ID: 920570255

View in Genome Browser
Species Human (GRCh38)
Location 1:207010995-207011017
Sequence GATACTGGAGTGGTTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920570249_920570255 25 Left 920570249 1:207010947-207010969 CCTTTTGAGCATCCTTCAGGTAC 0: 1
1: 0
2: 0
3: 8
4: 83
Right 920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG 0: 1
1: 0
2: 0
3: 17
4: 136
920570251_920570255 0 Left 920570251 1:207010972-207010994 CCAGCTCTCTCAAGTATTGACTG 0: 1
1: 0
2: 0
3: 6
4: 158
Right 920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG 0: 1
1: 0
2: 0
3: 17
4: 136
920570250_920570255 13 Left 920570250 1:207010959-207010981 CCTTCAGGTACTGCCAGCTCTCT 0: 1
1: 0
2: 3
3: 20
4: 243
Right 920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG 0: 1
1: 0
2: 0
3: 17
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920570255 Original CRISPR GATACTGGAGTGGTTCTCAC AGG Intronic
901523894 1:9807146-9807168 GTTACTGCAGGGCTTCTCACAGG - Intronic
902381409 1:16054230-16054252 GATACTGGACTTGTACCCACAGG - Intronic
905043800 1:34980557-34980579 GAAACTGAAGTGGTTATCTCTGG + Intergenic
905669646 1:39783172-39783194 GACCCTGGAGTGGGGCTCACTGG - Intronic
908168549 1:61482631-61482653 GATACTGAAGCAGTCCTCACGGG - Intergenic
909724974 1:78823746-78823768 GATGCTGGAGGGGTGCTTACTGG - Intergenic
909960846 1:81840180-81840202 AATACTGGAATGGTAATCACAGG - Intronic
912526004 1:110283167-110283189 GAGACTGAACTAGTTCTCACAGG - Intergenic
915301249 1:154952818-154952840 GATAATGGACTGGGGCTCACTGG - Intronic
916177593 1:162055531-162055553 GGTTCTGGAGAGGTTCTCAGGGG + Intergenic
916692951 1:167208709-167208731 GAGACTGGTTTAGTTCTCACAGG - Intergenic
919853664 1:201691077-201691099 GATAATGGAGTGGGTCTTAATGG + Intronic
920570255 1:207010995-207011017 GATACTGGAGTGGTTCTCACAGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1066338248 10:34502460-34502482 GAGTCTGGTGTGGATCTCACTGG - Intronic
1068617777 10:59138421-59138443 GAGACTGGAATCTTTCTCACAGG - Intergenic
1069758106 10:70786061-70786083 GATACTGCACTTATTCTCACAGG + Intergenic
1072923716 10:99597860-99597882 GTTCCTGGAGTGGTGCTCACGGG - Intergenic
1074506449 10:114075233-114075255 ATTACAGCAGTGGTTCTCACTGG + Intergenic
1079476079 11:20830794-20830816 GAGACTGGAAAAGTTCTCACAGG - Intronic
1079610855 11:22431185-22431207 GATACTGCAGGGCTTCTTACAGG + Intergenic
1081650588 11:44821310-44821332 GATATTGGACTGTTTCTCACGGG + Intronic
1082748672 11:56995473-56995495 GTTATTGAAGTGGTTCTCAGTGG + Intergenic
1083889908 11:65590521-65590543 GATCCAGGAGTGGTTCACCCTGG + Exonic
1084032567 11:66489479-66489501 GGAACAGGAGTGGATCTCACTGG + Intronic
1087137036 11:94731394-94731416 GATACTAAGGTGGTTCTCAGAGG + Intronic
1087801484 11:102509362-102509384 GAGACTGGATTGGTTCACAGGGG + Intergenic
1089117226 11:116105451-116105473 GATACTGGAATGTGTCTTACTGG + Intergenic
1090169042 11:124582122-124582144 GAGACTGGATTAGTTCTCAAAGG + Intergenic
