGAGCCTTCAGG - Exonic
1062079509 9:134615910-134615932 CAGGGCAGGACAGAGCCTTCTGG + Intergenic
1062736155 9:138138466-138138488 CAAGGCAGGACTGAGGCTCCAGG - Intergenic
1185504914 X:624982-625004 GAAGGAAGGAAAAAGCTTTCTGG - Intronic
1187208727 X:17208097-17208119 GCAGGCAGGACGAACCCATCAGG + Intergenic
1188310793 X:28614049-28614071 GAAGGCAGTACTTAACCTGCTGG + Intronic
1188821496 X:34780710-34780732 GAAGTCAGGGCTAAGCTTTAGGG + Intergenic
1190062836 X:47222046-47222068 GACGGCTGGCCTAAGCCTTTTGG + Intronic
1190257746 X:48776232-48776254 GAAAGCAGGACTGAGTCTTAAGG - Intergenic
1193042189 X:77015628-77015650 GAAGACAGGATTCAGACTTCTGG - Intergenic
1194363606 X:92986090-92986112 GGAGGCAGGAACAGGCCTTCAGG - Intergenic
1194935812 X:99947117-99947139 GGAGGCTGAGCTAAGCCTTCAGG + Intergenic
1196151716 X:112381603-112381625 GAAGACAAGAATCAGCCTTCAGG + Intergenic
1196787042 X:119429871-119429893 GAAGGCAGGAGCAAGGATTCTGG + Intronic
1200671842 Y:6102346-6102368 GGAGGCAGGAACAGGCCTTCAGG - Intergenic