ID: 920580207

View in Genome Browser
Species Human (GRCh38)
Location 1:207099397-207099419
Sequence GCCCAGTTCCTAATAGTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1037
Summary {0: 1, 1: 2, 2: 35, 3: 352, 4: 647}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920580203_920580207 6 Left 920580203 1:207099368-207099390 CCTGCCCGCTGCTCACTTTCTGC 0: 1
1: 3
2: 10
3: 61
4: 324
Right 920580207 1:207099397-207099419 GCCCAGTTCCTAATAGTCCGTGG 0: 1
1: 2
2: 35
3: 352
4: 647
920580204_920580207 2 Left 920580204 1:207099372-207099394 CCCGCTGCTCACTTTCTGCTGTG 0: 2
1: 53
2: 398
3: 848
4: 1462
Right 920580207 1:207099397-207099419 GCCCAGTTCCTAATAGTCCGTGG 0: 1
1: 2
2: 35
3: 352
4: 647
920580205_920580207 1 Left 920580205 1:207099373-207099395 CCGCTGCTCACTTTCTGCTGTGT 0: 1
1: 20
2: 170
3: 450
4: 1006
Right 920580207 1:207099397-207099419 GCCCAGTTCCTAATAGTCCGTGG 0: 1
1: 2
2: 35
3: 352
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920580207 Original CRISPR GCCCAGTTCCTAATAGTCCG TGG Intronic
900468437 1:2837596-2837618 GCCCGGTTCCTAACAGGCCATGG + Intergenic
900915822 1:5637884-5637906 GCCCAGTTCCTAACAGCCCATGG + Intergenic
901467688 1:9433200-9433222 GCCCAGTTCCTAACAGGCTATGG + Intergenic
901581518 1:10248031-10248053 GCCTGGTTCCTAATAGGCCATGG + Intronic
901863984 1:12092013-12092035 GCCCCGTTCCTAACAGGCCATGG + Intronic
901924466 1:12557089-12557111 GCCCATTTCCTAACAGGCCATGG - Intergenic
902104230 1:14020259-14020281 GCCCAGTTCCTAACAGGCCACGG + Intergenic
902186344 1:14728437-14728459 GCCCAGTTCCTAAGAGGCCATGG + Intronic
902365263 1:15968960-15968982 GCCCACTTCCTAACAGGCCACGG - Intronic
903060784 1:20667108-20667130 GCCCAGTTCCTAACAGGCCAGGG - Intronic
903080273 1:20805279-20805301 GCCCAGTTTCTAACAGGCCATGG - Intergenic
903139090 1:21327759-21327781 GCCCGGTTCCTAACAGGCCATGG - Intronic
903167378 1:21530465-21530487 GCCCAGTTCCAATGAGTCCAAGG + Intronic
903434362 1:23335406-23335428 GCCCGGTTCCTAACAGGCCATGG - Intronic
904564601 1:31421030-31421052 GCCCAGTTCTTAACAGGCCATGG - Intronic
905082919 1:35340788-35340810 GCCCAGTTTCTAACAGGCCATGG + Intronic
905095065 1:35463105-35463127 GCCCAGTTCCTAACAGGCCACGG + Intronic
905246942 1:36621629-36621651 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
905358854 1:37404563-37404585 GCCTTGTTCCTAATAGGCCATGG + Intergenic
907064537 1:51467619-51467641 GCTCAGTTCCTAACAGGCCATGG - Intronic
907121913 1:52015479-52015501 GCCCAGTTCCTAACAGGCCATGG + Intergenic
907892195 1:58647019-58647041 GCCCAGCTCCTAACAGGCCACGG + Intergenic
908102449 1:60805515-60805537 GCCCATTTCCTAACAGACCATGG + Intergenic
908328644 1:63048758-63048780 GCCCAGTTCCTAACAGGCCATGG + Intergenic
908664396 1:66473993-66474015 GCCCATTTCCTAACAGGCCATGG + Intergenic
909346232 1:74590701-74590723 GCCTGGTTCCTAATAGGCCATGG + Intronic
909423044 1:75487830-75487852 GCTCAGTTCCTAACAGGCCATGG - Intronic
909516026 1:76508345-76508367 GCCCAGTTCCTAACAGGCCAGGG + Intronic
909617394 1:77626604-77626626 GCCCAGTTCCTAACAGGCCATGG + Intronic
909664423 1:78117616-78117638 GCCCAGTTTCTAACAGGCCATGG + Intronic
909687795 1:78370486-78370508 GCCCAGTTCTTAACAGTGCTTGG - Intronic
909701524 1:78529759-78529781 GCCCAGTTCCTAAAAGGCCTGGG - Intronic
910315211 1:85874817-85874839 GCCCATTTCCTAACAGGCCTTGG - Intronic
910754902 1:90678693-90678715 GCCCAGTTCTTAACAGGCCATGG - Intergenic
910946726 1:92600791-92600813 GCCCGGTTCCTAACAGGCCATGG + Intronic
911005173 1:93213184-93213206 GCCCAGTTCCTAATGGGCCATGG + Intronic
911147075 1:94562755-94562777 GCCCAGTTCCTAACAGGCCATGG + Intergenic
911150614 1:94594159-94594181 TCCCAGTTCCTAACAGGCCACGG - Intergenic
912273334 1:108231698-108231720 GCCCAGTTCCTAACAGGTCATGG + Intronic
912294886 1:108462624-108462646 GCCCAGTTCCTAACAGGTCATGG - Intronic
912353229 1:109034513-109034535 GCTCAGTTCCTAACAGGCTGTGG - Intronic
912750369 1:112282569-112282591 TCCCAGTTCCTAACAGGCCATGG + Intergenic
912975596 1:114327100-114327122 GCCCAGTTCCTAACAGGCCATGG - Intergenic
913230370 1:116736007-116736029 GCCCAGTTCCTAACAGGCCATGG - Intergenic
913302762 1:117389515-117389537 GCCGAGTTCCTAACAGGCCCTGG + Intronic
913325024 1:117620609-117620631 GCCCAGTTCCTAACAGGCCACGG - Intronic
913373025 1:118121420-118121442 GCCCAGTTCCTAACAGGCCATGG - Intronic
913670562 1:121094192-121094214 GCCCAGTTCCTAACAGGCCACGG - Intronic
914022328 1:143881631-143881653 GCCCAGTTCCTAACAGGCCACGG - Intergenic
914660811 1:149789572-149789594 GCCCAGTTCCTAACAGGCCACGG - Intronic
914698565 1:150108889-150108911 GCCCAGTTCCTAACAGACCACGG + Intronic
914701112 1:150135117-150135139 GCCCAGTTTCTTATAATCAGGGG + Intronic
915708300 1:157868616-157868638 GCCCAGTTCCTAACAGGCCATGG + Intronic
915962043 1:160275053-160275075 GCCCAGTTCCTAACAAGCCATGG - Intergenic
916345938 1:163791573-163791595 GCCCTGGTGCTAATAGTCCATGG - Intergenic
916653347 1:166850584-166850606 GCCCAGTTCCTGACAGGCCATGG - Exonic
916952136 1:169791136-169791158 GCTCAGTTCCTAACAGGCCACGG + Intronic
917146054 1:171892959-171892981 GCCCAGTTCCTAACAGGCCATGG + Intronic
917348145 1:174049977-174049999 GCCCAGTTCCTAACAGGCCATGG - Intergenic
917633270 1:176910743-176910765 GCTCGGTTCCTAACAGTCCATGG - Intronic
917987162 1:180332362-180332384 GCCCAGTTCCTAACAGGCCATGG - Intronic
918019585 1:180673527-180673549 GCCCAGTTCCTAACAGGCCATGG - Intronic
918225192 1:182474731-182474753 GCCCAGTTCCTAACAGGCCATGG - Intronic
918555636 1:185796317-185796339 GCCCAGTTCCTAAGAGGCCACGG + Intronic
918572200 1:186010078-186010100 GCCCAGTTCCTAACAGGCCATGG + Intronic
919007750 1:191921509-191921531 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
919099058 1:193071233-193071255 GCCCAGTTCCTAACAGGCCACGG + Intronic
919265051 1:195252099-195252121 GCCCATTTCCTAACAGGCCATGG - Intergenic
919282041 1:195502797-195502819 GCCCAGTTCCTAACAGGCCATGG - Intergenic
919615249 1:199799262-199799284 GCCCAGTTGCTAACAGGCCACGG - Intergenic
919811540 1:201411943-201411965 GCCCAGTTCCTAACAGGCCACGG + Intronic
920580207 1:207099397-207099419 GCCCAGTTCCTAATAGTCCGTGG + Intronic
921006015 1:211094343-211094365 GCCCAGTTCCTAACAGGCCATGG + Intronic
921151840 1:212408913-212408935 GCCCAGTTCCTAACAGGCCATGG - Intronic
921402337 1:214739128-214739150 GCCCAGTTTCTAACAGGCCACGG + Intergenic
921488202 1:215740997-215741019 GCCCGGTTCCTAACAGGCCGCGG + Intronic
921701400 1:218272540-218272562 GCCCAGTTCCTAACAGGCCATGG - Intergenic
922093669 1:222422448-222422470 GCCCATTTCCTAACAGGCCACGG - Intergenic
922171281 1:223157677-223157699 GCCTGGTTCCTAATAGGCCACGG + Intergenic
922275242 1:224071441-224071463 GCCCAGTTCCTAACAGGCCATGG - Intergenic
922275340 1:224072404-224072426 GCCCAGTTCCTAACAGGCCATGG + Intergenic
922382926 1:225051060-225051082 GCATAGTTCCTAACAGGCCGTGG + Intronic
922501634 1:226101177-226101199 GCCCGGTTCCTAACAGACCATGG - Intergenic
923289046 1:232526596-232526618 GCCCGGTTCCTAACAGGCCATGG + Intronic
923826127 1:237502710-237502732 GCCTGGTTCCTAACAGGCCGCGG + Intronic
924194136 1:241587351-241587373 GCCCAGTTCCTAACAGGCCATGG + Intronic
924202040 1:241670616-241670638 GCCCAGTTCCTAACAGTCCATGG - Intronic
924666633 1:246080190-246080212 ACCCAGTTCCTAACAGGCCATGG - Intronic
1062827318 10:582165-582187 ACCCGGTTCCTAACAGACCGTGG + Intronic
1063499415 10:6539319-6539341 CCCCAGTTCCTAACAGGCCACGG - Intronic
1063588923 10:7377798-7377820 GCCCAGTTCGTAACAGCCCATGG + Intronic
1063606832 10:7529878-7529900 GCCCAGTTCCTAACAGGCCCCGG + Intergenic
1063784246 10:9362638-9362660 GCCCATTTCCCAATAGGCCATGG - Intergenic
1063842424 10:10087943-10087965 GCCCAATTCCTAATAGGCCACGG + Intergenic
1064089032 10:12367828-12367850 GCCCAGTTCCTAACAGGCCATGG + Intronic
1064449811 10:15431638-15431660 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1064558157 10:16568218-16568240 GCCTGGTTCCTAATAGGCCAGGG - Intergenic
1064688578 10:17890798-17890820 GCTCAGTTCCTAACAGGCCATGG - Intronic
1064741385 10:18438388-18438410 ACCCAGTTCCTGAGAGTCCAGGG - Intronic
1064882013 10:20065898-20065920 GCCCAGTTCCTAACAGGTCATGG + Intronic
1065138086 10:22692390-22692412 GCCCAGTTCCTAACAGGCCATGG + Intronic
1065312608 10:24430865-24430887 GCCCAGTTCCTAACAAGCCAAGG + Intronic
1065697290 10:28391378-28391400 GCCCAGTTCCTGACAGGCCATGG - Intergenic
1065819430 10:29511371-29511393 TCCCAGTTCCTGATGGGCCGGGG + Intronic
1065931533 10:30483568-30483590 GCCCTGTTCCTAACAGGCCATGG - Intergenic
1065960267 10:30728232-30728254 GCCTAGTTCCTAAAAGGCCATGG + Intergenic
1066147725 10:32578732-32578754 GCCCAGTTCCTAACAGGCCATGG + Intronic