1091614249 12:2036882-2036904 GACACTGGAGGGGTTAGCACAGG + Intronic
1091797800 12:3307219-3307241 CATGCTGGAGTGGTGCTCACAGG - Intergenic
1094583307 12:31754668-31754690 GTTACTGGGATGGTTCTCAGTGG - Intergenic
1097154734 12:57004486-57004508 GGTACCAGAGTGGCTCTCACTGG + Exonic
1098870204 12:75808877-75808899 GATAGTGAGATGGTTCTCACGGG + Intergenic
1102275839 12:111581327-111581349 GTTGCTGGGGTGGTTCTCAGTGG - Intronic
1102423014 12:112818824-112818846 GATACTGCAGTGGATCTCTAGGG - Intronic
1102955239 12:117054636-117054658 GAAACTGGGGTGCTGCTCACGGG - Intronic
1103302437 12:119938249-119938271 GTTACTGGAGCAGTTCTCACAGG + Intergenic
1107122411 13:36809972-36809994 GAGACTGGAATAGTTCTCTCAGG + Intergenic
1107325153 13:39234169-39234191 GATAATGGAGTGGTTAGCAGGGG - Intergenic
1107585863 13:41847684-41847706 GATCCTTGAGTGGTTCTAATGGG + Intronic
1108080573 13:46730702-46730724 GATACTGGAGTGTTTCATATTGG - Intronic
1109633241 13:65080592-65080614 AATCCTGGATTGTTTCTCACTGG - Intergenic
1109674765 13:65661267-65661289 GATAGTGGAGTGAATCTTACTGG + Intergenic
1110614080 13:77521771-77521793 GATACTTGAGTCATTCTTACTGG + Intergenic
1113223012 13:108127109-108127131 GACACTGGTGTTGTTCTCACAGG - Intergenic
1117326589 14:54674531-54674553 GATACTGGTGTGGTTTCTACTGG + Intronic
1119150054 14:72350571-72350593 AATTCTGGAGAGTTTCTCACTGG - Intronic
1119207977 14:72809021-72809043 AAGACTGGATTTGTTCTCACAGG + Intronic
1120133429 14:80835045-80835067 GAGGCTGGACTGGTTCTCAAGGG + Intronic
1121298212 14:92847461-92847483 AAGTCTGGAGTGGGTCTCACTGG - Intergenic
1123584012 15:21741263-21741285 GATGCTGGAGTGGTTTTCTTTGG + Intergenic
1123620662 15:22183866-22183888 GATGCTGGAGTGGTTTTCTTTGG + Intergenic
1124624009 15:31297838-31297860 GAGACTGGAGTGGTGCACACAGG - Intergenic
1126387982 15:48113417-48113439 AATAGAGGAGTAGTTCTCACTGG - Intergenic
1126811812 15:52414112-52414134 GAGACTGGATTAGTTCTCTCGGG + Intronic
1134845869 16:17439839-17439861 GATACTGGAGTGGGTATCCTTGG - Intronic
1138893237 16:61170735-61170757 GATAGTGAATTAGTTCTCACAGG - Intergenic
1142426797 16:90005917-90005939 GTTCCTGGAGTGGCTGTCACAGG + Exonic
1142925681 17:3234036-3234058 GAAACTGGAGTGGTTACCTCTGG + Intergenic
1144324956 17:14169942-14169964 GAGACTGGATTAGTTCTCATGGG + Intronic
1148078276 17:44952516-44952538 GAGACTGGGGTAGGTCTCACAGG + Intergenic
1150179264 17:63098312-63098334 GAAACTTGACTGGTTCTCACAGG - Intronic
1151225453 17:72644687-72644709 GAAACTCAAGTGGTTCTCTCAGG + Intergenic
1152443604 17:80326535-80326557 GATACTGGAATGGTGGACACAGG - Intronic
1156118179 18:33812409-33812431 GAGGCTGGATTAGTTCTCACAGG - Intergenic
1156170754 18:34482230-34482252 GAGACTGGATTAATTCTCACAGG + Intergenic
1157973561 18:52299383-52299405 AATGCTGGGGTGGTTGTCACTGG - Intergenic
1158877430 18:61746682-61746704 GATCCTGGAATGTTTCTCAGAGG + Intergenic
1158878648 18:61755325-61755347 GATAATGGAGTGGGACTCAATGG + Intergenic
