ID: 920567981

View in Genome Browser
Species Human (GRCh38)
Location 1:206991143-206991165
Sequence GAGTTAGCTGCCACTAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920567981_920567987 27 Left 920567981 1:206991143-206991165 CCTTGGCTAGTGGCAGCTAACTC No data
Right 920567987 1:206991193-206991215 TGCATAGCTACCTGTTCAATGGG No data
920567981_920567986 26 Left 920567981 1:206991143-206991165 CCTTGGCTAGTGGCAGCTAACTC No data
Right 920567986 1:206991192-206991214 ATGCATAGCTACCTGTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920567981 Original CRISPR GAGTTAGCTGCCACTAGCCA AGG (reversed) Intergenic
No off target data available for this crispr