ID: 920578682

View in Genome Browser
Species Human (GRCh38)
Location 1:207084067-207084089
Sequence TCCCAGGCAGAGAACCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920578682 Original CRISPR TCCCAGGCAGAGAACCTAGG AGG (reversed) Intronic
900189440 1:1347100-1347122 TCCCAGCCAGAGGACCTGGGAGG + Intronic
900773443 1:4563785-4563807 TGGCAGGGAGAGGACCTAGGAGG + Intergenic
901030324 1:6303766-6303788 TCCCAGCCACAGAACCTGGGAGG - Intronic
901756288 1:11443513-11443535 TCCCAGGCACAGCATCTGGGAGG + Intergenic
903875277 1:26469652-26469674 TCCCAGGTGGAGAGCCAAGGGGG - Exonic
903968286 1:27102971-27102993 TCCCAGGCATAGGTCCCAGGTGG - Intronic
904769118 1:32871040-32871062 TCCCCGGCAGAGGACCTAATAGG - Intronic
904769286 1:32871868-32871890 TCTCAGCCAGAGAAACAAGGTGG + Intronic
908400902 1:63772213-63772235 TCTCAGGCAGAGAAACTTGGGGG + Intergenic
908408903 1:63843228-63843250 ACCCTGGCAGAGAAGCTGGGGGG - Intronic
908715697 1:67067552-67067574 TCACAGGCCCAGAGCCTAGGAGG + Intergenic
909405227 1:75281586-75281608 TCACAGGCTCAGAACCTAAGAGG + Intronic
910923360 1:92373246-92373268 TACCATGCAGAGAACTGAGGGGG + Intronic
911271741 1:95810058-95810080 CCCCAGTCACAGAACCTAGGAGG - Intergenic
911842259 1:102698089-102698111 GCCCAGCCAGAGACCCTAAGAGG + Intergenic
912099232 1:106185077-106185099 TCCCAGGCAGAGTCCCTACTGGG + Intergenic
913174778 1:116263523-116263545 TCCCAGGCTGACATCCTAGTTGG + Intergenic
914420760 1:147526678-147526700 TCCATGGCAGAGATCCTAGTGGG + Intergenic
914863484 1:151405976-151405998 TCCCAGGGGGAGAATCTAGAGGG - Exonic
917414624 1:174796013-174796035 CCCCAGGCAGAGAACCTAGGAGG + Intronic
917545514 1:175962676-175962698 ACCTAGCCAGAGAACCTAAGAGG + Intronic
917676975 1:177328554-177328576 ACCTAGGAAGAGAACATAGGGGG + Intergenic
918235955 1:182581057-182581079 ACCCCGGCAGGGAGCCTAGGGGG + Intronic
918769442 1:188535780-188535802 TCCCAGGCAGAGAGCACAGTTGG - Intergenic
919393575 1:197017538-197017560 ACCTAGGCAGAGAAACTTGGAGG - Intergenic
920578682 1:207084067-207084089 TCCCAGGCAGAGAACCTAGGAGG - Intronic
921556116 1:216601005-216601027 ATCCAGGCAGAGAACCGGGGAGG - Intronic
923524829 1:234764433-234764455 ACCCAGGGAGAGAGCATAGGTGG - Intergenic
923681372 1:236121447-236121469 TACCAGGCAGAGAATCGAGGTGG - Intergenic
924264683 1:242269480-242269502 GCCCAGCCATTGAACCTAGGAGG - Intronic
924755485 1:246936954-246936976 ACCCAGCCAGAGAGCCTAAGAGG - Intergenic
1064452447 10:15454739-15454761 TTCAAGACAGAGAACCAAGGTGG - Intergenic
1065854818 10:29821552-29821574 GCCCAGCCAGGGAACCTAGAAGG - Intergenic
1066720124 10:38329006-38329028 GCCCAGCCATTGAACCTAGGAGG + Intergenic
1067281875 10:44879507-44879529 CCCCAGCCAGAGAACCTAGAGGG + Intergenic
1067670146 10:48312905-48312927 TTCCAGGCAGAAGAACTAGGTGG - Intronic
1068929403 10:62573630-62573652 TCCCAGGATGAGAACCAAGGTGG + Intronic
1070440884 10:76441948-76441970 TTCCAGGCAGAGAGACGAGGTGG - Intronic