1158969818 18:62656094-62656116 GAGACTGAATTGGTTCTCAGCGG - Intergenic
1159237848 18:65700122-65700144 GATACTGGATTGCTTCTCCTGGG - Intergenic
1165553502 19:36608328-36608350 AATACTGGAAAGGTTTTCACTGG - Intronic
1167160855 19:47766316-47766338 GAGACTTGAGTGGCTCACACTGG + Intergenic
1168268476 19:55236623-55236645 GAAACTGGAGGGGGACTCACCGG + Exonic
1168287969 19:55343757-55343779 GATGCTGAAGTCATTCTCACCGG - Exonic
925002788 2:419574-419596 GATGCTGCAGTGGTTCCTACTGG + Intergenic
925038916 2:715076-715098 GAGACTGGACTGGCTCCCACTGG - Intergenic
925650591 2:6085439-6085461 GATTCTGGTGTTTTTCTCACAGG - Intergenic
925770221 2:7274876-7274898 GAAAATGGAGTGGTGGTCACTGG - Intergenic
929941904 2:46340473-46340495 GAGACTGGAGTGGTTAAAACAGG - Intronic
933103935 2:78297340-78297362 GAGACTAGATTAGTTCTCACTGG + Intergenic
940572086 2:155449747-155449769 GATACTGGTGTTTTTCTCCCAGG - Intergenic
947994570 2:234516055-234516077 TCTACTGGAGAGGTTTTCACTGG - Intergenic
948413340 2:237781899-237781921 GTTACAGCAGTGGTTCTCAATGG - Intronic
948733463 2:239982152-239982174 GGTCCTGAAGTGCTTCTCACTGG - Intronic
1168960146 20:1863559-1863581 GATACTGGAGAGGTTGACAAGGG + Intergenic
1169402867 20:5298021-5298043 GATTCTGGGGTGATTCTCTCTGG + Intergenic
1170672994 20:18452324-18452346 GATAGAGCAGTGGTTCTCAGAGG - Intronic
1170882990 20:20313944-20313966 GAAACTGAATTGGTTCTCACGGG - Intronic
1182768728 22:32777980-32778002 AATAATGTAGTGTTTCTCACTGG - Intronic
1184834679 22:47014219-47014241 GATGGAGGAGTGGTCCTCACAGG - Intronic
949261227 3:2105062-2105084 CTCACTGCAGTGGTTCTCACTGG - Intronic
949821731 3:8123395-8123417 GACTATGCAGTGGTTCTCACAGG + Intergenic
951610697 3:24489949-24489971 GATTCTTGAGTGAATCTCACTGG + Intronic
952471714 3:33661039-33661061 GATACTTGAGTAGTTTTCCCAGG - Intronic
952485657 3:33807303-33807325 CCCACTGGAGTGGTGCTCACAGG - Intronic
955316235 3:57941472-57941494 GAAACTGGATTAGTTCTCACAGG - Intergenic
955420994 3:58737582-58737604 TTTACTGGAGTAGTTCTCAGTGG - Intronic
956052999 3:65268674-65268696 GATTCTGGAATGATTCTCTCAGG + Intergenic
956339154 3:68201973-68201995 GAGACTGGATTAATTCTCACAGG - Intronic
957391946 3:79586352-79586374 GATACTGAAGTGGTGGTCAATGG + Intronic
962387363 3:134942724-134942746 GAAAATGGAGTGGATTTCACTGG + Intronic
962944013 3:140151228-140151250 GATAAGTGAGTGGTTGTCACAGG + Intronic
966242490 3:177769933-177769955 AATGCTGGATTAGTTCTCACAGG - Intergenic
967150842 3:186649029-186649051 GACACTGGAGTGGATCACAAAGG - Intronic
974726246 4:65802319-65802341 GAGACTGCAGTTGTTCTCACAGG + Intergenic
974742414 4:66023240-66023262 GATACTGGAGAGGTTATAAAAGG + Intergenic
976903840 4:90211435-90211457 GATTCTTGAGTGTTGCTCACAGG + Intronic
978014762 4:103729328-103729350 GAAACTGGATTAGTTCTCATAGG - Intergenic
978752734 4:112270750-112270772 GATACTGGAGTGGTAGTTAAGGG + Intergenic
981488092 4:145308913-145308935 GAGACTAGATTAGTTCTCACAGG - Intergenic
