ID: 920573273

View in Genome Browser
Species Human (GRCh38)
Location 1:207034323-207034345
Sequence CGGGCTATGACCTCTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920573268_920573273 19 Left 920573268 1:207034281-207034303 CCCTATCAGCAGCCTATGGATAT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
920573269_920573273 18 Left 920573269 1:207034282-207034304 CCTATCAGCAGCCTATGGATATC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
920573265_920573273 26 Left 920573265 1:207034274-207034296 CCCAGTACCCTATCAGCAGCCTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
920573266_920573273 25 Left 920573266 1:207034275-207034297 CCAGTACCCTATCAGCAGCCTAT 0: 1
1: 0
2: 0
3: 8
4: 58
Right 920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
920573270_920573273 7 Left 920573270 1:207034293-207034315 CCTATGGATATCACAGCTGAATG 0: 1
1: 0
2: 1
3: 11
4: 119
Right 920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920573273 Original CRISPR CGGGCTATGACCTCTTTCCC TGG Intronic
901772581 1:11537833-11537855 TGGGCACTGAGCTCTTTCCCTGG + Intergenic
905324902 1:37144994-37145016 CTGGCAATGTCCACTTTCCCTGG - Intergenic
905732360 1:40305704-40305726 GGGGCATTTACCTCTTTCCCAGG + Exonic
907807852 1:57839328-57839350 CAGACAATGAACTCTTTCCCTGG - Intronic
915581144 1:156814102-156814124 CGGGCTCTTAGCTCATTCCCCGG - Intronic
915607539 1:156962422-156962444 CTGGCTCTGAGCACTTTCCCCGG + Intronic
916444290 1:164857516-164857538 CAGGCTATAGCCTCTTACCCAGG + Intronic
920072201 1:203310373-203310395 CGGGTAATGAACTCCTTCCCAGG + Intergenic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
922634432 1:227151851-227151873 TGGGTTATGACCTCTTGGCCAGG - Intronic
923976558 1:239270894-239270916 AGGGCCATGGCCTCTGTCCCTGG + Intergenic
1062951854 10:1509480-1509502 CGGGCTTAAACCTCTGTCCCCGG - Intronic
1063969008 10:11368233-11368255 AGGGCCCTGGCCTCTTTCCCTGG + Intergenic
1064569634 10:16679412-16679434 GTGGCTATCACTTCTTTCCCAGG - Intronic
1071754709 10:88524148-88524170 CTGGCTCTATCCTCTTTCCCTGG + Intronic
1080621721 11:33992391-33992413 CAGGCTAAGGCCTCTTTCCTTGG + Intergenic
1083191766 11:61057219-61057241 CTGGGTAAGACCTGTTTCCCAGG - Intergenic
1083349103 11:62014492-62014514 CGGCCTATTACTTCTTTTCCGGG - Intergenic
1084094007 11:66898237-66898259 CGGGCTGTGACCGCTGGCCCTGG - Intronic
1084120520 11:67066385-67066407 CGGGCTAAGATGTCTTTGCCAGG + Intronic
1084606158 11:70173298-70173320 AGTGCCATGACCTCTTACCCAGG - Intronic
1097237064 12:57547291-57547313 CTGGCCATTACCTCATTCCCTGG - Intronic
1105823047 13:24096871-24096893 AGGACTGTGACCTCTTGCCCAGG + Intronic
1109400167 13:61816900-61816922 CATGCTATGACCTCTCTTCCAGG - Intergenic
1112613678 13:100981535-100981557 TGAGCTAAAACCTCTTTCCCTGG - Intergenic
1114538906 14:23440472-23440494 CGGACTCTGCCCTGTTTCCCAGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1121868580 14:97385975-97385997 CTGGCCATCTCCTCTTTCCCTGG - Intergenic
1125591682 15:40858087-40858109 CAGGCTCTGAGCTCCTTCCCAGG + Exonic
1128021073 15:64390920-64390942 CGGGCACTGACCTCCTTCCCAGG - Intronic
1132560454 16:590958-590980 GGGACCATGACATCTTTCCCCGG - Intronic
1136062941 16:27739165-27739187 CTGGGTCTGACCTCTTTACCTGG - Intronic
1140118341 16:72062141-72062163 CTGGCTATTACTTCTTTCACAGG - Intronic
1140120372 16:72078319-72078341 CTGGCTATTATCTCTTTCACAGG - Intronic
1140936290 16:79673496-79673518 GGGGCTATGACCTCATTATCTGG + Intergenic