1072622671 10:97090349-97090371 TCCCAGGCAGAGGAACCAGCAGG + Intronic
1074521085 10:114224790-114224812 ACCAAGGCAGAAAACCAAGGAGG - Intronic
1075165180 10:120061848-120061870 GCCCAGCCACAGAACCTAAGAGG + Intergenic
1075403302 10:122176736-122176758 GCCCAGCCAAAGAACCTAGGTGG - Intronic
1076193417 10:128498590-128498612 GCCCAGGCAGAGAGCACAGGAGG - Intergenic
1077482654 11:2823632-2823654 ACCCAGGAAGAGAAAATAGGTGG + Intronic
1077546891 11:3175823-3175845 TCCCAGGCAGAGGAAATAGCAGG + Intergenic
1078101320 11:8331972-8331994 GCCCCTGCAGAGAACCTAAGCGG - Intergenic
1078987245 11:16607856-16607878 AGCCAGGCAGAGAAGCTGGGAGG + Intronic
1080422815 11:32126813-32126835 TCCCAGGCAGGGACCCTGGGAGG - Intergenic
1080925209 11:36749093-36749115 GCACAGGCACAGAATCTAGGGGG - Intergenic
1080963428 11:37186570-37186592 ACCCAGGCAGAAAAAGTAGGGGG + Intergenic
1082256523 11:50039017-50039039 TCCTAGGGAGAGCAGCTAGGAGG - Intergenic
1082952401 11:58831126-58831148 TCCCAGGCTCAGGACCTGGGCGG + Intergenic
1083932862 11:65855373-65855395 ACCCTGGCAGAGAAGCTGGGGGG - Exonic
1084012839 11:66362294-66362316 TCCTGGGCAGAGCACCTAGTTGG - Intronic
1085416589 11:76322361-76322383 TCTCAGGCAGAAAACTGAGGTGG + Intergenic
1085875958 11:80406161-80406183 TCCCAGGGGGAGAACCAAGATGG - Intergenic
1087300913 11:96434047-96434069 TCCCAAGCACAGAGCCTAGGAGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1087805057 11:102546499-102546521 CCTCAGCCAGAGAACCTAGGAGG + Intergenic
1088102988 11:106175502-106175524 TCCCAAGCAGGGACCCTTGGTGG + Intergenic
1089494712 11:118902301-118902323 TCACAGACACAGAGCCTAGGGGG - Exonic
1089536060 11:119161418-119161440 TCCCAGGCAGACAGCAGAGGAGG - Exonic
1091087753 11:132739383-132739405 TCCCAGGCAATGAACCTAAGTGG + Intronic
1091588651 12:1830135-1830157 GCCCAGGCTGAGAGCCTAGATGG + Intronic
1092790308 12:12065048-12065070 CCCCAGCCAAAAAACCTAGGAGG - Intronic
1097419904 12:59363921-59363943 TCAAAGGAAGAGAACCTAGAGGG + Intergenic
1097871875 12:64609189-64609211 TACCAAGCAGAGAACCCAGTAGG + Intergenic
1097905222 12:64912675-64912697 TCCCTGGCAGAGACCCTATATGG - Intergenic
1098178268 12:67816960-67816982 TCCCTGGCAGAGAAAGGAGGTGG + Intergenic
1098228614 12:68350323-68350345 TCCCAGGCAGCTGAGCTAGGAGG - Intergenic
1101158661 12:101951918-101951940 TCCCCGGCATAGAACATAGGAGG + Intronic
1101757511 12:107632677-107632699 TTCTAGGCAGAGAACCCAGCTGG - Intronic
1103414903 12:120737348-120737370 CCCCAGGTAGAGAGACTAGGAGG - Exonic
1106410170 13:29505993-29506015 TCCCAGGCAGGGAGGCAAGGGGG + Intergenic
1107828210 13:44350101-44350123 CCCCAGGCAGAGAAGCTGGGAGG - Intergenic
1109163465 13:59004350-59004372 TCCCAGCTGGATAACCTAGGAGG + Intergenic
1115435957 14:33373869-33373891 TCCCAGTCAGAGAACCTCAGGGG - Intronic
1116620250 14:47192539-47192561 TGGGAGGCAGAGAACCTGGGAGG + Intronic
1118631393 14:67706926-67706948 TCCTATGCAGAGAAATTAGGGGG + Intronic