982986015 4:162207265-162207287 GAGACTGGATTAGTTCTTACAGG - Intergenic
991303982 5:65157143-65157165 CATGCTGGAGTGGTTCTCATTGG + Intronic
1001770949 5:174295414-174295436 GGTGCCGGAGTGGCTCTCACAGG + Intergenic
1008558702 6:52701821-52701843 GATACTGGAGTGTTTTTGATAGG + Intergenic
1011772729 6:90692766-90692788 GAGCCTGCAGTGGGTCTCACAGG + Intergenic
1014969537 6:127797309-127797331 GAAACTTGTGTGGTTCTCAATGG - Intronic
1018006986 6:159631579-159631601 GATACTGGAGGAGTTCTCTCTGG - Intergenic
1018596151 6:165482917-165482939 GAGACTGGGGTGGTTTGCACAGG + Intronic
1021494411 7:21258706-21258728 GATACCGGAGTTGTTCTTTCTGG - Intergenic
1021764330 7:23931628-23931650 GATACTGGAGCTGTTATCAGAGG + Intergenic
1025189236 7:56884084-56884106 GAGACTGGTGAGGTTCTCACCGG + Intergenic
1025682704 7:63692833-63692855 GAGACTGGTGAGGTTCTCACCGG - Intergenic
1025848581 7:65222773-65222795 GATAACTGAGTGGTTCTCATAGG + Intergenic
1029517240 7:101032788-101032810 GCCACTGGAGTGGTGCTGACAGG - Exonic
1029665040 7:101989630-101989652 GAGACTGGTGAGATTCTCACCGG + Intronic
1033910834 7:146261024-146261046 GATAGTGAAGGAGTTCTCACAGG + Intronic
1036092831 8:5687167-5687189 GATACTGGATGAGTTCTCATGGG + Intergenic
1037009330 8:13821084-13821106 AATACTGGTTTAGTTCTCACAGG - Intergenic
1038518212 8:28205333-28205355 GATACTGCAGTGGTGTACACAGG + Intergenic
1038767256 8:30440648-30440670 GATACTGCTTTTGTTCTCACTGG + Intronic
1040626717 8:49158102-49158124 GAGACTGGGTTGGTTCTCAAGGG - Intergenic
1042026880 8:64433377-64433399 GATGTTGCAGTGGTTCTCTCTGG - Intergenic
1043998003 8:86843048-86843070 GATACTGAAGTAGTACTCAGTGG + Intergenic
1044382326 8:91549076-91549098 GCTACTGAAGTGTTTCCCACGGG + Intergenic
1046696228 8:117342737-117342759 GATACTGGAGTATTCCTGACAGG - Intergenic
1050101671 9:2126508-2126530 GATATTGAAGGGGTTCTCATGGG + Intronic
1051097265 9:13480934-13480956 GAGACTGGAGTTGATCCCACAGG - Intergenic
1055282790 9:74693987-74694009 CATACTGGAAGGGTTTTCACTGG - Intergenic
1055997205 9:82172858-82172880 AATACTGGATTAGTTCTCATGGG - Intergenic
1056374106 9:85990228-85990250 GAGACTGGATTAGTTCTCACAGG - Intronic
1057897701 9:98922993-98923015 CATACTGAAGTGGTTCTCCAAGG - Intergenic
1059642218 9:116228449-116228471 GATAGCGGAGGAGTTCTCACTGG - Intronic
1185682709 X:1901648-1901670 GAAGTTGGAGTGGCTCTCACTGG - Intergenic
1186557300 X:10573426-10573448 GAGACTAGATTGGTTCTCACAGG - Intronic
1186629949 X:11338020-11338042 GACACTAGATTGGTTCTCAGGGG - Intronic
1189030717 X:37446880-37446902 GAGACTGGACTAGTTCTCACAGG - Intronic
1189195497 X:39148857-39148879 GATAGTGGGGTGGTCCACACTGG - Intergenic
1190320681 X:49177596-49177618 GAGAAAGGAGTGGTTCTCAGAGG + Intronic
1190577648 X:51856975-51856997 GACACTGGGGAGGTTCTCATGGG + Intronic
1193365539 X:80627958-80627980 GAGACTGGATTGGTTTTTACAGG + Intergenic
1195158624 X:102149073-102149095 GAGACTGGATTAGTTATCACTGG + Intergenic
1196222450 X:113127002-113127024 GACACTGGAGGGATTCTCTCTGG - Intergenic