1067049943 10:43009624-43009646 GCCCAGTTCCTAACAGGCCTTGG + Intergenic
1067224633 10:44367603-44367625 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1067250955 10:44586924-44586946 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1068250037 10:54426509-54426531 GCCCAGTTCCTAACAGGCCACGG + Intronic
1068590724 10:58850277-58850299 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1068602503 10:58970372-58970394 GCCCAGTTCCTCACAGGCCATGG + Intergenic
1068872086 10:61956136-61956158 GCCCAGTTTCTAACAGGCCAGGG - Intronic
1068957103 10:62828015-62828037 GCCCACTTCCTAACAGTTCCTGG - Intronic
1068987530 10:63121003-63121025 GCCTGGTTCCTAACAGGCCGTGG - Intergenic
1069021149 10:63489871-63489893 GCCCAGTTCCTAACAAGCCATGG - Intergenic
1069358471 10:67614679-67614701 GCCCAGTTCCTAACAGGCCATGG + Intronic
1069372240 10:67760593-67760615 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1069575220 10:69522545-69522567 GCCTGGTTCCTAATAGACCATGG - Intergenic
1070097795 10:73355157-73355179 GCCCAGTTCCTGACAGGCCACGG - Intronic
1070222474 10:74463611-74463633 GCCCAGTTCCTAACAGGCCATGG + Intronic
1070691697 10:78531920-78531942 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1071829367 10:89356371-89356393 GCCCAGTTCCTAACAGGCCTCGG - Intronic
1071909172 10:90211504-90211526 GGCCAGTTCCTAACAGGCCATGG + Intergenic
1071982038 10:91013196-91013218 GCCCAGTTCCTAACAGGTCACGG + Intergenic
1072015914 10:91346424-91346446 GCCTAGTTCCTAACAGGCCATGG - Intergenic
1072332725 10:94369461-94369483 GCCCAGTTCCTAACAGGCCGCGG + Intergenic
1073505650 10:103986572-103986594 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1073587828 10:104727696-104727718 GCCCAGTTCCTAACAGGCCACGG - Intronic
1073682525 10:105719630-105719652 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1073746868 10:106479159-106479181 GCCCAGTTCCTAACAAGCCATGG - Intergenic
1074294334 10:112169724-112169746 GCCCGGTTCCTAACAGGCCGGGG - Intronic
1074539555 10:114353157-114353179 GCCCACTTCCTAGTAGTTCCAGG - Intronic
1074735242 10:116424568-116424590 GCCCAGTTCCTAACAGTCTATGG - Intergenic
1075234637 10:120715775-120715797 TCCCAGCTCCTAAAAGTCCCTGG + Intergenic
1075240135 10:120770986-120771008 GCACAGTTCTTTATAGCCCGTGG - Intergenic
1075290120 10:121222148-121222170 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1075301083 10:121324829-121324851 GCCCAGTTCCTCACAGACCACGG + Intergenic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1075831628 10:125417007-125417029 GCTCAGTTCCTAACAGGCCGCGG - Intergenic
1075848267 10:125564773-125564795 GGCCAGTTCCTAACAGGCCAAGG + Intergenic
1075917641 10:126182916-126182938 GCCCAGTTCCTAACAGGCCACGG - Intronic
1077313829 11:1906830-1906852 GCTCAGTCCCTAATACTCCAGGG + Intergenic
1077400839 11:2356123-2356145 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1077559432 11:3249334-3249356 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1077565325 11:3295137-3295159 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1078009585 11:7562185-7562207 GCCCAGTTCCTAACAGGCCATGG + Intronic
1078330269 11:10413556-10413578 ACCCAGTTCCTAACAGGCCATGG + Intronic
1078571816 11:12465106-12465128 GCCTAGTTCCTAACAGGCCATGG + Intronic
1078630741 11:13001473-13001495 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1078826348 11:14934387-14934409 GCCCAGTTCCTAACAGGCCATGG + Intronic
1078849501 11:15151105-15151127 GCCCAGTTCCTAACAGGCTAAGG - Intronic
1079086887 11:17452627-17452649 GCTCAGTTCCTAACAGGCCATGG + Intronic
1079149840 11:17887882-17887904 GCCTGGTTCCTAACAGGCCGTGG - Intronic
1079434195 11:20429387-20429409 GTCCAGTTCCTAACAGGCCACGG + Intronic
1079665870 11:23104560-23104582 TCCCAGTTCCTAACAGGCCATGG + Intergenic
1079916579 11:26375329-26375351 GCCCGGTTCCTAACAGACCATGG + Intronic
1080046101 11:27809892-27809914 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1080122333 11:28692059-28692081 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1080202133 11:29684438-29684460 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1080293507 11:30698523-30698545 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1084401896 11:68949003-68949025 GCCCAGTTCCTAACAGGTCATGG - Intergenic
1084984894 11:72860202-72860224 GCTCAGTTCCTAACAGGCCATGG + Intronic
1085211364 11:74782352-74782374 GCCGTGTTCCTAATAGGCCATGG - Intronic
1085556836 11:77430866-77430888 GCCCAGTTCCTAACAGGCCATGG - Intronic
1085598588 11:77833574-77833596 GCCCAGTTCCTAACAGATCACGG + Intronic
1086042110 11:82492121-82492143 GCCTAGTTCCTAACAGGCCAAGG - Intergenic
1086472637 11:87131774-87131796 GCCCAGTTCCTAACAGGCCACGG - Intronic
1086804039 11:91217267-91217289 GCCCAGGTCCTAAAAGGCCATGG + Intergenic
1087557948 11:99746469-99746491 GCCCAGTTCCTAACAGTCCATGG - Intronic
1087672072 11:101119197-101119219 GCCCACTTCCTAACAGGCCATGG + Intronic
1087852327 11:103046437-103046459 GCCCATTTCCTAACAGGCCATGG - Intergenic
1088185730 11:107167069-107167091 GCCTGGTTCCTAACAGGCCGTGG + Intergenic
1088266507 11:107992702-107992724 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1088609628 11:111564734-111564756 GCCCGGTTCCTAACAGGCCAGGG - Intergenic
1088644625 11:111907820-111907842 GCCTGGTTCCTAATAGGCCACGG - Intergenic
1089215430 11:116831965-116831987 GCCCGGCTCCTAACAGTCCATGG + Intronic
1090230934 11:125103117-125103139 GCCCAGTTCCTAAAAGGCCATGG - Intronic
1091115586 11:133009833-133009855 GCCCAGTTCCTAACAGGGCATGG + Intronic
1091541657 12:1468013-1468035 GCCCAGTTCCTAACAGGGCCTGG + Intronic
1092094903 12:5833582-5833604 GTCCAGTTCCTAACAGGCCATGG - Intronic
1092752107 12:11728334-11728356 GCCCAGTTCCTAAAAGGCCACGG - Intronic
1092766095 12:11854349-11854371 GCCCAGTTCCTAACAGGCCATGG + Intronic
1093340630 12:17968667-17968689 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1093832275 12:23776847-23776869 GCCCGGTTCCTAACAGGCCACGG + Intronic
1093886684 12:24469323-24469345 GCCAAGTTCCTAACAGACCACGG + Intergenic
1094045528 12:26161941-26161963 GCCCAGTTCCTAACTGGCCATGG + Intronic
1094689178 12:32751861-32751883 GCCCTGTTCCTAACAGGCCACGG + Intronic
1095184328 12:39184464-39184486 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1095538524 12:43280318-43280340 GCCCGGTTCCTAACAGACCACGG + Intergenic
1095589679 12:43889537-43889559 GTCCAGTTCCTAACAGGCCATGG + Intronic
1095762357 12:45853920-45853942 GCCCAGTTCCTAAAGGGCCACGG - Intronic
1095992694 12:48047661-48047683 GCCCAGGTCCTATTAGTTAGTGG - Intronic
1096483411 12:51958840-51958862 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1096917598 12:55049980-55050002 GCCCAGTTCCTAACAGGCCAAGG + Intergenic
1097809935 12:64007503-64007525 GCCCAGTTCCTAACAGGCCACGG + Intronic
1097906631 12:64926531-64926553 GCCCAGTTACTAACAGGCCATGG - Intergenic
1098125715 12:67290794-67290816 GCCCAGTTCCCAACAGGCCAAGG - Intronic
1098244563 12:68502988-68503010 GCCCGGTTCCTAACAGGTCGTGG - Intergenic
1098606677 12:72398949-72398971 GCCCAGTTCCTACCAGGCCATGG - Intronic
1098914584 12:76244028-76244050 GCCCAGCTCCTAACAGGCCATGG + Intergenic
1099025058 12:77455082-77455104 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1099155310 12:79168059-79168081 GTCCAGTTCCTAACAGGCCATGG + Intronic
1099352818 12:81593895-81593917 GCCTAGTTCCTAACAGGCCATGG - Intronic
1099446616 12:82760615-82760637 GCCCAGTTTCTAACAGGCCATGG - Intronic
1099457316 12:82879534-82879556 GCTCAGTTCCTAACAGGCCATGG + Intronic
1099868718 12:88319201-88319223 GCCCAGTTCCTACCAGGCCATGG - Intergenic
1099972369 12:89513701-89513723 GCCCAGTTCCTAATAGGCCATGG - Intronic
1100424386 12:94469788-94469810 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1100678016 12:96889025-96889047 GCCTGGTTCCTAACAGGCCGTGG + Intergenic
1100993714 12:100279381-100279403 GCCCGGTTCCTAATAGGCCGTGG + Intronic
1101159247 12:101956542-101956564 GCACAGTTCCTAACAGGCCACGG + Intronic
1101335361 12:103791676-103791698 GCCCGGTTCCTAACAGACCTTGG - Intronic
1101512813 12:105407840-105407862 ACCCAGTTCCTAAGAGGCCACGG - Intergenic
1101658091 12:106742007-106742029 GCCCAGTTCCTAACAGGCCACGG + Intronic
1101734952 12:107456281-107456303 GCCCAGTTCCTAACAGGCCATGG - Intronic
1101976712 12:109365847-109365869 GCCCAGTTCCTAACAGGCCACGG - Intronic
1103226332 12:119291108-119291130 GCCCTGTTCCTAACAGGCCATGG - Intergenic
1104377209 12:128275194-128275216 GCCTAGTTCCTAATAGGCCACGG - Intronic
1104510367 12:129372317-129372339 GCCCAGTTCCTAACAGGCCATGG - Intronic
1104708701 12:130969314-130969336 GCCCAGTTCCTAACAGGCTACGG - Intronic
1104722223 12:131050955-131050977 GCCCGGTTCCTAACAGGCCACGG + Intronic
