ID: 920574687

View in Genome Browser
Species Human (GRCh38)
Location 1:207050820-207050842
Sequence GTCCAGCCGGACCCGGGTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920574687_920574697 8 Left 920574687 1:207050820-207050842 CCCGCACCCGGGTCCGGCTGGAC 0: 1
1: 0
2: 2
3: 2
4: 108
Right 920574697 1:207050851-207050873 CAAAACATGGGTGCCGTCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 62
920574687_920574698 19 Left 920574687 1:207050820-207050842 CCCGCACCCGGGTCCGGCTGGAC 0: 1
1: 0
2: 2
3: 2
4: 108
Right 920574698 1:207050862-207050884 TGCCGTCCTTGGCCTTGCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 189
920574687_920574692 -5 Left 920574687 1:207050820-207050842 CCCGCACCCGGGTCCGGCTGGAC 0: 1
1: 0
2: 2
3: 2
4: 108
Right 920574692 1:207050838-207050860 TGGACAGCCCCTGCAAAACATGG 0: 1
1: 0
2: 0
3: 21
4: 209
920574687_920574693 -4 Left 920574687 1:207050820-207050842 CCCGCACCCGGGTCCGGCTGGAC 0: 1
1: 0
2: 2
3: 2
4: 108
Right 920574693 1:207050839-207050861 GGACAGCCCCTGCAAAACATGGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920574687 Original CRISPR GTCCAGCCGGACCCGGGTGC GGG (reversed) Exonic
900384831 1:2405742-2405764 GTCCAGGCCCACCCGGGCGCCGG + Exonic
900471228 1:2855981-2856003 GTCCTGCCGGCCCCTGCTGCAGG - Intergenic
905741433 1:40374252-40374274 GTCCAGCCGCGCCGGGGTGGTGG + Intronic
906483865 1:46219898-46219920 GTCCAGCCGGTCGGTGGTGCTGG - Exonic
906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG + Intergenic
906636082 1:47411649-47411671 GTCCAGGCTGCCCTGGGTGCTGG - Intergenic
912401564 1:109397779-109397801 GTCCAGCCGGTCCTGGCTGAGGG + Exonic
915513699 1:156400816-156400838 GCCCAGCCGGTGCCGGGGGCTGG + Intergenic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
922029415 1:221783576-221783598 GGTCTGCAGGACCCGGGTGCGGG - Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
1067178075 10:43964151-43964173 GTCCAGGAGGGCCCTGGTGCAGG - Intergenic
1071661270 10:87505145-87505167 GACCAGCTGCACCGGGGTGCAGG - Exonic
1075509980 10:123064241-123064263 GTCCTGCTGGACTGGGGTGCTGG - Intergenic
1075687383 10:124373740-124373762 GCCCAGCTGGACCCAGGAGCTGG - Intergenic
1077051530 11:568913-568935 GGCCCGCGGGACGCGGGTGCGGG - Intergenic
1077142567 11:1030953-1030975 GGCCTGCCGGACGTGGGTGCTGG + Exonic
1077514149 11:2991851-2991873 GCCCAGCCCGCCCCGCGTGCGGG - Intronic
1079304448 11:19310000-19310022 GTCCAGCCAGGCCCCGGGGCAGG - Intergenic
1084064262 11:66694272-66694294 GCCCAGGAGGACCAGGGTGCAGG - Exonic
1084520096 11:69657636-69657658 GTCCAGCCTGACCCGCATGCCGG + Intronic
1085318847 11:75562304-75562326 GCCCAGCCCGACCCAGGTGAGGG + Intronic
1091549504 12:1527370-1527392 GTCCAGCCGCCTCTGGGTGCAGG - Intergenic
1103506306 12:121443953-121443975 GTCTGGCTGGTCCCGGGTGCTGG - Intronic
1105471905 13:20703099-20703121 GCCCTGCCGGGCGCGGGTGCGGG - Intronic
1106413508 13:29527012-29527034 CTTCAGGAGGACCCGGGTGCCGG + Intronic
