ID: 920572940

View in Genome Browser
Species Human (GRCh38)
Location 1:207031659-207031681
Sequence CAGATTTACCTGCAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920572940_920572942 -3 Left 920572940 1:207031659-207031681 CCTTCCTTCTGCAGGTAAATCTG 0: 1
1: 0
2: 1
3: 17
4: 199
Right 920572942 1:207031679-207031701 CTGCCACACAAACTGCCAACTGG 0: 1
1: 0
2: 0
3: 7
4: 163
920572940_920572945 9 Left 920572940 1:207031659-207031681 CCTTCCTTCTGCAGGTAAATCTG 0: 1
1: 0
2: 1
3: 17
4: 199
Right 920572945 1:207031691-207031713 CTGCCAACTGGGACACCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 176
920572940_920572943 -2 Left 920572940 1:207031659-207031681 CCTTCCTTCTGCAGGTAAATCTG 0: 1
1: 0
2: 1
3: 17
4: 199
Right 920572943 1:207031680-207031702 TGCCACACAAACTGCCAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920572940 Original CRISPR CAGATTTACCTGCAGAAGGA AGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
902032418 1:13432648-13432670 CAGATCTCCCTTCTGAAGGAAGG - Intergenic
902342804 1:15795286-15795308 CATTTTTTTCTGCAGAAGGAAGG - Intergenic
907353857 1:53855955-53855977 CAGATTTACATGGGGAAGGTAGG + Intronic
907740241 1:57158419-57158441 CAGATAGATATGCAGAAGGAGGG - Intronic
910077441 1:83297908-83297930 AAGATTTACTTTGAGAAGGAGGG + Intergenic
911099030 1:94079334-94079356 CTGATTCACCTGCAGCACGAAGG - Exonic
911857686 1:102901451-102901473 CAGATTTATTGGCTGAAGGATGG - Intronic
912849733 1:113112574-113112596 CAGATTTCCTGGCAGAAAGATGG + Exonic
914333907 1:146698028-146698050 AAGGCTTCCCTGCAGAAGGATGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915349056 1:155213275-155213297 CAGCTTTGCCTGCAGCAGCAGGG - Exonic
915352243 1:155233902-155233924 CAGCTTTGCCTGCAGCAGCAGGG - Intergenic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
916152226 1:161806030-161806052 CAGATTTACCAGCAAAAGACAGG - Intronic
917527341 1:175800662-175800684 CAGATTTGACTGCAGGAGGGTGG + Intergenic
917779271 1:178374431-178374453 CAGATTTCCCTCCAGAAGGGGGG + Intronic
918274644 1:182942169-182942191 AAGATTTACCTGCAGAAAATGGG - Intronic
918755018 1:188329295-188329317 CAGATATACCTTCTGAAAGATGG + Intergenic
918855221 1:189745499-189745521 CTGATTTCCCTGCATAAGAAAGG - Intergenic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
919972152 1:202588003-202588025 ATGATTTCCCTGCAGAAGGAAGG + Exonic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
920607985 1:207408790-207408812 CAGATTTCCCTGAAGAAGATGGG - Intergenic
922632331 1:227128816-227128838 CAGACTTACGTGAACAAGGATGG - Intronic
923932234 1:238714175-238714197 TGGATTTACCTACAGAAGTAGGG - Intergenic
924718694 1:246603108-246603130 GAGATTTACCTCCAGATGCATGG + Intronic
1063039179 10:2319328-2319350 GTGTTTTACCTGCAGAATGAGGG - Intergenic
1063391306 10:5651422-5651444 AAGATGAACCTGCAGCAGGATGG - Intronic
1064488188 10:15819594-15819616 CTGATGTACCTGAAGTAGGATGG - Intronic
1065022857 10:21515383-21515405 CAGTTTTACCTGTAGGACGAGGG + Exonic
1069610504 10:69769466-69769488 CAGATGTACTACCAGAAGGAAGG + Intergenic
1070237704 10:74647207-74647229 CAGATTAAATTGGAGAAGGAAGG + Intronic
1072046928 10:91666633-91666655 CAGACCTCCCTGAAGAAGGAGGG - Intergenic