1105989728 13:25606955-25606977 GCCCAGTTCCTAACAGGCCATGG - Intronic
1106062749 13:26310715-26310737 GCCCAGTTCCTAACAGGCCATGG + Intronic
1106257812 13:28037742-28037764 GCCCCTTTCCTAATAGGCCATGG - Intronic
1106639007 13:31563343-31563365 GTCCAGTTCCTAACAGGCTGTGG - Intergenic
1107067124 13:36226526-36226548 GCCCAATTCCTAACAGGCCATGG + Intronic
1107221470 13:37986312-37986334 GCCCAGTTTCTAACAGGCCATGG - Intergenic
1107338395 13:39380368-39380390 GCCCATTTCCTAACAGACCATGG - Intronic
1107340343 13:39398684-39398706 GCCCTGTTCCTAACAGGCCAGGG - Intronic
1107729337 13:43332437-43332459 GCCCAGTTCCTAACAGGCCATGG + Intronic
1107804336 13:44140300-44140322 GCTCAGTTCCTAATAGGCCATGG - Intergenic
1107874498 13:44778193-44778215 GCCAGGTTCCTAACAGTCCACGG + Intergenic
1108320129 13:49281627-49281649 GCCCAGTTCCTAACAGGCCACGG + Intronic
1108333353 13:49412925-49412947 GCCCGGTTCCTAACAGGCCATGG + Exonic
1108369990 13:49759803-49759825 GCCCAGTTCCTAATGGGCCACGG + Intronic
1108487166 13:50938764-50938786 GCCCAGTTCCTCACAGGCCATGG + Intronic
1108588900 13:51895146-51895168 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1109189232 13:59305801-59305823 GTCCAGTTCCTAACAGGCCAAGG + Intergenic
1109373547 13:61457983-61458005 GCCTGGTTCCTAATAGGCCCTGG - Intergenic
1109830547 13:67781420-67781442 GTCCAGTTCCTAACAGGCCACGG + Intergenic
1109928698 13:69183787-69183809 GCCCAGTTCCTGACAGGCCAAGG + Intergenic
1110077723 13:71269882-71269904 GCCGAGTTCCTAACAGGCCACGG + Intergenic
1110146910 13:72202938-72202960 GCCCAGTTCCTAACAGGCCTTGG - Intergenic
1110223885 13:73099502-73099524 GCCCTGATACTAATAGTCTGGGG - Intergenic
1110358397 13:74595728-74595750 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1110552467 13:76824873-76824895 GCCCAGTTCCTAATAGGCCACGG + Intergenic
1110745118 13:79043456-79043478 GCCCTGTTCCTAACAGGCCATGG + Intergenic
1111034096 13:82647768-82647790 GCCCAGTTCCTAACAGGCTGTGG + Intergenic
1111091335 13:83452049-83452071 GCCCAGTTACAAACAGTCCCTGG - Intergenic
1111694083 13:91601473-91601495 GCCCGGTTCCTAACAGGCCACGG - Intronic
1111756532 13:92403372-92403394 GACCAGTTCCTAACAGGCCATGG - Intronic
1111827066 13:93280971-93280993 GCCCAGTTCCTAATAGGCAACGG + Intronic
1112057848 13:95707263-95707285 GCCCAGTTCCTAACAGGCCATGG + Intronic
1112115318 13:96346125-96346147 GCCCAGTCCCTAACAGGCCATGG + Intronic
1112165142 13:96910196-96910218 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1112298719 13:98211215-98211237 GCCCAGTTCCTGAAAGGCCACGG - Intronic
1112865518 13:103891805-103891827 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1112931090 13:104738993-104739015 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1113158269 13:107350140-107350162 GCCCAGTTCCTAACAGGCCACGG + Intronic
1113190462 13:107739687-107739709 GCCCCGTTCCTAATGGACCTGGG - Intronic
1113626652 13:111852843-111852865 GCCCAGTTCCTAACAGCTCACGG - Intergenic
1113978328 13:114249414-114249436 GCCTGGTTCCTAATAGGCCAGGG + Intronic
1114058378 14:18996411-18996433 GCCCAGGTCCTAACAGGCCAGGG - Intronic
1114104168 14:19405343-19405365 GCCCAGGTCCTAACAGGCCAGGG + Intronic
1115001785 14:28429991-28430013 GCTCAGTTCCTAACAGGCCACGG - Intergenic
1115053267 14:29091150-29091172 GCCCAGTTCCAAACGGTCCATGG - Intergenic
1115251918 14:31357911-31357933 GCCCAATTCCTAACAGGCCGTGG - Intronic
1115444310 14:33471778-33471800 GCCCAGTTCCTAATGGGTCACGG - Intronic
1115758901 14:36558197-36558219 GCCCAGTTCCTAATAGACCATGG + Intergenic
1116140550 14:40988200-40988222 GCCTGGTTCCTAATAGGCCATGG + Intergenic
1116643554 14:47497076-47497098 GCCCAGTTGCTAATAGGCCATGG + Intronic
1116823886 14:49652435-49652457 GTCCAGTTCCTAACAGACCATGG - Intronic
1116982476 14:51186199-51186221 GCCCAGTTCCTAAAAGGCCGTGG - Intergenic
1117520662 14:56548384-56548406 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1117558111 14:56907373-56907395 GGCCTGTTCCTAACAGGCCGTGG + Intergenic
1117559164 14:56918166-56918188 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1117581110 14:57152635-57152657 GCCTGGTTCCTAATAGGCCACGG - Intergenic
1117609548 14:57468111-57468133 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1117827059 14:59714816-59714838 GCCCAGTTCCTAACAGACCACGG - Intronic
1118011504 14:61614874-61614896 GCCCAGTCCCTAACAGGCCACGG - Intronic
1118106815 14:62669157-62669179 GCCCAGTTCCTAACAGGTTGAGG - Intergenic
1118188007 14:63555016-63555038 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1118762418 14:68888630-68888652 GCCCAGTTCCTAACAGGCCACGG - Intronic
1118835175 14:69472820-69472842 GCCCGGTTCCTAATAGGCCAAGG - Intergenic
1118838046 14:69490464-69490486 GCCCAGTTCCTAACAGGCCATGG + Intronic
1119454475 14:74742917-74742939 GTCCAGTTCCTAACAGGCCATGG + Intergenic
1119882363 14:78110911-78110933 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1120191425 14:81443557-81443579 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1120387383 14:83863453-83863475 GCCCAGTTCCTAATAACCCATGG + Intergenic
1120428463 14:84381591-84381613 GCCCAGTTCCCAACAGGCCATGG + Intergenic
1120602593 14:86530495-86530517 GCCCAGTTCCTAATAGGTCAGGG - Intergenic
1120988576 14:90355213-90355235 GCCCCGTTCCTAACAGGCCATGG + Intergenic
1121497073 14:94400200-94400222 GCCCGGTTCCTAACAGGCCAAGG + Intergenic
1121500912 14:94436697-94436719 GACCAGTTCCTAACAGGCCACGG - Intergenic
1121944975 14:98111303-98111325 GCCCAGTTCCCAACAGGCCATGG + Intergenic
1121958632 14:98238223-98238245 GCCCAGTTCCTAACAAGCCATGG + Intergenic
1122086432 14:99309987-99310009 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1123497075 15:20837970-20837992 GCCCAGGTCCTAACAGGCCAGGG + Intronic
1123554309 15:21411604-21411626 GCCCAGGTCCTAACAGGCCAGGG + Intronic
1123590554 15:21848925-21848947 GCCCAGGTCCTAACAGGCCAGGG + Intergenic
1123996889 15:25725026-25725048 GCCCAGTTCCTAACAGGCCATGG - Intronic
1124096845 15:26656527-26656549 GCCCAGTTCCTAACAGGCCACGG - Intronic
1124138013 15:27052087-27052109 GCCCAGTTCCTGACAGGCCTTGG + Intronic
1124440326 15:29681290-29681312 GCCCAGTTACTAACAGTCCATGG + Intergenic
1124576453 15:30913084-30913106 GCCCAGTTCCTAACAGGCAATGG - Intronic
1124951265 15:34323351-34323373 GCCCCGTTCCTAACAGGCCAGGG - Intronic
1125108142 15:35998054-35998076 GCCCGGTTCCTAACAGGCTGTGG + Intergenic
1125443858 15:39732245-39732267 GCCCAGTTCCTAACAGGCCATGG + Intronic
1126029824 15:44485634-44485656 GCCCAGTTCCTAATAGGCTGCGG + Intronic
1126434137 15:48618662-48618684 GCCCAGTTCCTAACAGGACATGG - Intronic
1126457025 15:48874387-48874409 GCCCGGTTCCTAACAGGCCACGG - Intronic
1126511015 15:49474668-49474690 GCCTAGTTCCTAACAGGCCATGG - Intronic
1126704175 15:51392222-51392244 GCCCAGTTCCTAACAGGTCATGG - Intronic
1126721129 15:51581093-51581115 GCCCAGTTCCTAACAGGCCATGG - Intronic
1126821661 15:52510493-52510515 GCCCGGTTCCTAACAGGCCAGGG - Intronic
1127014271 15:54665769-54665791 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1127077072 15:55337363-55337385 GCCCAGTTCCTAAGAGGCCATGG - Intronic
1127473532 15:59311450-59311472 TCCCAGTTCCTAACAGGCCACGG + Intronic
1127550852 15:60036992-60037014 GCCCAGTTCCTAAGAGGCCATGG + Intronic
1127568227 15:60214462-60214484 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1127681473 15:61302445-61302467 CCCCAGTTCCTAACAGGCCATGG - Intergenic
1128343425 15:66838421-66838443 GCCCAGTTCCTAACAGGCTGTGG + Intergenic
1130940874 15:88507865-88507887 GCCTGGTTCCTAACAGTCCGTGG - Intergenic
1131158956 15:90091899-90091921 GCCCAGTTCCCAACAGTCCGTGG - Intronic
1131565690 15:93483436-93483458 GCCCAGTTCCAAACAGGCCACGG - Intergenic
1131714624 15:95094844-95094866 GCCTAGTTCCTAACAGGCCAGGG + Intergenic
1131752116 15:95521005-95521027 GCCCAGTTGCTAAAAGGCCATGG + Intergenic
1131933619 15:97475541-97475563 GCCCAGTTCCTAACAGGCCAGGG - Intergenic
1131960676 15:97787382-97787404 GCCCAGTTCCTAATGGGCCATGG + Intergenic
1202962656 15_KI270727v1_random:138802-138824 GCCCAGGTCCTAACAGGCCAGGG + Intergenic
1133863753 16:9621810-9621832 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1133909294 16:10050314-10050336 GCCCAGTTCCTAATAGGTCATGG - Intronic
1134787265 16:16955899-16955921 GCCCAGCTCCTAATAGTCCATGG - Intergenic
1135144576 16:19950274-19950296 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1135679273 16:24442965-24442987 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1135693490 16:24565436-24565458 GCCCAGTTCCTAACAGGCCAAGG - Intronic
1135889977 16:26348390-26348412 GCCCAGTTCCTAAAAGGCTATGG + Intergenic