1118647161 14:67851343-67851365 TCTCAGGCAGGGCACTTAGGCGG + Intronic
1120362391 14:83521731-83521753 ACCCAGCCAGAGATCCTAAGAGG - Intergenic
1120616497 14:86711942-86711964 TCCCTGGCACAGAAAGTAGGGGG + Intergenic
1121325859 14:93019255-93019277 TCCCAGGCAGGGAAACCTGGAGG - Intronic
1122693497 14:103542264-103542286 CCCCAGGCAGAGCACAAAGGAGG - Intergenic
1123539658 15:21275452-21275474 TCCCAGAGAGAGAAACTAGCTGG + Intergenic
1124033357 15:26031328-26031350 GCCCAGTCAAAGAACCTAGAAGG - Intergenic
1126872633 15:53006174-53006196 TCCAAGGCAGAGAACTAAGAAGG - Intergenic
1129146749 15:73655063-73655085 CCCCAGCCAGAGAACCTATGTGG + Intergenic
1129411664 15:75353884-75353906 ACACAGGCAGAGACCCCAGGAGG + Intronic
1129761655 15:78132132-78132154 GCCCAGCCAAAGACCCTAGGAGG - Intronic
1129962766 15:79702975-79702997 TCCCAGAAAGCAAACCTAGGTGG + Intergenic
1130953838 15:88612899-88612921 TCCCAGGCAGAAAGGCTGGGAGG - Intergenic
1131137246 15:89946957-89946979 TCCCAGCCAGAGAATCTAGGAGG - Intergenic
1202947967 15_KI270727v1_random:2614-2636 TCCCAGAGAGAGAAACTAGCTGG + Intergenic
1133414432 16:5595302-5595324 ACCCAGGCAGAGATCCCAGATGG - Intergenic
1137712290 16:50574690-50574712 TCCCAGGCAGAGGCCCTCTGAGG + Intronic
1138649636 16:58451953-58451975 CCCCAGCCAGAAAATCTAGGAGG - Intergenic
1139483123 16:67241570-67241592 TCAGATGCAGAGGACCTAGGAGG + Intronic
1140485518 16:75290171-75290193 ACCCAGGCAGAGGACCAAGCAGG - Intergenic
1141639918 16:85335157-85335179 GCCCAGCCAGGGAACCTCGGAGG + Intergenic
1142654422 17:1381798-1381820 TCCCAGGCATAGGACTGAGGTGG + Intronic
1142984918 17:3689984-3690006 CCCCAGGCAGAGACCCACGGAGG + Intronic
1143445313 17:7005852-7005874 TCCCAGGCAGTGAGCACAGGTGG + Exonic
1144090464 17:11851477-11851499 TTCCAGGCAGAGACCTGAGGTGG + Intronic
1144491874 17:15719830-15719852 AACCAGTCAGAGAAACTAGGTGG + Exonic
1144583639 17:16474581-16474603 TCCCAAGCAGAGAGATTAGGAGG - Intronic
1145050927 17:19659906-19659928 TTCCAGGCAGAGTAACTTGGGGG + Intronic
1145287456 17:21516944-21516966 GCCCAGCCAAAGAACCTAGAAGG + Intergenic
1145390167 17:22449433-22449455 GCCCAGCCAAAGAACCTAGAAGG - Intergenic
1146157262 17:30535054-30535076 TCCCAGGCAGTGAGCACAGGTGG + Intergenic
1146502118 17:33373115-33373137 TGCCAAGAAGAGAACCCAGGAGG + Intronic
1146767930 17:35540736-35540758 TGCCAGTCACAGAACCCAGGAGG - Intergenic
1147950462 17:44104847-44104869 TCCCGGGCTGAGGACATAGGAGG + Intronic
1147986235 17:44309075-44309097 TCCCAGGCCCAGAACCCAGAGGG + Intronic
1148127019 17:45242216-45242238 CCCCAGGCAGAGGACCCTGGAGG - Intronic
1148951535 17:51317728-51317750 TCCTAGGAAGAGAAAATAGGGGG - Intergenic
1149720942 17:58843193-58843215 TGGGAGGCAGAGAACCTGGGAGG + Intronic
1150290094 17:63976154-63976176 TCCCAGGGAGAGATCCCAGAAGG + Intergenic
1150622954 17:66822238-66822260 TCCCAGGCATAGAAACCACGTGG - Intergenic
1151666394 17:75547500-75547522 GCCCAGCCAAAGAACCTAGAAGG - Intronic