1072705538 10:97678195-97678217 CAGATTTCTCTGCAGTAGAAAGG + Intronic
1074467632 10:113697590-113697612 CAAACTTACCTGAAGAGGGACGG - Exonic
1077061604 11:620064-620086 CACCTTCACCAGCAGAAGGAAGG + Exonic
1078370688 11:10742211-10742233 CAGCTTTCCCTGCATGAGGAAGG + Intergenic
1080274188 11:30485568-30485590 CTGTTTTACTTACAGAAGGAGGG - Intronic
1081100463 11:38995478-38995500 CAGATTTCTCAGAAGAAGGAAGG - Intergenic
1083314040 11:61803165-61803187 CAGCTTTACCTGGAGAATGCTGG - Intronic
1083424215 11:62574744-62574766 CAGATTTATGCGCACAAGGACGG - Exonic
1083431228 11:62614491-62614513 CTGACTCACCTGCAGTAGGAAGG - Exonic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1084469397 11:69347883-69347905 CAGATATAGCTACAGAAGGTGGG + Intronic
1085542600 11:77286471-77286493 GAGGTTTCCCTGCAGTAGGAAGG - Intronic
1086146009 11:83552536-83552558 CAGATTTACTAGCAGAGGGGTGG + Intronic
1086796374 11:91109241-91109263 CAGATTTAACTTCAGAGTGAGGG - Intergenic
1086938454 11:92769563-92769585 CCTCTTTACCTGCAGATGGATGG + Intronic
1087803380 11:102528634-102528656 GAGATTTAACAGCAGAAAGAAGG - Intronic
1089635876 11:119811351-119811373 CAGATTTACCCACAAAAGAATGG - Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1092898610 12:13037617-13037639 GAGATTCACATGCAGAGGGACGG + Intergenic
1096181072 12:49550616-49550638 CTGATTTTCCTCCTGAAGGAAGG - Intronic
1098953463 12:76665272-76665294 TGGTTTTACCTGGAGAAGGAGGG + Intergenic
1099415218 12:82376381-82376403 CAGCTTGACTTGCAGAAGCAGGG - Intronic
1107662342 13:42651541-42651563 CAAATCTACCTGCAGAAGGAGGG - Intergenic
1108069045 13:46608538-46608560 CTTCTTTTCCTGCAGAAGGATGG - Intronic
1111770910 13:92594466-92594488 CAGCTTTACCTACATAAAGATGG + Intronic
1114684106 14:24511977-24511999 CAGATTTTCCTGAAGCAGGCTGG + Intergenic
1115043921 14:28966320-28966342 AAGTTTTAACTGAAGAAGGATGG - Intergenic
1117474266 14:56078045-56078067 CAGAATTACATGCAGCAGGGAGG + Intergenic
1117754649 14:58961040-58961062 CAGTGTTACTTGCAGATGGAAGG - Intergenic
1118762285 14:68887851-68887873 AAGATTTACCTGCAGAAAACGGG - Intronic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1121043645 14:90772172-90772194 CAGATTGCCCTGCAGAACGGTGG - Intronic
1121421357 14:93817997-93818019 CAGAGTTACCAGCAGAGAGAGGG - Intergenic
1121954931 14:98205138-98205160 AAGAGGAACCTGCAGAAGGAAGG + Intergenic
1121982068 14:98463222-98463244 AAGATTTAGCTGCAGAGAGAGGG - Intergenic
1123696302 15:22881450-22881472 CAGCTGGACCTGCAGATGGATGG + Intronic
1124340621 15:28887103-28887125 CGTATTTACTGGCAGAAGGAAGG + Intronic
1126853923 15:52818947-52818969 CAGCTTCACCTGAGGAAGGAAGG + Intergenic
1127284842 15:57523475-57523497 CAGATTTCCCTGCAAATGGCAGG - Exonic
1127807619 15:62535492-62535514 CAGAATTACCTGGAGAGAGAGGG - Intronic
1128114379 15:65096130-65096152 AAGCTTCACCTTCAGAAGGAGGG + Intronic
1129019848 15:72506693-72506715 AAGATTTTCCTACAGAAGCATGG - Intronic
1129036334 15:72651129-72651151 CTGATTTACCTCAAGAAGTAGGG + Intergenic
1129072361 15:72961939-72961961 CAGATTTAGCTTCAAGAGGAGGG - Intergenic
1129213553 15:74086096-74086118 CTGATTTACCTCAAGAAGTAGGG - Intergenic
