ID: 920564729

View in Genome Browser
Species Human (GRCh38)
Location 1:206964284-206964306
Sequence GTGGTTCAACATCTTGCGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920564724_920564729 11 Left 920564724 1:206964250-206964272 CCAGCTCTATGTGTCTTTCTACA 0: 1
1: 0
2: 1
3: 17
4: 302
Right 920564729 1:206964284-206964306 GTGGTTCAACATCTTGCGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920564729 Original CRISPR GTGGTTCAACATCTTGCGGT AGG Intronic
905088506 1:35406856-35406878 GTGGATCAACATGTTGTAGTAGG + Intronic
907522715 1:55034916-55034938 GTGAATCAACATGTTGCAGTCGG + Intergenic
907667509 1:56446456-56446478 GGGGTTAAACATCTTGCTGAAGG + Intergenic
911822339 1:102437675-102437697 GTGGTCCTACTTCTTGGGGTTGG - Intergenic
914463326 1:147904766-147904788 CTGTTTCAACATCATGGGGTTGG + Intergenic
920564729 1:206964284-206964306 GTGGTTCAACATCTTGCGGTAGG + Intronic
1066178054 10:32930460-32930482 GTTGTTCAGCATATTGCGATGGG - Intronic
1080899494 11:36474637-36474659 GTTGTTCAACAACTAGTGGTGGG + Intergenic
1083765389 11:64839036-64839058 GTGGTTCATGATCTTGCCGTAGG + Exonic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1116023866 14:39492662-39492684 GTGGTTCAGCAAATTGCGATTGG + Intergenic
1117694881 14:58350475-58350497 GTGGTAAAACATATTGCTGTTGG + Intronic
1129452429 15:75658499-75658521 GTGGTCCAGCAGCTTGCTGTGGG + Exonic
1133556600 16:6911640-6911662 GGGCTTCAACATCTTTTGGTGGG + Intronic
1135556015 16:23437213-23437235 GTGGTTCAGCATCATGGGTTTGG - Intronic
1140511402 16:75511235-75511257 GTGATTAAAGATCTTGCAGTAGG + Intergenic
1152203746 17:78962465-78962487 GTGGTTCAAATGCTTGCTGTGGG + Intergenic
1152681916 17:81672841-81672863 GTGGGTCCACATCTTGCAGGGGG + Exonic
1157882813 18:51337717-51337739 CTGGTTCAACATCTTGCTAGTGG - Intergenic
1161794756 19:6380308-6380330 GTCGTTGATCATCTTGCGCTCGG + Exonic
1164397997 19:27882773-27882795 GTGGTTCAATGTCCTGGGGTTGG - Intergenic
932838676 2:75061150-75061172 GGAGGTCCACATCTTGCGGTTGG + Intronic
933200746 2:79445381-79445403 GAGGTTCAACATCTGGCCCTAGG - Intronic
936899658 2:117468843-117468865 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
943777101 2:191778028-191778050 ATGGTTAAACATTTTGAGGTGGG + Intergenic
946058578 2:216921608-216921630 GTGGTTCAGAATCTTGCTATAGG + Intergenic
947314434 2:228840295-228840317 GTGGTTAAATGACTTGCGGTAGG - Intergenic
1169192490 20:3667065-3667087 ATGGTTTAACATCTCGGGGTGGG + Intergenic
1174131286 20:48345033-48345055 GTGGTTCAGCATCTTGGAGATGG - Intergenic
1175425521 20:58863009-58863031 CTGGTTCACCATCTGGCTGTTGG - Intronic
1181264942 22:21625433-21625455 GTGGCTCCACATGTTGCCGTGGG + Intergenic
1185294676 22:50047198-50047220 GTGGTTCAGCATCTGGTCGTAGG + Exonic
987781388 5:22440813-22440835 GTGATTAAAGATCTTGAGGTGGG - Intronic
997386492 5:133476959-133476981 GTGCCTCAACATCTGGGGGTGGG + Intronic
999439109 5:151587647-151587669 GTGGTTTAATATCTTGGGGTAGG - Intergenic
1002869423 6:1152903-1152925 GTGCTTAAACATCTTTCAGTGGG - Intergenic
1012913823 6:105146764-105146786 GTAATTCACCATCTTGGGGTTGG + Intergenic
1018619839 6:165719492-165719514 CTGGTTGAACATGTTGTGGTAGG + Intronic
1019593396 7:1846937-1846959 GAGGTTCTTCATCTTGCGGTGGG + Intronic
1028251181 7:88541561-88541583 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
1033418696 7:141186644-141186666 CTCGTTCAACATCTTGTGCTGGG + Intronic
1035402298 7:158574841-158574863 GTTGTTCGACATCCTGCAGTAGG - Intronic
1035486086 7:159227078-159227100 GCCGTTCAACAGCTTGCGTTAGG - Intergenic
1040760535 8:50836656-50836678 GTGGTTGAACAACTAGCTGTTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042009515 8:64225795-64225817 GTGGTTCTACATCTTTTGGTGGG - Intergenic
1043074140 8:75674416-75674438 GTGGTTCTCCAGCTTGCAGTTGG + Intergenic
1048927151 8:139281331-139281353 GTGATTAAGGATCTTGCGGTTGG + Intergenic
1051229885 9:14945092-14945114 GTCGTTGAACATCTTGTGGCTGG - Intergenic
1057733273 9:97630580-97630602 GTGGTTCAACATTTAGAGGTTGG - Intronic
1061200914 9:129138018-129138040 GAGGGTCAGCATCTTTCGGTGGG + Intronic
1186783201 X:12934057-12934079 GTGGTTCAACGTCTGGTGGTGGG + Intergenic
1191645409 X:63475364-63475386 GTGGTTTAACATCTTGGGACTGG - Intergenic