1152438816 17:80292681-80292703 TTGCAGACAGAGAACCCAGGTGG - Intronic
1152798568 17:82320678-82320700 ACCCAGGCAGGAAACCCAGGAGG - Intergenic
1154169856 18:12043549-12043571 CCCCAGGCAGTGAACATAAGAGG + Intergenic
1156885684 18:42132736-42132758 GCCCAGGCAGAGACCCTAAGAGG - Intergenic
1157455624 18:47826347-47826369 ACCAAGGGAGAGAACATAGGAGG - Exonic
1158433619 18:57416531-57416553 TCCTAGGCAGAGATTCTTGGTGG + Intergenic
1158579290 18:58667544-58667566 ACCCAGGCAGATGAGCTAGGCGG - Intergenic
1160124950 18:76163294-76163316 TCCCATTTAGAGAACATAGGAGG - Intergenic
1161427313 19:4210617-4210639 TTCCAGGCAGAGGACACAGGTGG - Intronic
1161899554 19:7108268-7108290 TCCCAGTCAGAGACTCTAAGAGG - Intergenic
1164764968 19:30757389-30757411 TCCCAGGCCGAGACCCTGCGAGG + Intergenic
1164928716 19:32154611-32154633 TCAAAGGCAGAGAACCAAAGGGG - Intergenic
1165188154 19:34039623-34039645 TGCCAGGCAGCGCTCCTAGGTGG + Intergenic
1165276897 19:34761020-34761042 TCCCAGACAGAGGAATTAGGAGG + Intronic
1166057948 19:40304764-40304786 GCCCAGTCAAAGAACCTAGAAGG + Intergenic
1167096530 19:47377585-47377607 CCCCAGGCAGAGACCCAAAGAGG + Intronic
1168220626 19:54957796-54957818 GCCCATCCAAAGAACCTAGGAGG + Intronic
927178837 2:20429377-20429399 TCTCAGGAAGATAATCTAGGAGG - Intergenic
930029786 2:47051494-47051516 TCCCAGGAATAGATCCTAGTGGG + Intronic
931001281 2:57785851-57785873 ACCCAAGCTGAGAACCTAGAAGG - Intergenic
931238541 2:60432530-60432552 TCACTGGAAGAGAACCCAGGAGG - Intergenic
931688612 2:64816272-64816294 TCCCAGTCACTGAACCTAAGAGG + Intergenic
932008117 2:67947914-67947936 TCCCAGGGAGGGAAACTAGCTGG + Intergenic
934568421 2:95353234-95353256 TTCCATGCAGAGAACCTGGGTGG + Intronic
936856828 2:116968252-116968274 CTCCAACCAGAGAACCTAGGAGG + Intergenic
937016925 2:118614667-118614689 CCCCAGGCAGAGGACCTAGAGGG + Intergenic
937449451 2:121989793-121989815 TCCAGGGCTGAGAACCTGGGTGG + Intergenic
938723434 2:134086218-134086240 TCCAAGGAAGAGAAGCAAGGGGG - Intergenic
939872779 2:147543348-147543370 TTCCAGGCAGGGAATGTAGGTGG - Intergenic
941253726 2:163200892-163200914 TTCAAGGCAGAGAAGCGAGGGGG + Intergenic
943603818 2:189952267-189952289 GCCCAGCCACAGAACCTAAGAGG + Intronic
944301610 2:198130540-198130562 TCCCAGGCATTGTACCTGGGAGG + Intronic
945920757 2:215752641-215752663 TCCTAAGCAGAGAACAAAGGTGG - Intergenic
947264337 2:228260493-228260515 TCTCAGGCAGAGAACAAGGGAGG - Intergenic
947499368 2:230660755-230660777 TCCCAGGCAGAGACCACGGGTGG + Intergenic
1169082872 20:2807896-2807918 TCACAGGGAGAGCACCTAGCAGG - Intergenic
1169532331 20:6499161-6499183 GCTCAGCCAAAGAACCTAGGAGG - Intergenic
1169754314 20:9026926-9026948 CCCCAGTCAGAAAACCTAGGAGG - Intergenic
1170293649 20:14800088-14800110 TCCCAGTCACAGAAACTAGGAGG + Intronic
1170854088 20:20033492-20033514 TCTCAGGCACAGAACTGAGGAGG - Exonic
1170889315 20:20365182-20365204 TCCAAGGCAGAGCACCCAAGGGG - Intergenic