1113745909 13:112744351-112744373 GACCATCCGAAGCCGGGTGCCGG - Intronic
1129116621 15:73368479-73368501 GCCCAGCCGGGCCCGGGAGGAGG - Exonic
1129269163 15:74410453-74410475 GTCCAGCCGCAGGCGGCTGCTGG - Exonic
1130991188 15:88877103-88877125 GTTCACCCGGTCCTGGGTGCTGG - Intergenic
1131149311 15:90037010-90037032 CTCCAGCCTGACCCTGGAGCTGG - Intronic
1132815989 16:1826784-1826806 GTCCAGCCCGGCCCGGGTCATGG - Exonic
1132896987 16:2233837-2233859 GCACAGCCTGCCCCGGGTGCTGG + Intronic
1132900433 16:2251315-2251337 GTGGAGCCGGACGCGGGCGCAGG - Exonic
1133213474 16:4275997-4276019 GCCCAGGCAGACCCGGGAGCTGG + Intergenic
1133259237 16:4537946-4537968 GGCGAGCCGGGCGCGGGTGCAGG + Intronic
1138530359 16:57631316-57631338 CTCCAGCCGGACTGGGATGCGGG + Intronic
1142403627 16:89873923-89873945 GTCCAGCCGGGTCGGGGAGCGGG + Intronic
1143321301 17:6070673-6070695 CTCCAGCCGGACCCCCGCGCGGG + Intronic
1146022556 17:29292711-29292733 CTCCCGCCGCACCCGGGAGCGGG + Intronic
1147257957 17:39193448-39193470 GCCCAGCCGGACCGTGGTGGTGG - Intronic
1147313162 17:39606771-39606793 GCCCAGCCCTACCCGGCTGCCGG + Intronic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1148745371 17:49915113-49915135 ATCCAGCCGGACCCTGGTTAAGG - Intergenic
1151231485 17:72688393-72688415 GTCCAGCATGACACGGCTGCAGG - Intronic
1151538249 17:74750513-74750535 GTCCAGCCAGAGCTGGGTGCTGG + Intronic
1151875238 17:76864258-76864280 GGCCAGCAGGACCCAGGGGCAGG + Intergenic
1152920963 17:83066446-83066468 CTCCAGCCGGACACGGGCCCAGG - Intergenic
1154214785 18:12408054-12408076 CTCCAGCCGGGCTCGGGAGCAGG - Intronic
1156507815 18:37609631-37609653 GTCCAGCATGACTGGGGTGCAGG + Intergenic
1160964905 19:1743060-1743082 CCCCAGCCGGAGCCGGGTGATGG + Intergenic
1161377277 19:3946429-3946451 GACCAGGCAGCCCCGGGTGCAGG + Intergenic
1161488874 19:4550821-4550843 GTCCATCTGGACGCCGGTGCCGG - Exonic
1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG + Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165923672 19:39314286-39314308 CTCCAGCCGGACCCGGGTCCGGG - Exonic
1166107606 19:40605144-40605166 GTACAGCCGGGGCCGGGGGCCGG - Exonic
1166719854 19:44990644-44990666 GCCCAGCTGGACCCTGGAGCTGG + Intronic
1167510107 19:49891273-49891295 TTCCTGCCTGACCCGGGGGCTGG - Intronic
1167577714 19:50325717-50325739 GGCCAGCCGGGCCGGGGGGCGGG + Intronic
1168713289 19:58513672-58513694 GCCCAGCCTGACCCTGGGGCAGG + Exonic
937958344 2:127436507-127436529 CTCCAGACAGACTCGGGTGCAGG + Intronic
945019680 2:205558206-205558228 GTCCAGCAAGACTTGGGTGCAGG + Intronic
948458936 2:238119884-238119906 GTCCAGCAGGCCCCAGGGGCTGG - Intronic
1171010295 20:21505866-21505888 GTCCGGCGGGACCCGGATCCAGG + Intergenic
1172938419 20:38637768-38637790 GACCAGCGGGACCTGTGTGCTGG - Exonic
1175972606 20:62694309-62694331 GTCCGGGAGGCCCCGGGTGCAGG + Intergenic
1176382381 21:6119852-6119874 GGCCAGCCTGACCGGGGAGCAGG - Exonic
1178367527 21:31999676-31999698 GGCCAGCAGGAGCCGGGGGCAGG + Exonic
1179430092 21:41315926-41315948 AACCAGCCGGACCCTGGGGCGGG + Intronic