1137240019 16:46648200-46648222 GCCCAGTTCCCAACAGGCCAGGG - Intergenic
1137306277 16:47203752-47203774 GCCCGGTTCCTAACAGGCCATGG + Intronic
1137325499 16:47431240-47431262 GCCCAGTTCCTAAAAAGCCATGG - Intronic
1138113481 16:54342371-54342393 GCCCTGTTCCTACAAGGCCGTGG + Intergenic
1138370228 16:56520727-56520749 CCTCACTTCCTAATAGTCCTAGG - Intergenic
1138425690 16:56930981-56931003 GCCTGGTTCCTAATAGGCCAGGG + Intergenic
1138964746 16:62070787-62070809 GCCCAGTTCCTAACATGCCATGG + Intergenic
1139174355 16:64669594-64669616 GCCGAGTTCCTAAAAGTCCACGG + Intergenic
1140298638 16:73734208-73734230 GCCCGGTTCCTAATAGGCCATGG + Intergenic
1140358654 16:74326665-74326687 GGCCAGTTCCTAACAGGCCACGG + Intergenic
1140534559 16:75697730-75697752 GCCCAGTTCCTAACAGGCCATGG - Intronic
1140910710 16:79449272-79449294 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1141043639 16:80694302-80694324 GCCCGGTTCCTAACAGGCCACGG + Intronic
1141386232 16:83624643-83624665 GCCTGGTTCCTAATAGGCCATGG + Intronic
1142116842 16:88361314-88361336 GCCCAGTTCCTAATAGGCTTGGG + Intergenic
1142542104 17:667765-667787 GCCCAGTTCCCAACAGGCCACGG - Intronic
1142697441 17:1641157-1641179 GCCCAGTTCCTAACATGCCACGG - Intronic
1142777197 17:2150064-2150086 GCCCAGTTCCTAACAAGCCATGG - Intronic
1143209579 17:5175183-5175205 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1143219250 17:5247695-5247717 GCCCAGTTCCTAACAGGCCCCGG - Intergenic
1143908338 17:10227394-10227416 GCCCAGTTCCTAACAAGCCATGG + Intergenic
1144018356 17:11218791-11218813 GCCCGGTTCCTAACAGGCCTCGG - Intergenic
1144523895 17:15973492-15973514 GCCCAGTTCCTAACAGGCCACGG - Intronic
1144617827 17:16792538-16792560 GCCCGGTTCCTAACAGGCCATGG + Intronic
1144619059 17:16804643-16804665 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1144665666 17:17100499-17100521 GCCCAGTTCCTAATAAGCCATGG - Intronic
1144893641 17:18511052-18511074 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1144894877 17:18523144-18523166 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1145137346 17:20421090-20421112 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1145138582 17:20433222-20433244 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1146422428 17:32700406-32700428 GCCCAGTTCCTAACAGGCCACGG + Intronic
1147634838 17:41957476-41957498 GCCCGGTTCCTAACAGGCCATGG + Intronic
1148033361 17:44638595-44638617 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1148294362 17:46488034-46488056 GCCCAGTTCCTAACGGGCCATGG - Intergenic
1148316545 17:46705748-46705770 GCCCAGTTCCTAACGGGCCATGG - Intronic
1148391872 17:47278661-47278683 GCCCAGTTCCTAACAGGCCATGG - Intronic
1149040992 17:52187881-52187903 GCACAGTTCCTAACAGGCCATGG + Intergenic
1149794787 17:59509144-59509166 GCCCTGTTCCTAACAGGCTGTGG - Intergenic
1149953540 17:61019111-61019133 GCTCAGTTCCTAACAGGCCAGGG - Intronic
1150181390 17:63124692-63124714 GCCCAGTTCCTAATAGGCCACGG - Intronic
1150417720 17:65000939-65000961 GCCCAGTTCCTAACAAACCATGG - Intergenic
1150594201 17:66590052-66590074 CCCCAGTTCCTAACAGGCCATGG + Intronic
1150976055 17:70088438-70088460 GCCCGGTTCCTAACAGGCCATGG + Intronic
1151230548 17:72681920-72681942 GCCCAGTTCCTAACAAACCATGG - Intronic
1152381871 17:79946435-79946457 GGCCAGTTCCTAACAGGCCATGG + Intronic
1153246996 18:3082199-3082221 GCCCAGCTCCTAGTAGGCCACGG + Intronic
1153342362 18:3988689-3988711 GCCCGGTTCCTAACAGGCCACGG + Intronic
1153845207 18:9043184-9043206 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1153875566 18:9367545-9367567 GCCCGGTTCCTAAGAGGCGGCGG - Intronic
1154368845 18:13738987-13739009 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1154455095 18:14514391-14514413 GCCCAGGTCCTAACAGGCCAGGG + Intronic
1154488444 18:14898492-14898514 GCCTAGTTCCTAACAGGCCACGG + Intergenic
1155261019 18:24042525-24042547 GCCCAGTTCCTAACAGGCCATGG + Intronic
1155362808 18:25018729-25018751 GCCCGGTTCCTAATAGGCCATGG + Intergenic
1155401830 18:25447803-25447825 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1155690014 18:28608411-28608433 GCCCAGTTTCTAACAGGCCATGG - Intergenic
1155695951 18:28686868-28686890 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1155736075 18:29224112-29224134 ACCCAATTCCTAATAGGCCACGG - Intergenic
1156034100 18:32747661-32747683 GCCCAGTTCCTAACAGGCCATGG + Intronic
1156053047 18:32961800-32961822 GCCCAGTTCCTAATAGGCCATGG + Intronic
1157474038 18:48009963-48009985 GCCCACTTCCTAACAGGCCATGG - Intergenic
1157780245 18:50431969-50431991 GCCTAGTTCCTAAGAGGCCATGG - Intergenic
1158386338 18:56996689-56996711 GCCCACTTCCTAATAATTCTGGG - Intronic
1159222375 18:65481516-65481538 GCCCAGTTCCAAACAGGCCACGG + Intergenic
1159356679 18:67345502-67345524 GCCCATTTCCTAACAGGCCAGGG - Intergenic
1159937319 18:74379657-74379679 GCCCAGTTTCTAACAGGCCGTGG + Intergenic
1160281338 18:77493655-77493677 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1160398947 18:78594859-78594881 GCCCAGTTCCTAACAGCCCATGG + Intergenic
1160609803 18:80076089-80076111 GCCCAGTTCCTAACAGGCCATGG - Intronic
1161862348 19:6807548-6807570 GCCCAGTTCCTAACAGACCATGG + Intronic
1162655579 19:12126644-12126666 GCCTAGTTCCTAACAGGCCATGG + Intronic
1162676809 19:12305347-12305369 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1162833289 19:13300073-13300095 GCCCCGTTCCTAATAGGCCTCGG + Intronic
1163744613 19:19037909-19037931 GCCCAGGTCCTAACAGGCCAGGG - Intronic
1164579665 19:29426785-29426807 GCCCAATTCCCAATAGGCCACGG - Intergenic
1164945119 19:32286953-32286975 GCCCATTTCCTAACAGGCCACGG + Intergenic
1165242433 19:34479544-34479566 GCCCAGTTCCTAACAGGCGGTGG - Intergenic
1166017191 19:39991229-39991251 GCCCAGTTCCTAACAGGCCATGG + Intronic
1166018359 19:40001222-40001244 GCACAGTTCCTAACAGGCCGTGG + Intronic
1166034036 19:40154409-40154431 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1166128497 19:40731177-40731199 GCCCCGTTCCTAAGAGGCCATGG - Intronic
1166526107 19:43510817-43510839 GCCCAGTTCCTAACAGACCACGG - Intronic
1166582594 19:43915546-43915568 GCCCAGATCCTAACAGGCCACGG - Intronic
1166596049 19:44051353-44051375 GCCCGGTTCCTAACAGTCAGTGG + Intronic
1168402750 19:56095266-56095288 GCCCAGTTCCTAACAGGCCACGG + Intronic
1168582712 19:57568922-57568944 GCCCAGTTCCTAACAGGACATGG + Intergenic
925007130 2:452345-452367 GCCCAGTTCCTGACAGTCCACGG + Intergenic
925557838 2:5152049-5152071 GCCCGGGTCCTAATAGGCCATGG + Intergenic
925590975 2:5508982-5509004 GCCCAGTTCCTAACAGGCCATGG - Intergenic
925974618 2:9133161-9133183 GCCCAGTTCCTAACAAGCCATGG + Intergenic
926823570 2:16880136-16880158 GCCCAGTTCCTAACAGGCCATGG + Intergenic
927064835 2:19460847-19460869 GCACAGTTCCTAACAGGCCATGG - Intergenic
927204458 2:20598506-20598528 GCCCGGTTCCTAACAGGCCAGGG + Intronic
927298526 2:21483580-21483602 GCCCGGTTCCTAACAGGCCATGG - Intergenic
927817619 2:26233182-26233204 GCCCAGTTCCTAACAGGCTATGG + Intronic
928501820 2:31904680-31904702 GTCCAGTTCCTAACAGGCCACGG + Intronic
928641456 2:33303815-33303837 GCCCGGTTCCTAACAGGCCACGG + Intronic
928828953 2:35455528-35455550 GCCCAGTTCCTAACAGGCTGCGG - Intergenic
928963275 2:36951825-36951847 ACCCAGTTCCTAACAGGCCATGG - Intronic
929058209 2:37897136-37897158 GCCCCATTTCTAATAGTCCATGG + Intergenic
929104066 2:38346764-38346786 GCCCAGTTCCTAACAGGCCACGG + Intronic
929473234 2:42218040-42218062 ACCCAGTTCCTACCAGTCTGTGG - Intronic
929569222 2:43009501-43009523 GTCCAGTTCCTAACAGGCCATGG - Intergenic
929675126 2:43919008-43919030 GCCCGGTTCCTAACAGACCACGG - Intronic
930130825 2:47848225-47848247 GCCCAGTTCCTAACTGGCCCCGG - Intronic
930600986 2:53442946-53442968 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
930799322 2:55426156-55426178 GCACAGTTCCTAACAGGCCATGG + Intergenic
930818218 2:55620287-55620309 GCCCAGTTCCTAACAGGCCCTGG - Intergenic
930842682 2:55864881-55864903 GCCCGGTTCCTAACAGGCCATGG + Intergenic
930935950 2:56951645-56951667 GCCCAATTCCTAATAGGCCACGG + Intergenic
931094815 2:58927184-58927206 GCCCAGTTCCTAACAGGCCATGG + Intergenic
931430827 2:62207797-62207819 GCCCCGTTCCTAACAGACCATGG + Intronic
932250890 2:70242684-70242706 GCCCAGTTCCTAACAGGCCATGG - Intronic
932540785 2:72650006-72650028 GCCCAGTTCCTAACAGGCTATGG - Intronic
932599618 2:73114375-73114397 GCCCAGTTCCTAACAGGACATGG - Intronic
932741322 2:74293108-74293130 TCCCAGTCCCCAATAGTCAGTGG - Intronic
932959953 2:76402020-76402042 GCCCAGTTCCTAACAAGCCACGG - Intergenic
933006118 2:76997726-76997748 GCCCAATTCCTAACAGGCCATGG - Intronic
933076193 2:77930102-77930124 GCCCAGTTTCTAACAGGCCATGG + Intergenic