1129396847 15:75254989-75255011 CTGATTTACCTCAAGAAGTAGGG + Intergenic
1129400459 15:75279267-75279289 CTGATTTACCTCAAGAAGTAGGG + Intronic
1131472980 15:92712022-92712044 AAGATTTACCTGCAGAAAACGGG + Intronic
1133120468 16:3603562-3603584 CAGATTTCACTGCAGTAGCACGG - Intronic
1135231439 16:20711821-20711843 CAGATTTAAGGGCATAAGGAAGG + Intronic
1135893805 16:26380312-26380334 CAGATTTAGCTTCAGAAGGTAGG + Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1139999711 16:71013221-71013243 AAGGCTTCCCTGCAGAAGGATGG + Intronic
1140867639 16:79077944-79077966 CAGAGTTTCCTGGAGAAGAAGGG - Intronic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1146585807 17:34080577-34080599 GAGAGGTACCTGCAGAGGGAAGG + Intronic
1147807900 17:43145169-43145191 AAGATTTACCTGCAGAAAACAGG + Intergenic
1148631000 17:49109211-49109233 CTGATTTGCCTACATAAGGATGG - Intergenic
1149013131 17:51878219-51878241 CAGAATTACCTCCAGAAAGTTGG + Intronic
1149863436 17:60137255-60137277 CAGATATACAAGCTGAAGGAGGG + Intergenic
1149939807 17:60851657-60851679 AAGATTTACCTGCAGAAAAGGGG + Intronic
1150172831 17:63018183-63018205 TAGATTTACCTGCAGTTGTAAGG + Intronic
1150848917 17:68686416-68686438 CAGCTTTACCTGGAGAATCAGGG - Intergenic
1153767141 18:8385506-8385528 CAGCTTTCCAGGCAGAAGGAAGG + Intronic
1156294694 18:35778803-35778825 CAGAGTTACCTCCTGAAGAATGG + Intergenic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1158502796 18:58018855-58018877 AAGATTTACCTGCAGAAAATGGG - Intergenic
1158557952 18:58490655-58490677 CACATTTTTCTGCAGAAAGAGGG - Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1166808429 19:45500528-45500550 CAGATTTACCTCCTGGGGGAGGG + Exonic
1168191120 19:54739461-54739483 CTGGTTTGCCTGCAGATGGATGG + Intronic
1168201264 19:54817488-54817510 CTGGTTTGCCTGCAGAGGGATGG + Intronic
925636995 2:5950115-5950137 CTGATTTTCCTGCAGAAGAAGGG - Intergenic
927491073 2:23521280-23521302 CAGCTCTGCCTGCAGGAGGAAGG + Intronic
928284767 2:29980198-29980220 CTGATTGCCCTGCAGAAGAAAGG - Intergenic
928565850 2:32548001-32548023 CAAATATACCTGCAGAAGGCAGG - Exonic
928670146 2:33594843-33594865 TAGGTTTACCTACAGCAGGAAGG + Intronic
934867663 2:97827462-97827484 AAGATTTACCTGCAGAAAATGGG + Intronic
936171948 2:110184638-110184660 CACCTCTACCTGCATAAGGAGGG + Intronic
936271906 2:111055475-111055497 AAGAGCCACCTGCAGAAGGAAGG - Intronic
939246480 2:139631087-139631109 CAGATTTAAGTGCAGTTGGAGGG - Intergenic
939300614 2:140332539-140332561 CACAATTATCTGGAGAAGGAGGG - Intronic
945299275 2:208200665-208200687 CAGTTGTAGCTGCAGATGGATGG + Intergenic
946962268 2:224997638-224997660 CAAATGTACCTGCTGATGGAGGG + Intronic
947688487 2:232112755-232112777 CAGATTTGCAGGCAGAAGGAGGG + Intronic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1170819149 20:19741401-19741423 CAGATTTACCCCCAGAAGTATGG + Intergenic
1171104751 20:22421773-22421795 CAGATTTTCCTGTACAAGGAAGG - Intergenic
1171447347 20:25214208-25214230 CTCATTTACCTGCAGGAGGAGGG + Intronic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1176956693 21:15113075-15113097 CAGCTTTCCAAGCAGAAGGAAGG + Intergenic
1179183365 21:39063392-39063414 CACACTTACCTGCAGAACTAAGG + Intergenic