1170900206 20:20455180-20455202 TGCGAGGCAGAGCACTTAGGTGG - Intronic
1173553594 20:43950019-43950041 TCCAAAGCAGAGAGGCTAGGTGG - Intronic
1173916706 20:46713443-46713465 TCCCAGGCAGAGAGGCTGGCAGG + Intronic
1174886927 20:54346114-54346136 TCCCAGCCACAGAACCTATGAGG - Intergenic
1175163585 20:57027272-57027294 TCCCCGGCACAGAAACTCGGTGG + Intergenic
1175199494 20:57267623-57267645 TCTCAGGCACAGACCCTTGGAGG - Intergenic
1178121914 21:29477846-29477868 GCCCAGGCAGAGGACAGAGGTGG + Intronic
1182114844 22:27750281-27750303 TCCCAGGCGGAATACCTAAGAGG + Exonic
1182808892 22:33099120-33099142 TCCCAGCCAGAGAGCCTAGGAGG + Intergenic
1183411935 22:37659805-37659827 ACCCAGGCAGAGATGCTTGGAGG - Intronic
1183641428 22:39095250-39095272 TCCCAGGCTGAGAAGCAGGGAGG - Intergenic
1183708077 22:39487274-39487296 TCCTAGGAAGGGGACCTAGGAGG - Intronic
1184464853 22:44662845-44662867 TCCCGGGCAGAGAGGCTGGGTGG + Intergenic
1184853591 22:47134844-47134866 TGCCAGGCAGAGGACCCTGGAGG - Intronic
949698426 3:6727044-6727066 TGGCAGGCAGAGAACTTAGAGGG - Intergenic
950266042 3:11573810-11573832 TCACATTCAGAGAACCTAGGGGG - Intronic
950919831 3:16683251-16683273 TCCCATGAAGAGAAAGTAGGGGG - Intergenic
951105432 3:18736580-18736602 TCCCAGGCAAAGAACAGGGGTGG + Intergenic
953960424 3:47262063-47262085 TCCTGGGCAGAGAACCCAAGTGG + Intronic
954413920 3:50383691-50383713 TCCTGGGCATAGAACCAAGGAGG - Intronic
954627767 3:52032002-52032024 GCCCAGGCAGAGAGGCTTGGAGG - Intergenic
955350894 3:58192171-58192193 TCGAAGGCAGAGAAACCAGGTGG + Intergenic
955538628 3:59951245-59951267 TTCCATGCACAGAACCCAGGTGG - Intronic
956939161 3:74136705-74136727 CCCCAGGCAGAGGAACTTGGAGG + Intergenic
957455106 3:80431276-80431298 TCCCAGGCATAAAACCTACGTGG - Intergenic
958970461 3:100605461-100605483 GCCCAGACACAGAACCAAGGGGG - Intergenic
959166734 3:102789425-102789447 GCCCAGGAAGAGAACCCATGTGG - Intergenic
960057318 3:113284646-113284668 GCCCAGCCTGAGACCCTAGGAGG - Intronic
960183746 3:114613661-114613683 TCCCAAGCAGAGAACATATAAGG - Intronic
960527904 3:118731118-118731140 TCCCAGGCAAAGAAGAAAGGGGG - Intergenic
960675878 3:120194330-120194352 CCACAGGCAAAGCACCTAGGAGG + Intronic
962665646 3:137651157-137651179 TACCTGGCAGAGAAACTGGGAGG - Intergenic
963682137 3:148391802-148391824 GCCCAGACAGAGACCCTAAGAGG - Intergenic
965650229 3:170924590-170924612 ACCCTGGAAGACAACCTAGGCGG + Intergenic
966346517 3:178986960-178986982 ACCCAGCCAAAGAACCTAGAAGG - Intergenic
967722199 3:192827573-192827595 TCCCAGACAGAGAAGTTAAGTGG + Intronic
969469482 4:7379097-7379119 TCCCAAGCACAGGATCTAGGAGG - Intronic
969497703 4:7535393-7535415 CCCCAGCCAGAGAAGCCAGGGGG - Intronic
969727784 4:8934098-8934120 TCCCATGAAGAGAAAATAGGAGG - Intergenic
970593512 4:17578969-17578991 GCCCAGCCACAGAACCTAGGAGG - Intronic
970620094 4:17809659-17809681 ACCCAGCCAAAGAACCTAGGAGG - Intronic