933313006 2:80684035-80684057 GCCTAGTTCCTAACAGGCCATGG + Intergenic
934660691 2:96142244-96142266 GCCCAGTTCCTAACAGACCACGG + Intergenic
934885808 2:98023284-98023306 GCCCAGTTCCTAACAGGCCACGG - Intergenic
935019017 2:99212643-99212665 GCCCAGTTCCTAACAGGTCATGG + Intronic
935108708 2:100072153-100072175 GCCCAGTTCCTAACAGGCCATGG - Intronic
935111042 2:100094573-100094595 GCCCAGGTCCTAACAGGCCCCGG + Intronic
935433097 2:102999160-102999182 GCCCAGTTCCCAACAGGCCACGG - Intergenic
936083083 2:109448366-109448388 GCCCAGTTCCTAACAGACCATGG - Intronic
936098342 2:109551971-109551993 GCCCAGTTCCTAACAGGCCATGG - Intronic
936123934 2:109770589-109770611 GCCCAGGTCCTAACAGGCCCCGG - Intergenic
936220755 2:110600875-110600897 GCCCAGGTCCTAACAGGCCCCGG + Intergenic
936258376 2:110936073-110936095 GCCCGGTTCCTAATAGGCCATGG + Intronic
937196471 2:120161682-120161704 GCCCAGTTCCTAACAGGCCATGG - Intronic
937363246 2:121243449-121243471 GCCCAGTTCCTAACAGGGCATGG - Intronic
937836719 2:126478615-126478637 GCCCAGTTCCTAACAGGCCATGG - Intergenic
937902716 2:127034192-127034214 GCCCGGTTCCTAACAGGCCATGG - Intergenic
938282828 2:130077806-130077828 GCCCAGGTCCTAACAGGCCAGGG + Intronic
938333462 2:130466377-130466399 GCCCAGGTCCTAACAGGCCAGGG + Intronic
938356351 2:130654294-130654316 GCCCAGGTCCTAACAGGCCAGGG - Intronic
938432785 2:131261099-131261121 GCCCAGGTCCTAACAGGCCAGGG - Intronic
938476792 2:131623350-131623372 GCCCAGGTCCTAACAGGCCAGGG - Intergenic
938740817 2:134230330-134230352 GCCCAGTTCCTAACAGGCCAAGG + Intronic
939440583 2:142244663-142244685 GCCAGGTTCCTAATAGGCTGTGG - Intergenic
940453313 2:153867952-153867974 GCCCAGTTCCTAACAGGCCATGG + Intergenic
940641549 2:156349744-156349766 GCCTGGTTCCTAATAGGCCATGG - Intergenic
941075965 2:161007123-161007145 GCTCAGTTCCTAACAGGCCACGG + Intergenic
941212093 2:162652677-162652699 GTCCAGTTCCTAACAGGCCACGG + Intronic
941398694 2:165003830-165003852 GCCCAGTTCCTAACAGGCCACGG - Intergenic
941488941 2:166119139-166119161 ACCCAGTTCCTAACAGGCCAGGG + Intronic
942420438 2:175801563-175801585 ACCCGGTTCCTAATAGGCTGTGG + Intergenic
942929558 2:181473174-181473196 GCCCAGTTCCTACCAGGCCACGG - Intronic
943156641 2:184187759-184187781 GCCCAGTTCCAAACAGGCCATGG + Intergenic
943657766 2:190527685-190527707 GCCCTGTTCCTAACAGACCATGG - Intronic
943905769 2:193499912-193499934 GACCAGTTCCTAAAAGGCCACGG + Intergenic
944626544 2:201575432-201575454 GCCCAGTTCCTAATGGGCCATGG - Intronic
945070436 2:205983620-205983642 CCCCAGTTCCTCATAGGCTGAGG + Intergenic
945149820 2:206778711-206778733 GCCCAGTTCCTAACAGGCCACGG - Intronic
945279564 2:208023466-208023488 GCCCAGTTCCTAACAGGCCATGG - Intronic
945337161 2:208605970-208605992 GCCCAGTTCCTAAGAGACCACGG + Intronic
945736085 2:213602112-213602134 GCCCAGTTTCTAACAGGCCACGG + Intronic
945933496 2:215880219-215880241 GCCCAGTTCCTAACAGGCCACGG + Intergenic
946146525 2:217735248-217735270 GCCTGGTTCCTAATAGGCCATGG + Intronic
946150406 2:217762400-217762422 GCTCAGTTCCTAACAGGCCATGG + Intergenic
946500742 2:220244905-220244927 GTCCAGTTCCTAACAGGCCAGGG + Intergenic
946655881 2:221946585-221946607 GCCCAGTTCCTAACAGTCCATGG + Intergenic
946739820 2:222790468-222790490 GCCCAGTTCCTAACAGGCCATGG + Intergenic
947113450 2:226744522-226744544 GCCCGGTTCCTAACAGGCCATGG - Intronic
947321368 2:228922796-228922818 GCCCGGTTCCTAACAGGCCACGG + Intronic
947676245 2:231983419-231983441 GCCCAGTTCCTAACAGGCCACGG - Intronic
948025485 2:234772834-234772856 GGCCAGTTCCTAACAGGCCATGG - Intergenic
948250131 2:236520896-236520918 GCCCAGTTCCTAACAGGCCACGG + Intergenic
948271187 2:236674412-236674434 GTCCAGTTCCTAACAGGCCATGG + Intergenic
948394934 2:237638454-237638476 TCCCAGTTCCTAACAGGCCATGG + Intronic
948612597 2:239179316-239179338 GCCCATTTCCTAACAGGCCAGGG - Intronic
1168747353 20:254914-254936 TCCCAGTTCCTAACAGGCCATGG + Intergenic
1168926569 20:1586519-1586541 GCCCAGTTCATAACAGGCCACGG - Intronic
1168987746 20:2064759-2064781 GCCCGGTTCCTAACAGGCTGCGG - Intergenic
1169254641 20:4087494-4087516 GCCCAGTTTCTAACAGGCCATGG + Intergenic
1169527425 20:6445181-6445203 GCCCAGTTCTTAACAGGCCACGG - Intergenic
1169924086 20:10765209-10765231 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1170789742 20:19497904-19497926 GCCCAGTTCCTAACAGGCCAGGG - Intronic
1171301423 20:24064194-24064216 GCCCAATTCCTAACAGGCCAAGG - Intergenic
1171365694 20:24622438-24622460 GCCCAGTTTCTAACAGGCCATGG - Intronic
1172306704 20:33885680-33885702 GCCAGGTTCCTAATAGGCCATGG - Intergenic
1172382425 20:34506424-34506446 GCCCAGTTCCTAACAGGCTGGGG - Intronic
1172626679 20:36351300-36351322 GCCCAGTTCCTAACAGGCCACGG - Intronic
1172804927 20:37604895-37604917 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1173466722 20:43288817-43288839 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1173477126 20:43367994-43368016 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1173725554 20:45294754-45294776 GCCCAGTTCCTAACAGGCCATGG - Intronic
1174144398 20:48440976-48440998 GCCCTGTTCCTAACAGGCCATGG - Intergenic
1174194839 20:48765812-48765834 GCCCGGTTCCTAACAGCCCACGG - Intronic
1174290264 20:49503454-49503476 GCCCATTTCTTAATAGGCCAAGG + Intergenic
1174427866 20:50445898-50445920 GCCCAGTTCCTAATAGGCCACGG - Intergenic
1174455932 20:50648909-50648931 GCCCAGTTCCTAACAGACCATGG + Intronic
1174679004 20:52386336-52386358 GCCCAGTTCCCAACAGGCCACGG - Intergenic
1174958047 20:55123128-55123150 GCCCAGTTCCTAACAGACTACGG + Intergenic
1175091817 20:56511211-56511233 GCCCGGTTCCTAAGAGGCCACGG - Intronic
1176819071 21:13638887-13638909 GCCCAGGTCCTAACAGGCCAGGG - Intronic
1177043015 21:16135912-16135934 GGCCAGTTCCTAACAGACCAAGG - Intergenic
1177071115 21:16509721-16509743 GCCCAGTTTCTTATGGTCAGTGG - Intergenic
1177127436 21:17212980-17213002 GCCCAGTTCCTAACAGGCCCAGG + Intergenic
1177732727 21:25049258-25049280 GCCCAGTTCCTAACAGGACATGG - Intergenic
1178157776 21:29874569-29874591 TCCCAGTTCCTAACAGGCCAAGG + Intronic
1178341682 21:31790775-31790797 GCCCACTTCCTAACAGGCCGTGG + Intergenic
1178437474 21:32572828-32572850 GCCCAGTTCCCAAGAGACCCAGG + Intergenic
1178604922 21:34027804-34027826 GCCCAGTTCCTAAGAGGCCATGG - Intergenic
1178844755 21:36165543-36165565 TCCCGGTTCCTAATAGGCCACGG - Intronic
1179046607 21:37850337-37850359 GCCCAGTCCCTAACAGGCCGCGG - Intronic
1179378312 21:40873525-40873547 GCCTTGTTCCTAATAGGCCATGG + Intergenic
1179609590 21:42541272-42541294 GCCCGGTTCCTAATAGGCCACGG + Intronic
1179949491 21:44701792-44701814 GCTCAGTTCCTAACAGGCCACGG + Intronic
1180018506 21:45103638-45103660 GCCCAGTTCCTAACAGGTCATGG + Intronic
1180476866 22:15719030-15719052 GCCCAGGTCCTAACAGGCCAGGG - Intronic
1181020157 22:20096090-20096112 GCCCGGTTCCTAACAGGCCATGG + Intronic
1181480624 22:23196879-23196901 GCCCAGTTCCTAACAGGCCACGG + Intronic
1181613318 22:24034223-24034245 ACCCAGTTCCTAACAGCCCATGG + Intronic
1181624112 22:24111320-24111342 GCCCAGTTCCTAACAGGCCACGG - Intronic
1181917470 22:26292521-26292543 CCCCAGTTCCTCACAGTCGGCGG + Exonic
1181972292 22:26700117-26700139 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1182302690 22:29346610-29346632 GCCCAGTTCCTTACAGGCCATGG + Intronic
1182879380 22:33720407-33720429 GCCATGTTCCTAATAGGCCACGG + Intronic
1183461326 22:37952741-37952763 GCCCGGTTCCTAACAGGCCAGGG - Intronic
1184591589 22:45487440-45487462 GCCCAGTTCCTAACAGGCCACGG + Intergenic
949361617 3:3238078-3238100 GCCCAGTTCCTAACAGGCCACGG - Intergenic
949434444 3:4013287-4013309 GCCCAGTTCCTAACAGCCCATGG + Intronic
949564262 3:5230424-5230446 GCCCAGTTCCTAACAGACTAGGG - Intergenic
949668543 3:6370336-6370358 GCCCAGTTTCTAACAGGCCATGG - Intergenic
949962295 3:9322471-9322493 GCCCTGTTCCTAATAGGCCACGG - Intronic
950347083 3:12306342-12306364 GCCCAGTTCCTAACAGGCCATGG + Intronic
950624958 3:14238549-14238571 GCCCGGTTCCTAAGAGGCCACGG + Intergenic
950761705 3:15235769-15235791 GCCCAGTTCCTAACAGGCCATGG + Intronic
950826123 3:15823325-15823347 AGCCAGTTCCTAATGGGCCGTGG + Intronic
950969241 3:17170059-17170081 GCCCGGTTCCTAACAGGCCACGG + Intronic
951480685 3:23159328-23159350 GCCCACTTCCTAACAGACCACGG + Intergenic
951553592 3:23898802-23898824 GCCCGGTTCCTAACAGGCCCTGG - Intronic
951960315 3:28311013-28311035 GCCCGGTTCCTAACAGGCCATGG + Intronic
952090409 3:29878236-29878258 GCCCGGTTCCTAACAGGCCATGG + Intronic
952162976 3:30714269-30714291 GCCCAGTTCCTAACAGGCCATGG - Intergenic
952210322 3:31223555-31223577 CCCCAGTTCCTAATAATTCGTGG + Intergenic