1141030116 16:80580269-80580291 CGGGCTACATCCTGTTTCCCTGG + Intergenic
1141651252 16:85394220-85394242 CGGGCCTTGACCTCGCTCCCCGG - Intergenic
1143515422 17:7417270-7417292 GGGCCTATGACCGCTTCCCCGGG + Exonic
1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG + Intronic
1148538740 17:48462824-48462846 CGGGCTTTGCCATGTTTCCCAGG - Intergenic
1151088157 17:71405132-71405154 AGGGCTGTGAACTCTTTCACTGG - Intergenic
1151971146 17:77458089-77458111 AGGGCTGTAACCTCTTCCCCTGG + Intronic
1154318683 18:13326695-13326717 CAGGCAATGCCCTCTTCCCCAGG - Intronic
1155822798 18:30399218-30399240 TGGGGTATGAGCTCTCTCCCTGG - Intergenic
1167177405 19:47874777-47874799 CGGGTTCTAACGTCTTTCCCAGG + Exonic
929765205 2:44838363-44838385 CTGGCTATGAACTCCTTGCCTGG + Intergenic
946884631 2:224210716-224210738 CCGCCCATGACCTCTTGCCCTGG - Intergenic
948396461 2:237648739-237648761 CAGGCTCTGACCTCCTTCCTGGG - Intronic
1168810267 20:700268-700290 CGGCCTCTGACCTTTCTCCCAGG - Intergenic
1170878465 20:20273070-20273092 AGGGCTATGATGTGTTTCCCAGG + Intronic
1170924851 20:20713038-20713060 CGCGCTGCGACCTCTTTTCCAGG + Intergenic
1177811670 21:25931252-25931274 AGGACAATGATCTCTTTCCCTGG - Intronic
1178363460 21:31969066-31969088 CGGGGTTTCACCTCTTGCCCAGG + Intronic
1182038484 22:27217994-27218016 TGGGCTCTGATCACTTTCCCTGG + Intergenic
949524692 3:4891587-4891609 CAGGCTATGACTGCTTTGCCAGG + Intergenic
950400701 3:12767380-12767402 CGGGAGATGTCCTCTTTCCCAGG + Intronic
960590590 3:119361906-119361928 GGGACCATGACCTCTTTCCTTGG + Intronic
963229467 3:142894833-142894855 CAGGCTTGGTCCTCTTTCCCAGG - Intergenic
966259926 3:177964658-177964680 CTTGCTATGACCTCTTCCTCTGG - Intergenic
978463112 4:108979628-108979650 GGGGTTATGACTTCTATCCCAGG + Intronic
994892014 5:105647983-105648005 CGGGCTATGTGCTCTGTCTCAGG - Intergenic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
1001335292 5:170791510-170791532 CTGGCTTTGACCTCGTTCCTGGG + Intronic
1002306718 5:178287836-178287858 GGGGCTAGGACATCTATCCCAGG + Intronic
1006576056 6:35047293-35047315 GGAGCTAAGACCCCTTTCCCTGG + Intronic
1009918828 6:70030900-70030922 GGGGCTATGACAGCTTTTCCAGG - Intronic
1019001366 6:168755747-168755769 AAGGCTAAGACCTCTCTCCCAGG + Intergenic
1022136778 7:27456819-27456841 CTGGCGAGGGCCTCTTTCCCAGG + Intergenic
1025757693 7:64360359-64360381 AGGGCACTGACTTCTTTCCCAGG - Intergenic
1026381798 7:69807509-69807531 AGAGCAATGACCTCTTTTCCCGG - Intronic
1026926361 7:74196630-74196652 CTGGCGAGGGCCTCTTTCCCAGG - Exonic
1035270160 7:157715044-157715066 CGGGCTCAGAGCTCTTCCCCAGG - Intronic
1036651571 8:10647242-10647264 CGCCCTCTGACCTCCTTCCCAGG + Intronic
1038262018 8:26003725-26003747 CTGGCTGTCACCTCTTCCCCAGG - Intronic
1038542745 8:28402627-28402649 AGGGCTCTCACCTCTTCCCCAGG + Intronic
1049009648 8:139879073-139879095 CGGGCTGGGCCCTCGTTCCCTGG - Intronic
1059880351 9:118682259-118682281 GGGTCTATGAAATCTTTCCCTGG + Intergenic
1060190515 9:121589403-121589425 TGGGCTATTTCCTCTTTGCCTGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061566910 9:131446809-131446831 GGGCCTCTGACTTCTTTCCCTGG + Intronic
1192234096 X:69285297-69285319 CCGGCTCTGACCTCTGGCCCTGG - Intergenic
1193763518 X:85496061-85496083 TTAGCTATGACCTTTTTCCCAGG + Intergenic
1194485230 X:94478226-94478248 CTGGCTATGACCAATTTGCCAGG + Intergenic
1201481169 Y:14441023-14441045 CTGACTCTGACCTCTTTCTCTGG + Intergenic