977407789 4:96621826-96621848 TCACAGGCAAATAACCCAGGAGG - Intergenic
977745678 4:100543981-100544003 TCCCAGGCAGAGGAAGTAGTAGG - Intronic
978619994 4:110628499-110628521 TCCTAGTCAGAGACCCTGGGGGG + Intronic
979066833 4:116147761-116147783 TCCAGGTCAGAGAACCTAGGAGG - Intergenic
981496925 4:145404155-145404177 TTCCAGGCAGAGAAACTAGGGGG + Intergenic
984540782 4:181034549-181034571 TTCCAAGCAGGGAAACTAGGAGG - Intergenic
986354716 5:6912410-6912432 ACCCTGGGAGAGAACCTAGAAGG + Intergenic
989574039 5:42972397-42972419 CCCCAGGCAGCGAACCTTAGCGG - Intergenic
991700667 5:69313408-69313430 ACCCTGGCAGAGAAGCTGGGGGG - Intronic
992897423 5:81257469-81257491 TCCTAGTCAGAGGACCTAGGGGG + Intronic
994238512 5:97393095-97393117 TTCTAGGGAGAGAAGCTAGGAGG - Intergenic
996433096 5:123402374-123402396 AACCAGGCAGAGATCCTAGAAGG + Intronic
996576943 5:124986037-124986059 TCCCAGTCAGATAACCTAAAAGG + Intergenic
997741698 5:136260529-136260551 TGCAAGGCAGAGAGCCTAGGGGG + Intronic
998431423 5:142073660-142073682 TCCCAGTCATTGAACCTAGGCGG + Intergenic
999827164 5:155284799-155284821 ACCCAGCCAAAGAACCTAGCAGG + Intergenic
1004509299 6:16271618-16271640 TCCCTGACAGAGAACCTAACAGG - Intronic
1004968580 6:20882498-20882520 GCCCAGCCAGAGAACCTGGGAGG + Intronic
1010296166 6:74199222-74199244 TCACAGGCAGAAAAGCAAGGAGG - Intergenic
1013089919 6:106891126-106891148 TCCCAGCTGGAGAACTTAGGAGG - Intergenic
1015600604 6:134906537-134906559 TCCCAGACACAAAACTTAGGGGG + Intergenic
1016912986 6:149217097-149217119 TCCAAGGCAGTGAATTTAGGAGG - Intergenic
1017632595 6:156411664-156411686 TTCCAGGCAGAAAACCAGGGTGG - Intergenic
1017789324 6:157782359-157782381 CCCCAGATAGGGAACCTAGGAGG + Intronic
1018201856 6:161402554-161402576 GCCCAGCCAAAGAACCTGGGAGG - Intronic
1018497109 6:164359791-164359813 TCCCAGGAACAGACCCTAGAAGG - Intergenic
1018606548 6:165603606-165603628 CCCCTGGCAGAGAATCTGGGAGG + Intronic
1019744411 7:2691639-2691661 GCTCAGGCAGTGAACCCAGGAGG + Intronic
1020140818 7:5610673-5610695 TCCCAGGCAGAGAGGCCTGGAGG + Intergenic
1023170110 7:37382910-37382932 CCCCAGGCCCAGAACCTAGGAGG + Intronic
1026543279 7:71299393-71299415 TCCTAGGTAGTGGACCTAGGAGG + Intronic
1028790124 7:94844354-94844376 TCACAGGCCCAAAACCTAGGAGG + Intergenic
1029536588 7:101160983-101161005 TCCCAGGCAGAGAAGCTGCCTGG - Exonic
1029698325 7:102229212-102229234 ACCCAGGCCGAGCACCCAGGGGG - Intronic
1030476779 7:110044060-110044082 TCCCAGGGAGAGATGCTAGGTGG + Intergenic
1032435004 7:131893376-131893398 CCCCAGGCAGAGAAAGTAGATGG - Intergenic
1032612936 7:133435440-133435462 GCAAAGGCAGAGAACCAAGGTGG + Intronic
1033445684 7:141419789-141419811 TCCCAGAAAGAGAACTTAGCTGG + Intronic
1033607930 7:142941082-142941104 TTCCAGGCATAGAACATAGCAGG + Intergenic
1034443549 7:151100302-151100324 TCCCAGGCATGGAAGCCAGGAGG - Intronic
1036048516 8:5170076-5170098 GCTCAGCCAAAGAACCTAGGAGG - Intergenic