952267295 3:31799031-31799053 GCCCAGTTCCTAACAGTCCATGG + Intronic
952365557 3:32671784-32671806 GCCCGGTTCCTAACAGGCCATGG + Intergenic
952459033 3:33504889-33504911 GCCCAGTTCCTAACAGGCCATGG + Intronic
952474338 3:33691114-33691136 GCCCAGTTCCTAACAGGTCATGG + Intronic
952796268 3:37242171-37242193 GCCCGGTTCCTAACAGGCCATGG + Intergenic
952799128 3:37271767-37271789 GCCCAGTTCCTAAAGGGCCACGG - Intronic
953116870 3:40001614-40001636 GCCCAGTGCCTAACACTCAGAGG - Intronic
953814973 3:46147721-46147743 GCCCAGTTCCTAACAGGGCATGG + Intergenic
954055270 3:48018148-48018170 GCCCAGTTCCTAACTGGCCATGG + Intronic
954308898 3:49749165-49749187 GCCCAGTTCCTAACAGGTCATGG + Intronic
954731390 3:52665519-52665541 GCCCAGTTCCAAACAGGCCATGG - Intronic
955022238 3:55132605-55132627 GCCCAGTTCCTAACAGGCCACGG - Intergenic
955292023 3:57701005-57701027 GCCCGGTTCCTAAGAGGCCATGG + Intergenic
955718976 3:61862036-61862058 GCCCAGTTCCTAACAGGCCAGGG - Intronic
955733155 3:62008894-62008916 GCCCAGATCCTAACAGGCCATGG + Intronic
955851412 3:63224126-63224148 GCCCAGCTCCTAACAGGCCATGG - Intergenic
955905570 3:63804181-63804203 GCCCAGTTCCTAACAGGCCATGG + Intergenic
956273793 3:67476196-67476218 GCCCAGTTCCTAACAGGCCATGG - Intronic
956298269 3:67738445-67738467 GCCCAGCTCCTAACAGGCCACGG + Intergenic
956327999 3:68074311-68074333 GTCCAGTTCCTGATAGGCTGTGG + Intronic
956438690 3:69259374-69259396 GCCCGGTTCCTAACAGGCCATGG + Intronic
958261456 3:91386255-91386277 GCCCAATTCCTAACAGGCCACGG - Intergenic
958411523 3:93822480-93822502 GCCCAGTTCCTAACAGGACATGG + Intergenic
958610900 3:96424776-96424798 GCCCAGTCCATAACAGTCCTAGG + Intergenic
958972027 3:100622124-100622146 GCCTGGTTCCTAATAGGCCATGG + Intronic
959181515 3:102986303-102986325 ACCCAGTTCCTAACAGGCCATGG + Intergenic
960020680 3:112948652-112948674 GCCCAATCCCTAATAGGCCAAGG + Intronic
960086114 3:113593267-113593289 GCCCAGCTCCTAACAGGCCACGG - Intronic
960218724 3:115077054-115077076 GTCCAGTTCCTAACAGGCCAGGG + Intronic
960225117 3:115159051-115159073 GCCCAGTTCCTAACAGGTCATGG - Intergenic
960589081 3:119348022-119348044 GCCCAGTTCCTAACAGGTCACGG - Intronic
960672882 3:120169124-120169146 GCCTGGTTCCTAACAGTCCATGG - Intronic
960775413 3:121246075-121246097 GCCTAGTTCCTAACAGGCCATGG - Intronic
960796283 3:121491825-121491847 GCCCAGTTCCTAACAGGCCATGG - Intronic
960804940 3:121574692-121574714 GACCAGTTCCTAACAGGCCATGG + Intronic
961199597 3:125033732-125033754 GCCTGGTTCCTAATAGCCCGCGG - Intronic
961488744 3:127236021-127236043 GCCCGGTTCCTAACAGGCCATGG - Intergenic
962002129 3:131309068-131309090 GCCCGGTTCCTAACAGGCCATGG + Intronic
962505203 3:136039682-136039704 GCCCAGTACCTAACAGGCCACGG + Intronic
962685101 3:137840060-137840082 GCCCAGTTCCTAGTGGACCACGG + Intergenic
962805296 3:138922841-138922863 GCCCGGTTCCTAACAGGCCATGG + Intergenic
963118387 3:141753636-141753658 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
963147340 3:142007943-142007965 GCCCAGCTCCTAACAGGCCACGG + Intronic
963215332 3:142739899-142739921 GCCCAGTTCCTAACAGACCACGG - Intronic
963744781 3:149115256-149115278 GCCCAATTCCTAAGAGGCCATGG - Intergenic
964737463 3:159931375-159931397 GCCCAGTTCCTAACAGGCCATGG + Intergenic
964764596 3:160167566-160167588 GCCCAGTTCCTAACAGGCCACGG - Intergenic
965435712 3:168648485-168648507 GCCCAGTTCCTAACAGACCATGG - Intergenic
966363397 3:179154243-179154265 GCCCGGTTCCTAACAGGCCAGGG - Intronic
966510828 3:180761278-180761300 GCCCAGTTCCTAACAGGTCATGG - Intronic
966556798 3:181271487-181271509 GCCCAGTTCCTAACAAGCCACGG - Intergenic
966813052 3:183865433-183865455 GCCCAGTTCCTAACAGGCCACGG - Intronic
967518463 3:190399789-190399811 GCCCAGTTACTAACAGGCCACGG - Intronic
968641273 4:1716307-1716329 GCCCAGTTCCTGATGGTTCAAGG - Exonic
969055557 4:4399973-4399995 GACCAGTTCCTAACAGGCCATGG + Intronic
969120869 4:4910114-4910136 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
969184582 4:5465815-5465837 GCCCAGGTCCTAACAGGCCCAGG + Intronic
969254866 4:5994806-5994828 GCCCAGGTCCTAACAGGCCACGG - Intergenic
970430476 4:15984522-15984544 GCCCAGTTCCTAACAGGCTGTGG - Intronic
970630850 4:17942810-17942832 GCCCAGTTCCTTACAGGCCATGG - Intronic
970690424 4:18613200-18613222 GCCCAGTTCCTAACAGACCAGGG + Intergenic
970809769 4:20078837-20078859 GCCCAGTTCCTAACAGACCGGGG + Intergenic
970900458 4:21152686-21152708 GCCCAGTTCCTAACAGGCCACGG - Intronic
971364092 4:25962661-25962683 GCCCAGTTCCCAACAGGCCACGG + Intergenic
971483728 4:27138672-27138694 GCCCAGTTCCTACCAGGCCATGG - Intergenic
971743874 4:30553580-30553602 GCCCAGTTCCTAACAGGCCATGG - Intergenic
971917400 4:32890759-32890781 GCCCAGTTCCTAACAGGCCATGG + Intergenic
972049644 4:34713081-34713103 GCCCAGTTCCTAGCAGTTCGTGG + Intergenic
972269898 4:37501244-37501266 GCCCGGTTCCTAACAGGCCATGG - Intronic
972536947 4:40007779-40007801 GCCCAGTTCCTAACAGGCTGAGG + Intergenic
972556462 4:40186520-40186542 GCCCAGTTCCTAACAGGCCACGG + Intergenic
972975694 4:44632921-44632943 GCCCGGTTCCTAACAGGCCATGG - Intronic
973017781 4:45163317-45163339 GCCTAGTTCCTAACAGGCCACGG + Intergenic
973095944 4:46199956-46199978 GCCTGGTTCCTAATAGTCCAGGG - Intergenic
973133143 4:46673109-46673131 GCCCAGTTCCTAACAGGCCTCGG + Intergenic
973145501 4:46820439-46820461 GCCTAGTTCCTAACAGGCCATGG + Intronic
973595668 4:52486588-52486610 GCCCGGTTCCTAAGAGGCCATGG + Intergenic
973650796 4:52995395-52995417 GCCTGGTTCCTAACAGGCCGTGG + Intronic
973664562 4:53144899-53144921 GCCCGGTTCCTAACAGGCCATGG - Intronic
974035352 4:56813442-56813464 GCCCAGTTCCTAACAGGCCATGG - Intronic
974488507 4:62534187-62534209 GCCCAGTTCCTAACAGGCCATGG - Intergenic
974619274 4:64335132-64335154 GCCAGGTTCCTAATAGGCCAGGG - Intronic
974897122 4:67953197-67953219 GCCTAGTTCCTAACAGGCCATGG + Intronic
975249326 4:72159863-72159885 GCCCAGTTCCTAACAGGCCACGG - Intergenic
975789208 4:77930282-77930304 GCCCAGTTCATAATAGGACACGG - Intronic
976165262 4:82247781-82247803 GCCCAATTCCTAACAGGCCATGG - Intergenic
976417927 4:84800918-84800940 GCCCAGTTCCTAACAGGACATGG + Intronic
976566872 4:86561219-86561241 GCCCAGTTCTTAACAGGCCATGG + Intronic
976705498 4:88015198-88015220 GCCCAGTTCCTAACAGGCCATGG - Intronic
976705628 4:88016171-88016193 GCCCGGTTCCTAACAGGCCATGG + Intronic
976953691 4:90866989-90867011 GCCCAGTTCCTTATAGGCCACGG + Intronic
977173348 4:93789854-93789876 GCCCAGTTCCTAACAGGCCATGG - Intergenic
977180909 4:93872553-93872575 GTCCAGTTCCTAACAGGCCACGG + Intergenic
977612496 4:99050581-99050603 GCCCAGCTCCTAACAGGCCATGG - Intronic
977817503 4:101431880-101431902 GCCCAGTTCCTAACAGGCCATGG + Intronic
978055826 4:104264837-104264859 GCCCAGTTCCTAACAGGCCATGG - Intergenic
978209330 4:106116562-106116584 GCCCAGTTCCTAACAAGCCATGG - Intronic
978367951 4:108002184-108002206 GCCCGGTTCCTAATGGGCCACGG - Intronic
978419443 4:108514537-108514559 GCCCAGTTCCTAACAGGCTGTGG + Intergenic
978471661 4:109074245-109074267 GCCCAGTTCCTAACAGGCCAAGG + Intronic
978471857 4:109076992-109077014 GCCCAGTTTCTAAGAGGCCATGG + Intronic
978479675 4:109174841-109174863 GCCCAGTTCCTAACAGGCCATGG - Intronic
978671010 4:111247131-111247153 GCCCAGTTCCTAACAGGCCATGG - Intergenic
979007248 4:115315382-115315404 GCCTAGTTCCTAACAGGCCAGGG - Intergenic
979114963 4:116812044-116812066 GCCCATTTCCTAACAGGCCAGGG - Intergenic
979161255 4:117464228-117464250 ACCCAGTTCCTAACAGGCCATGG - Intergenic
979685160 4:123503928-123503950 GCCCAGTTCCTAGCAGGCCACGG + Intergenic
979790980 4:124780886-124780908 GCCCGGTTCCTAACAGGCCAGGG - Intergenic
979920809 4:126493600-126493622 GCCGGGTTCCTAACAGTCCATGG + Intergenic
979977769 4:127218262-127218284 GCCCAGTTCCTAACAGGCCACGG - Intergenic
980280904 4:130718245-130718267 GCCCAGTTCCTAACAGGCTATGG + Intergenic
980501151 4:133656006-133656028 GCTCAGTTCCTAAAAGGCCATGG + Intergenic
980623472 4:135341545-135341567 GCCCAGTTCCTAATAGGTCAGGG + Intergenic
980711362 4:136572928-136572950 GCCCAGTTCCTAACAGGCAAGGG - Intergenic
980974583 4:139598594-139598616 GCCCAGTTCCCAACAGGCCATGG - Intronic
981088652 4:140709935-140709957 GCCCAGTTCCTAACAGGCCACGG + Intronic
981106890 4:140891743-140891765 GCCCAGATCCTAACAGACCATGG - Intronic
981527682 4:145722689-145722711 GCCCACTTCCTAACAGGCCATGG - Intronic
981734714 4:147936854-147936876 GCCTGGTTCCTAATAGGCCACGG - Intronic
981755894 4:148141646-148141668 GCCCAGTTCCTAACAAGCCATGG - Intronic
981758864 4:148171673-148171695 GCCCAGTTCCTAACAGGTCAGGG + Intronic
982560035 4:156918485-156918507 GCCCAGTTCCTAACAGGCCAAGG - Intronic
982713733 4:158784782-158784804 GCCCGGTTCCTAACAGGCCATGG + Intronic