1180743365 22:18069338-18069360 CAGATTTCATTGCAGCAGGAAGG + Intergenic
1181003634 22:19999374-19999396 TAGATTTGCCTACAAAAGGATGG - Intronic
1182021241 22:27083397-27083419 CAGAATCCCCTGCAGAAGGGAGG - Intergenic
950005086 3:9686365-9686387 CAGATCTGCCTGCAGAGGGTGGG + Intronic
950276965 3:11670015-11670037 AAGATTTACCTGCTGGAAGAGGG - Intronic
953014475 3:39059935-39059957 CAAATTTACCAACAGAAAGAGGG - Intronic
954865922 3:53729441-53729463 CAGTTTTGCCTGCAGATGGCCGG + Intronic
955010248 3:55006867-55006889 CAGCTCTAGCTGCAGAAGCAAGG + Intronic
955638922 3:61060762-61060784 CAGATTAAGCTCCAGATGGAAGG + Intronic
956164192 3:66384155-66384177 CAGATTGCCTGGCAGAAGGATGG - Exonic
956595956 3:70967431-70967453 CACATTTACAAGTAGAAGGAAGG - Intronic
963888161 3:150603673-150603695 CAGTTATACCTGGAAAAGGAGGG - Intronic
964527528 3:157631137-157631159 CAGATTTGCCTCCACAACGATGG + Intronic
964622988 3:158733937-158733959 CACAATTATCTGCAGAAGGAAGG - Intronic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967378696 3:188833548-188833570 CAGTTTTGCCTGCAGACAGAGGG - Intronic
967925228 3:194640526-194640548 CAGCCTTTCCTTCAGAAGGACGG - Intergenic
969292324 4:6247964-6247986 AGGATTTACCTGCAGATGGTGGG + Intergenic
969451892 4:7278621-7278643 CAGAGACACCTGCTGAAGGAAGG - Intronic
969843254 4:9899273-9899295 AAGTTTTAGCTGCAAAAGGATGG + Intronic
970360214 4:15301860-15301882 TAATTTTACCTGCAGAAAGAAGG - Intergenic
971020290 4:22528511-22528533 TATATTAATCTGCAGAAGGATGG - Intergenic
972378035 4:38491499-38491521 CAGATTCACCAACAGAAGAATGG + Intergenic
974486355 4:62510683-62510705 AAGATTTACCTGCAGAAAACGGG + Intergenic
974832435 4:67206224-67206246 TAGGTTTAGCTTCAGAAGGAGGG - Intergenic
976563664 4:86529740-86529762 CAGAAAGCCCTGCAGAAGGATGG + Intronic
980682483 4:136181586-136181608 CTGATTTATCAGCAGAAAGATGG + Intergenic
983587765 4:169374654-169374676 CTGATTTTACTTCAGAAGGAAGG + Intergenic
985192346 4:187389571-187389593 AAGAGTAACCAGCAGAAGGAGGG + Intergenic
986558716 5:9039120-9039142 CTTATTTATCTGCAAAAGGATGG - Exonic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987496685 5:18653670-18653692 CAGATTTCTCTGCAGCATGAGGG + Intergenic
994302597 5:98163622-98163644 CAGCTTTCCCGGGAGAAGGATGG + Intergenic
995755849 5:115503168-115503190 CAGAAGTGCCTGCAGAAGGTAGG + Intergenic
996547152 5:124692117-124692139 AAGATTAATCTGCACAAGGAAGG - Intronic
998859925 5:146432558-146432580 CAGACTGACCTTGAGAAGGAGGG + Intergenic
1000015143 5:157269166-157269188 CAAGTTTACCGGCCGAAGGAAGG + Intronic
1003380675 6:5621892-5621914 CAGACTGGCCAGCAGAAGGAAGG - Intronic
1003472565 6:6450846-6450868 CTGAGTTATCAGCAGAAGGATGG + Intergenic
1004058495 6:12165571-12165593 CATATTTTCCTGAATAAGGATGG - Intergenic
1005189810 6:23208131-23208153 CATATTTACTTGTAGAAGTAAGG - Intergenic
1007572909 6:42906086-42906108 CAGATATGCATGCAGAAGGCAGG + Intergenic
1009416920 6:63425992-63426014 TAGATTTACCTGCAGTTGTAAGG - Intergenic
1009629533 6:66176375-66176397 CAGATTTACAGGAAGAAGAAAGG + Intergenic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1010906327 6:81494590-81494612 TAGAGTTACATGCAGGAGGATGG + Intronic
