ID: 920569018

View in Genome Browser
Species Human (GRCh38)
Location 1:207002243-207002265
Sequence AAGAGTTCTCAGGGCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920569015_920569018 8 Left 920569015 1:207002212-207002234 CCTTGCTTGTTGGAGCACTATTT No data
Right 920569018 1:207002243-207002265 AAGAGTTCTCAGGGCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920569018 Original CRISPR AAGAGTTCTCAGGGCTTTGA TGG Intergenic
No off target data available for this crispr