1179741091 21:43418387-43418409 GGCCAGCCTGACCGGGGAGCAGG + Exonic
1179893378 21:44349030-44349052 GTCCAGCAGGGCGCGGCTGCGGG + Intergenic
1179907667 21:44432595-44432617 GGGCAGGAGGACCCGGGTGCAGG - Intronic
1179991294 21:44949422-44949444 GTCCACCCGGCCGAGGGTGCTGG - Intronic
1180047639 21:45317196-45317218 GCCCACCCGGACCCTGGTGTGGG + Intergenic
1183205624 22:36417012-36417034 GTCCAGGTGGAGCTGGGTGCAGG - Intergenic
1184796871 22:46737974-46737996 GTCCGGCCGAACCCGGGCGGCGG + Intronic
954455791 3:50599190-50599212 AGCCAGCCTGACCTGGGTGCAGG + Intergenic
961507200 3:127377988-127378010 GTCCAGCCGGACCCACCTGGAGG + Intergenic
969413097 4:7042592-7042614 GCCCAGCCGGAGCCCGGAGCCGG - Exonic
969684645 4:8664367-8664389 GTGCAGCTGGGCCCGGGAGCAGG - Intergenic
980089518 4:128428048-128428070 TGCCAGCAGGACCCAGGTGCTGG - Intergenic
985035686 4:185838177-185838199 GGCCAGCCAGGCCTGGGTGCAGG - Intronic
992563334 5:77973442-77973464 CTCCAGCCCGCCCCTGGTGCTGG - Intergenic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1003569529 6:7246972-7246994 GTGGAGTCGGCCCCGGGTGCCGG + Exonic
1007431493 6:41779845-41779867 CTGCAGCGGGACCCGGGAGCGGG - Exonic
1010244857 6:73653689-73653711 GTCCCGCCGGCGCAGGGTGCGGG + Intronic
1019145271 6:169971857-169971879 GACAAGCAGGACCCGGGCGCTGG - Intergenic
1019274736 7:170026-170048 ATCCAGGCGGACCGTGGTGCAGG - Intergenic
1019487842 7:1297419-1297441 GTCCAGCCAGACAGGGGAGCTGG - Intergenic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1034474649 7:151275471-151275493 GTCCCGCAGGACCCTGGGGCCGG - Intronic
1034560354 7:151876187-151876209 ATCCAGCCGGGTGCGGGTGCGGG - Intronic
1035566983 8:647830-647852 GTCCAGCTGGCCCCGTGGGCAGG - Intronic
1035719091 8:1778018-1778040 GTCCAGCCTCACCTGGGTGTGGG + Intronic
1036293684 8:7517898-7517920 GTTCCGGCGGACCCGGATGCAGG + Intergenic
1036328877 8:7803097-7803119 GTTCCGGCGGACCCGGATGCAGG - Intergenic
1040915703 8:52565090-52565112 GTCCGGCCGGCCCCGGCCGCGGG + Exonic
1043969573 8:86514662-86514684 GTCCCGCCGGGCCCTGCTGCTGG + Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048852081 8:138654965-138654987 GCCCAGCAGGACCCAGGTCCAGG + Intronic
1049551149 8:143260578-143260600 GTCCAGGCGGAGCCCGGGGCTGG - Intronic
1057995879 9:99821544-99821566 GTCCCGCCTGACCCGTGGGCAGG + Intergenic
1059398602 9:114054591-114054613 GCCCAGCTGGACACGGGGGCTGG - Exonic
1060280781 9:122214179-122214201 CTCGGGCCGGACCCGGGTGGCGG - Intronic
1061226824 9:129285152-129285174 GCCCAGCCAGAACCAGGTGCTGG - Intergenic
1061432916 9:130542741-130542763 GTGCAGCAGGACCCAGGTGAGGG - Intergenic
1061867245 9:133499195-133499217 GTCCAGCAGGGGCAGGGTGCTGG - Intergenic
1062280809 9:135750860-135750882 GCCCAGCCAGACCCGGGTGCAGG + Intronic
1186357042 X:8800380-8800402 GTCCAGCCCGTCCCTGGGGCTGG + Intronic
1186378434 X:9033240-9033262 GTCCAGCCCGTCCCCGGGGCTGG + Intronic
1188115632 X:26239057-26239079 GAGCAGCAGGACCCTGGTGCTGG + Intergenic