1036217851 8:6895781-6895803 TTCAAGGCAGAGACACTAGGAGG - Intergenic
1038180033 8:25218807-25218829 TTCCAGGAAGAGAGCTTAGGTGG + Intronic
1039410472 8:37350956-37350978 TCCCAAGGAGTGTACCTAGGGGG - Intergenic
1039884283 8:41646464-41646486 TCCCAGGCTGAGCACCGAGAAGG + Exonic
1039910242 8:41820691-41820713 TCCCAGCCAAAGGACCTAGAAGG - Intronic
1039918456 8:41876332-41876354 TCGCGGCCAGAGAACCTGGGTGG - Intronic
1041574695 8:59380750-59380772 ACCCAGCCAGAGACCCTAAGAGG - Intergenic
1042223296 8:66494415-66494437 GCGCAGGCAGAGAACAGAGGCGG - Intronic
1042657758 8:71119174-71119196 GCCCAGCCAAAGAACCTAGGAGG + Intergenic
1042663492 8:71180969-71180991 TGCCAGGCAGAGAGCCTCAGAGG - Intergenic
1044553027 8:93533236-93533258 TCTCAGGCAGAGTCCCTTGGAGG - Intergenic
1044699363 8:94951951-94951973 GCCCAGGCAGGGAACCTGGCTGG - Intronic
1044737199 8:95290993-95291015 TCCCAGGCACAGAACCCCTGTGG + Intergenic
1045482230 8:102601482-102601504 TCCCAGGCTGAGAACTTTTGAGG + Intergenic
1047963311 8:130026811-130026833 GCCCAGCCAAAGAACCTAGAAGG + Intergenic
1049442654 8:142616339-142616361 TCCCAGGGAGAGGAGCTGGGTGG + Intergenic
1050148547 9:2596348-2596370 TGCCAGGCTGAGAATTTAGGAGG + Intergenic
1050878963 9:10675499-10675521 TCCCAGCCTGAGAACTCAGGAGG + Intergenic
1051694810 9:19756590-19756612 GCCCAAGCAGAGAACCCAGCTGG - Intronic
1051774399 9:20619846-20619868 TCCAAGGCTAAGAACCAAGGTGG + Intronic
1055913769 9:81379566-81379588 TCCCAGCCACAGAATCTAAGAGG + Intergenic
1056563006 9:87749033-87749055 TCCCAGTCAGTGAACCTAAGAGG + Intergenic
1057195310 9:93113078-93113100 TTCCTGGCAGATGACCTAGGGGG + Exonic
1059025743 9:110626886-110626908 ACCCAGCCACAGAACCTAAGAGG - Intergenic
1060052508 9:120387294-120387316 TCCCAGGTAGAGGTCCTTGGGGG + Intergenic
1060812268 9:126616450-126616472 TGCCAGGCAGAAAACCCAGGAGG - Intronic
1061117183 9:128621325-128621347 TCCCAGGAAGTGAACTTTGGGGG - Intronic
1061469153 9:130809096-130809118 TCACAGGCAGAGAAACAAAGAGG + Intronic
1062175382 9:135159244-135159266 ACCCAGGGAGAGACCCCAGGAGG - Intergenic
1062481569 9:136754889-136754911 TGCCAGGCAGGGACCCTGGGAGG - Intronic
1062524479 9:136972708-136972730 GCCCAGGCAGAGAATCACGGAGG - Intergenic
1186896919 X:14012839-14012861 TCCCAGGCAGAGGGGCTATGGGG + Intronic
1189374645 X:40457392-40457414 CCGCAGCCAGAGAAACTAGGAGG + Intergenic
1189427367 X:40913097-40913119 TCCCAGGCACAGAACATGGTGGG + Intergenic
1189668848 X:43386354-43386376 CCCCAGTGAGAGAATCTAGGAGG - Intergenic
1189765738 X:44370313-44370335 CCCCAAACAGAGAACCTAGGAGG + Intergenic
1190243509 X:48676186-48676208 GCCCAGGCAGAGAACCCCGCTGG + Intergenic
1194763129 X:97817419-97817441 TACCAGACAAAGAACCTAGGGGG - Intergenic
1196268274 X:113679009-113679031 GCCCAGCCAGAGATCCTAAGAGG - Intergenic
1196472490 X:116044238-116044260 TCCCATTCAGAGAAACTTGGTGG + Intergenic
1201494813 Y:14581603-14581625 TCCCAGGCAGTCATCCTAAGTGG + Intronic