1012385232 6:98673396-98673418 CAGATTTCTATGCAGCAGGATGG + Intergenic
1015123879 6:129730711-129730733 CAGTTTTTGCTGCGGAAGGAAGG - Intergenic
1016500716 6:144718009-144718031 CAGATGTTCCTGCAAACGGAGGG + Intronic
1017234305 6:152103759-152103781 CTGCTTTACCTTCAGAATGAGGG - Intronic
1022622558 7:31999930-31999952 CAGATTTCCATGCAGAGGCAGGG + Intronic
1023520002 7:41040324-41040346 CAGACCTACCTGATGAAGGAGGG + Intergenic
1024646651 7:51376660-51376682 CATTTTTTTCTGCAGAAGGAAGG + Intergenic
1024960722 7:54971830-54971852 CAGCTGTCCCTGCAGAAAGATGG - Intergenic
1026575935 7:71571560-71571582 CAGGTTTCCCTACATAAGGAGGG - Intronic
1027295218 7:76763112-76763134 AAGATTTACTTTGAGAAGGAGGG + Intergenic
1028675696 7:93458113-93458135 CAGTCTTACCTGCAGAATAATGG - Intronic
1031378032 7:121051119-121051141 AAGATTTACCTGCAGAAAACGGG + Intronic
1032743211 7:134760273-134760295 CAGTTCTAGCTGCAGAAGAATGG + Intronic
1034554135 7:151839254-151839276 CAGACTGGCCTGCAGAAGGAAGG + Intronic
1035031830 7:155865859-155865881 CAGAACTGCCTCCAGAAGGAAGG + Intergenic
1035536405 8:394528-394550 CAGATTTACAGGCACAATGAGGG - Intergenic
1036228924 8:6983115-6983137 GAGAATCACCTGCCGAAGGATGG - Intergenic
1036231376 8:7002220-7002242 GAGAATCACCTGCCGAAGGATGG - Intronic
1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG + Intronic
1039944655 8:42119019-42119041 CCGTTGTACCTGCAGAAAGATGG + Intergenic
1041487845 8:58398529-58398551 TAGATCTACCTACAGAAGTAAGG - Intergenic
1047039602 8:120978311-120978333 AAGAACTACCTGCAGTAGGAAGG + Intergenic
1047511767 8:125521088-125521110 CAGCTTTGCCTGAAGAGGGAAGG + Intergenic
1048736595 8:137508906-137508928 CTGAATTCCCTGCTGAAGGATGG - Intergenic
1049776041 8:144405667-144405689 CAGATTCACCTGGAGAGGGAGGG - Intronic
1053087352 9:35237018-35237040 CAGGCTTACATGCAGAAGAAGGG - Intronic
1055011168 9:71567051-71567073 CAGATCTACCAGCAGTAGGTGGG + Intergenic
1055062361 9:72083074-72083096 AAGATTTACCTTCAGGTGGAAGG + Intergenic
1055296772 9:74841352-74841374 CAGATTTACAGGAAGAAGTAAGG + Intronic
1055404094 9:75956327-75956349 CTGATTTATCTGTAGAATGAAGG - Intronic
1057224599 9:93284692-93284714 CAGATTTACCTGCATGAAGCAGG - Intronic
1057270452 9:93647378-93647400 CAGCTGTCCCTGCAGAAGCAGGG + Intronic
1058147727 9:101430269-101430291 TGGATGTACATGCAGAAGGAGGG + Intronic
1058183386 9:101824844-101824866 CAGCTAAACATGCAGAAGGAGGG + Intergenic
1058485686 9:105441384-105441406 CAGATTGACCTTCATAATGAAGG + Intergenic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1059856220 9:118400477-118400499 CAGAGACACCTACAGAAGGAAGG + Intergenic
1062008658 9:134255282-134255304 GAGATTCACCTGCACAAGAATGG - Intergenic
1192217648 X:69174331-69174353 AAGATTTACCTGCAGAAAACAGG + Intergenic
1192917406 X:75667154-75667176 AAGCTTTACCTTCTGAAGGAAGG + Intergenic
1193730284 X:85094883-85094905 CAGATTGAACTGGAGAAGAAAGG + Intronic
1196536847 X:116856053-116856075 GATATCTACCTGCAGAAGAATGG - Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1197380189 X:125729359-125729381 CAGATTTCCTTGGGGAAGGATGG + Intergenic
1199265858 X:145824520-145824542 CCCATCTACATGCAGAAGGAAGG + Exonic