982858196 4:160412541-160412563 GCCCGGTTCCTAACAGTCCAGGG - Intergenic
982867970 4:160541683-160541705 GTTCAGTTCCTAATAGGCCATGG + Intergenic
982924543 4:161319558-161319580 GCCCAGTTTCTAACAGGCCATGG - Intergenic
983420442 4:167508896-167508918 GCCCAGTTCCTAACAGGCCATGG - Intergenic
983439780 4:167766561-167766583 GCCCAGTTCCTAACAGGCCAGGG + Intergenic
983631840 4:169857267-169857289 ACCCAGTTCCTAACAGGCCATGG + Intergenic
983652650 4:170048954-170048976 GCCCAGTTCCTACTGGGCCATGG + Intergenic
983946834 4:173595430-173595452 GCCCAGTTCCTAAAAGGCCATGG + Intergenic
984079800 4:175233272-175233294 GCCCGGTTCCTAACAGGCCACGG - Intergenic
984081063 4:175250573-175250595 GCCCAGTTCCTAATAGGCCATGG + Intergenic
984173469 4:176388404-176388426 GCCCAGTTCCTAATAGGCCGTGG - Intergenic
984461411 4:180041404-180041426 GCCCAGTTCCTAACATGCCACGG + Intergenic
984900904 4:184585567-184585589 GCCCAGTTCCTAATAGGCCATGG - Intergenic
985949471 5:3212544-3212566 GCAGAGTTCCTAAAAGTCCATGG + Intergenic
986112270 5:4731054-4731076 GCCCAGTTCCTAACAGGCCATGG - Intergenic
987017849 5:13838311-13838333 GCCCGGTTCCTAACAGACCATGG - Intronic
987910634 5:24139390-24139412 GCCTAGTTCCTAATAGGCCATGG + Intronic
988144697 5:27291252-27291274 GCCCAGTTCCTAACAGGCCACGG - Intergenic
988452504 5:31357352-31357374 GCCCAGTTCCTAACAGGCCATGG + Intergenic
988527672 5:32000880-32000902 GCCCAGCTCCTAACAGGCCATGG - Intronic
988553315 5:32216222-32216244 GCCCAGTCCCTAATAGGCCACGG - Intergenic
988641768 5:33048558-33048580 GCCCAGTTCCTAACAGGCCACGG + Intergenic
988665731 5:33325433-33325455 GCCTGGTTCCTAATAGTCCATGG - Intergenic
988902812 5:35752179-35752201 GCCCAGTTCCTAACAAGCCATGG + Intronic
988950017 5:36246499-36246521 GCCCGGTTCCTAATAGGCCAGGG - Intergenic
988953302 5:36287259-36287281 ACCCAGTTCCTAACAGGCCATGG + Intronic
989091805 5:37741691-37741713 GCTCAGTTCCTAACAGGCCATGG + Intronic
989227539 5:39047455-39047477 GCCCCGTTCCTAACAGGCCACGG + Intronic
989472519 5:41836793-41836815 GCCCAGTTCCTAACAGACCATGG + Intronic
989627426 5:43443789-43443811 GCCCAGTTACTAACAGGCCATGG - Intergenic
989799072 5:45513517-45513539 ACCCAGTTCCTAACAGTCCAGGG - Intronic
990443163 5:55866605-55866627 GCCCAGTTCCTAACAGGCCATGG + Intronic
990650862 5:57898096-57898118 GCCTAGTTCCTAACAGGCCATGG + Intergenic
990748594 5:58986445-58986467 GCCCAGTTCCTGACAGGCCACGG - Intronic
991066198 5:62427499-62427521 GCCCAGTTCCTAGCAGGCCACGG - Intronic
991197403 5:63952562-63952584 GCCCAGTTTCTAACAGGCCATGG + Intergenic
991230689 5:64329902-64329924 GCCCAGTTCCTAACAGGCCATGG + Intronic
991286499 5:64982828-64982850 GCTCAGTTCCTAACAGGCCATGG - Intronic
991316209 5:65309549-65309571 GCCCAGTTCCTAACAGGCCATGG + Intronic
991346399 5:65673363-65673385 GCCTGGTTCCTAACAGTCTGTGG - Intronic
991575554 5:68099629-68099651 GCACAGTTCCTAACAGGCCACGG + Intergenic
992226638 5:74625291-74625313 GCCCACTTCCTAACAGACCACGG - Intergenic
992307764 5:75461172-75461194 GCCCAGTTACTAACAGCCCATGG - Intronic
992317306 5:75569697-75569719 GCCCAGTTCCTAACAGACCATGG - Intronic
992485692 5:77192138-77192160 GCCCAGTTCCCAACAGGCCACGG + Intergenic
992685357 5:79194254-79194276 GCCCGGTTCCTAACAGGCCATGG - Intronic
993078816 5:83270268-83270290 GCCCACTTCCTATTAGGCCATGG + Intronic
993307238 5:86288383-86288405 GCCCAGTTCCTAACAGGTCATGG - Intergenic
993467357 5:88265555-88265577 GCCCAGTTCCTAACAGGCCATGG + Intronic
993885438 5:93410399-93410421 GCCTGGTTCCTAATAGGCCATGG - Intergenic
993913142 5:93708670-93708692 ACCCAGTTCCTAACAGGCCAGGG + Intronic
993923061 5:93831163-93831185 GCCCAGTTCCTAACAGGCCATGG + Intronic
994163589 5:96584339-96584361 GCCCAGGTCCTAACAGGCCAGGG + Intronic
994323638 5:98423193-98423215 GCCCAGTTCCTAACAGGCCACGG + Intergenic
994632655 5:102305211-102305233 GTCCTGTTCCTAATAGGCCATGG + Intergenic
994938245 5:106284600-106284622 TCCCAGTTCCTAATAGGCCATGG + Intergenic
995179720 5:109219489-109219511 GCCTAGTTCCTAACAGGCCACGG - Intergenic
995390417 5:111634516-111634538 GCCCAGTTCCTAACATGCCATGG - Intergenic
996322142 5:122230731-122230753 GCCCAGTTCCTAACAGTCCAGGG + Intergenic
996859902 5:128053490-128053512 GCCCAGTTCCTAACAGGCCATGG + Intergenic
997150672 5:131491556-131491578 GCCCAGTTCCTAACAGGCCATGG - Intronic
997959452 5:138308119-138308141 GCCCGGTTCCTAACAGGCCATGG + Intronic
998008142 5:138671220-138671242 GCCCAGTTCCTAACAGGCCAGGG + Intronic
998432751 5:142080608-142080630 GCCCAGTTCCTAATAGGCCATGG - Intergenic
998915842 5:147010716-147010738 GCCCAGTTCTTAACAGGCCACGG + Intronic
999010578 5:148034215-148034237 GCCCAGTTCCTAGCAGGCCATGG - Intronic
999193917 5:149769300-149769322 GCCCGGTTCCTAACAGGCCACGG + Intronic
999871736 5:155758515-155758537 GCCCAGTTGCTAACAGGCCATGG - Intergenic
1000375107 5:160573489-160573511 GCCCAGTTCCTAATGGGCTATGG - Intronic
1001350190 5:170954891-170954913 GCCCAGTTCCTAACAGGCTGTGG - Intronic
1001538107 5:172513904-172513926 GCCCAGTTCCTAACAGTCCTTGG - Intergenic
1002055300 5:176595240-176595262 GCCCAGTTCCAAATAATGCCAGG - Intronic
1002625756 5:180527776-180527798 ACCCAGTTCCTAACAGGCCATGG - Intronic
1003253654 6:4455682-4455704 GCCCAGTTCCTCAGGGTCCTTGG - Intergenic
1003344862 6:5257551-5257573 GCCCGGTTCCTAACAGGCCACGG - Intronic
1003850786 6:10220468-10220490 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1004030682 6:11866086-11866108 GCCCAGTTCCTAATGGGCGATGG - Intergenic
1004157946 6:13187173-13187195 GCCCGGTTCCTAATAGGCCGCGG + Intronic
1004373807 6:15075018-15075040 GCCCAGTTCCTAATAGGCCATGG + Intergenic
1004444439 6:15685148-15685170 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1004501076 6:16210748-16210770 GCCCAGTTCCTGACAGGCCATGG + Intergenic
1004515131 6:16316038-16316060 GCCCAGTACCTAACAGGCCATGG - Intronic
1004597550 6:17114767-17114789 GCCCAGTTCCTAACAGGCCACGG + Intronic
1004645651 6:17558408-17558430 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1005660529 6:27994264-27994286 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1005932759 6:30496186-30496208 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1006188637 6:32194563-32194585 GCCCAGTTCCTAAGAGGCCATGG + Intronic
1006714475 6:36107165-36107187 GCCCAGTCCCCATCAGTCCGTGG + Intronic
1006836333 6:37001090-37001112 GCCCAGTTCCTAATAGGCTACGG - Intergenic
1007401978 6:41607940-41607962 GCCCAGTTCCTAGCAGGCCACGG + Intergenic
1008067620 6:47066740-47066762 GCCCAGTTCCTAACGGGCCATGG - Intergenic
1008551240 6:52633331-52633353 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1008820075 6:55621349-55621371 GCCCAGTTTCTAACAGGCCATGG - Intergenic
1008993706 6:57633892-57633914 GCCCAATTCCTAACGGGCCGTGG + Intronic
1009052236 6:58290051-58290073 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1009182313 6:60532977-60532999 GCCCAATTCCTAACGGGCCGCGG + Intergenic
1009443052 6:63705362-63705384 GCCCAGTTCCTAATAGGCCATGG - Intronic
1009517781 6:64641697-64641719 GCCCAGTTCCTAACAGGCCATGG - Intronic
1009773706 6:68177904-68177926 GCCCAGTTTCTAACAGGCCAAGG - Intergenic
1010041005 6:71383687-71383709 GTCCAGTTCCTAACAGGCCCTGG + Intergenic
1011570641 6:88730653-88730675 GCCCAGTTCCTAACAGGCCATGG + Intronic
1011905489 6:92362100-92362122 GCCCAGTTCCCAACAGGCCATGG - Intergenic
1012132677 6:95517139-95517161 GCCCAGTTCCTTAGAGTCCATGG - Intergenic
1012979832 6:105817881-105817903 GCCCAGTTTCTAAGAGGCCATGG - Intergenic
1013045205 6:106478666-106478688 GCCCAGTTCCTAACAGGTCATGG - Intergenic
1013227099 6:108127739-108127761 GCCCAGTTCCTAACAGGCCATGG + Intronic
1013465853 6:110416452-110416474 GGCCAGTTCCTAACAGGCCACGG + Intergenic
1013547541 6:111173479-111173501 GCCCAATTCCTAACAGGCCATGG - Intronic
1013725410 6:113089274-113089296 GCCCAGTTCCTAACAGGCGGTGG + Intergenic
1013880918 6:114899607-114899629 GCCCAGTTCCTAATTTCCTGGGG - Intergenic
1014010476 6:116469785-116469807 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1014136797 6:117898694-117898716 GGCCAGTTCCTAACAGGCCATGG - Intergenic
1014227337 6:118862730-118862752 GCCCGGTTCCTAACAGGCCATGG + Intronic
1014350772 6:120342468-120342490 GCCTGGTTCCTAACAGTCTGGGG - Intergenic
1014541009 6:122676387-122676409 GCCCAGTTCCTAACAGGCCATGG + Intronic
1014727366 6:124987989-124988011 GCCTGGTTCCTAACAGTCCGGGG - Intronic
1015201223 6:130583519-130583541 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1015280241 6:131425790-131425812 GTCCAGTTCCTAACAGGCCCGGG + Intergenic
1015360106 6:132330186-132330208 GCCTAGTTCCTAACAGGCCACGG - Intronic
1015384122 6:132602602-132602624 GCTCAGTTCCTAACAGTCCAAGG + Intergenic
1015465552 6:133544542-133544564 GCCTGGTTCCTAACAGTCCCAGG - Intergenic
1015593490 6:134844232-134844254 GCCCAGCTCCTAATAGGCCATGG + Intergenic
1015672738 6:135708760-135708782 GCCCAGTTCCTAACGGGCCACGG + Intergenic
1015973898 6:138769862-138769884 GCCCAGTTCCTAACAGGCCACGG + Intronic
1016025886 6:139286587-139286609 GCCCAGTTCCTAACAGGCCACGG - Intronic
1016580164 6:145620398-145620420 GCCCGGTTCCTAACAGGCCATGG + Intronic
1016672481 6:146725330-146725352 GCCCAGTTCCTAACAGGCCTCGG - Intronic
1017249116 6:152260918-152260940 GTCCAGTTCCTAACAGGCCACGG + Intronic
1017737144 6:157375585-157375607 GCCCGGTTCCTAACAGGCCGTGG - Intergenic
1018329107 6:162708841-162708863 GCCCAGTTCCTAACAGGCCACGG - Intronic
1018335645 6:162785800-162785822 GCCCAGTTCCTAGCAGGCCACGG + Intronic
1018512499 6:164540493-164540515 GCCCAGTTCCTAACAGCCTATGG - Intergenic
1018751961 6:166814467-166814489 GCCCGGTTCCTAACAGGCCACGG - Intronic
1018796301 6:167187903-167187925 GCCCAGTTCCCAAGAGACCCAGG - Intronic
1018820014 6:167367156-167367178 GCCCAGTTCCCAAGAGACCCAGG + Intronic
1019263124 7:93446-93468 GCCCAGTTCCTGACAGGCCACGG - Intergenic
1019466326 7:1191367-1191389 GCCCCGTTCCTAACAGGCCATGG - Intergenic
1019802534 7:3098838-3098860 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1019887513 7:3918244-3918266 GCCTGGTTCCTAATAGGCCATGG - Intronic
1020187706 7:5971513-5971535 CCCCACTTCCTAATAGGCCATGG + Intergenic
1020295211 7:6753257-6753279 CCCCACTTCCTAATAGGCCATGG - Intergenic
1020663343 7:11008371-11008393 GCCCAGTTCCTAACAGGCCAAGG - Intronic
1021448678 7:20760570-20760592 GCCCGGTTCCTAACAGGCCATGG - Intronic
1021590392 7:22254940-22254962 GCCCAGTTCCCAATATGCCACGG + Intronic
1021695390 7:23271274-23271296 GCCCAGTTCCTAACAGACTGAGG + Intronic
1022144252 7:27521534-27521556 ACCCAGTTCCTAACAGGCCACGG - Intergenic
1022518084 7:30988227-30988249 GCCCTGTTCCTAACAGTTCTAGG - Intronic
1022584439 7:31592749-31592771 GCCCACTGCCTAATAGGCCATGG + Intronic
1022881836 7:34595726-34595748 GGCCAGTTTCTAATAGGCCATGG - Intergenic
1023509662 7:40938096-40938118 GCCAGGTTCCTAATAGGCCACGG + Intergenic
1023728746 7:43170051-43170073 GCCCAGTTCCCAACAGGCCATGG - Intronic
1023729137 7:43173722-43173744 GCCCAGTTCCAAACAGGCCAAGG + Intronic
1024281599 7:47723567-47723589 GCCCAGTTCTTAACAGGCCATGG - Intronic
1024758704 7:52568186-52568208 GCCCGGTTCCTAACAGACCATGG + Intergenic
1025014081 7:55424715-55424737 GCCCAGTCCCTAACAGGCCACGG - Intronic
1025137239 7:56428682-56428704 GCCTGGTTCCTAATAGGCCATGG + Intergenic
1025218778 7:57086141-57086163 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1025629703 7:63259729-63259751 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1025652571 7:63484298-63484320 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1026112268 7:67467849-67467871 ACCCAGTTCCTAACAGGCCACGG - Intergenic
1026181527 7:68045346-68045368 GCCCAGTTCCTAACAGACCACGG + Intergenic
1026182374 7:68053188-68053210 GCCCTGTTCCTAACAGGCCATGG + Intergenic
1026209978 7:68295528-68295550 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1026224060 7:68425315-68425337 GCCCAGTTCCTAACAGGCTGTGG - Intergenic
1026315118 7:69221235-69221257 GGCCAGTTCCTAACAGTCCAAGG + Intergenic
1026558393 7:71427690-71427712 GCTCAGTTCCTAAAAGGCCATGG - Intronic
1026647773 7:72187394-72187416 GCCCGGTTCCTAACAGGCTGTGG - Intronic
1027426677 7:78068330-78068352 GCCCGGTTCCTAACAGACCATGG + Intronic
1027613579 7:80393033-80393055 GCCCAGTTTCTAACAGGCCACGG + Intronic
1028057213 7:86261293-86261315 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1028473070 7:91225308-91225330 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1029242513 7:99174037-99174059 GCCCAGTTCCTAATAGGCCACGG - Intronic
1029355508 7:100048946-100048968 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1029421301 7:100473036-100473058 GCCCGGTTCCTATCAGTCCCCGG + Intronic
1029491036 7:100870274-100870296 GCCCAGTTCCTAACAGGCCATGG + Intronic
1029809815 7:103035958-103035980 GCCTAGTTCCTAACAGGCCATGG - Intronic
1030115750 7:106061093-106061115 TCCCAGTTCCTAACAGGCCCTGG + Intergenic
1030199183 7:106885110-106885132 GCCCAGTTCCTAACAGGCCATGG + Intronic
1030263348 7:107589611-107589633 GCCCAATTCCTGACAGGCCGTGG + Intronic
1030282647 7:107792648-107792670 GCCCAGTTCTTAACAGGCCACGG + Intronic
1030291890 7:107880959-107880981 GCCCAGTTCCTAACAGGCCAAGG + Intergenic
1030399820 7:109034361-109034383 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1030479307 7:110082294-110082316 GCCCAGTTCCTAATAGGCCACGG + Intergenic
1030613756 7:111716618-111716640 GCCCAGTTCCTAACAGGCCAAGG - Intergenic
1030694431 7:112569296-112569318 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1030720732 7:112867859-112867881 GCCCGGTTCCTAACAGGCCACGG - Intronic
1030723807 7:112901169-112901191 GCCCAGTTCCTAACAGGTCACGG - Intronic
1030845183 7:114400781-114400803 GCCCAGTTCCTAACAGGCCATGG + Intronic
1030937513 7:115603623-115603645 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1030948836 7:115763555-115763577 GCCGAGTTCCTAAGAGGCCATGG + Intergenic
1031120134 7:117712932-117712954 GCCCAGTTATTAATAGGCCATGG - Intronic
1031135802 7:117882784-117882806 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1031270309 7:119641022-119641044 GCCCGGTTCCTAACAGACCAAGG - Intergenic
1031497228 7:122465425-122465447 GCCCAGTTCCAAACAGGCCATGG - Intronic
1031546184 7:123053538-123053560 GCCCAGTTCCTAACAGTCCATGG - Intergenic
1031574753 7:123401527-123401549 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1032247145 7:130222694-130222716 GCCCAGTTCCTAACAGGCCACGG - Intergenic
1032587838 7:133164032-133164054 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1032654808 7:133916308-133916330 GCCCAGTTCCTAACAGGCCATGG + Intronic
1032707309 7:134432604-134432626 GCCCCGTTCCTAACAGGCCATGG + Intergenic
1033135454 7:138780426-138780448 GCCCAGTTCCTAACAGGCCATGG + Intronic
1033335237 7:140446712-140446734 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1033949160 7:146762298-146762320 GCCCAGTTCCTAAGAATCCCTGG + Intronic
1034106971 7:148498428-148498450 GCCCAGTTTCTAACAGACCATGG - Intergenic
1034485477 7:151358401-151358423 GCCCAGTTCCTAACAAGCCACGG - Intronic
1034518353 7:151599772-151599794 GCCCATTTCCTAACAGGCCAGGG + Intronic
1034905414 7:154940419-154940441 GCCCAGTTCCTAATAGGCCGTGG - Intronic
1034973971 7:155437206-155437228 ACACAGTTCCTAATAATGCGGGG + Intergenic
1035112526 7:156495085-156495107 GCCCAGCTCCTAACAGGCCATGG - Intergenic
1035445611 7:158940414-158940436 GCCCAGTTCGTAATAGGCCGTGG + Intronic
1035448245 7:158957570-158957592 GGCCGGTTCCTCATAGCCCGTGG - Intergenic
1035901549 8:3462359-3462381 GCCCAGTTCCTAGCAGGCCATGG - Intronic
1036336280 8:7873175-7873197 GCACGGTTCCTAACAGTCCAGGG + Intergenic
1036736025 8:11317580-11317602 GGCCAGTTCCTAACAGGCCACGG + Intronic
1037140883 8:15519467-15519489 GCCTGGTTCCTAATAGGCCAAGG - Intronic
1037207692 8:16343340-16343362 GCCCAGTTACTAACAGGCCATGG - Intronic
1037734938 8:21558308-21558330 GCCCCGTTCCTAACAGACCATGG + Intergenic
1037742484 8:21618556-21618578 GCCTGGTTCCTAATAGGCCCTGG - Intergenic
1037923346 8:22824898-22824920 GCCCAGTTCCTAACAGGCCATGG + Intronic
1038243764 8:25834625-25834647 GCCCTGTTCCTAACAGGCCATGG - Intergenic
1038324442 8:26561888-26561910 GCCCAGTTCCTAATAGGCCATGG + Intronic
1038724454 8:30068142-30068164 GCTCAGTTCCTAACAGGCCGTGG - Intronic
1038729782 8:30116587-30116609 GCCCAGTTCCTAATAGGCCATGG + Intronic
1038730824 8:30126168-30126190 GCTCAGTTCCTAACAGGCTGTGG + Intronic
1038745900 8:30254495-30254517 GCCCAGTTCTTAACAGGCCATGG + Intergenic
1039037338 8:33374017-33374039 GCCCGGTTCCTAACAGGCCAGGG - Intronic
1039070727 8:33647248-33647270 GCCCAGTTCCTAACTGGCCATGG + Intergenic
1039618830 8:38978202-38978224 GCCCAGTTCCTAACAGGCCATGG - Intronic
1039748435 8:40454379-40454401 CCCCAGTTCCTAACAGGCCACGG - Intergenic
1039958316 8:42224082-42224104 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1040081366 8:43289335-43289357 GGCCAGTTCCTCACAGTCGGGGG + Intergenic
1040087460 8:43360412-43360434 GCCCAGTTTCTAACAGACCAGGG - Intergenic
1041333620 8:56755192-56755214 GCTCAGTTCCTAACAGGCCAAGG + Intergenic
1041351186 8:56949494-56949516 GCCCAGTGCCTAATGGGCCATGG - Intergenic
1042318602 8:67451178-67451200 GCCCAGTTCCTAGTAAGCCATGG - Intronic
1043005624 8:74814749-74814771 GCCCAGTTCCCAATGGGCCATGG + Intronic
1043347063 8:79310745-79310767 GCCCAGTTACTAACAGGCCATGG + Intergenic
1044569805 8:93704520-93704542 GCCCAGTTCCTAATAGGCCTGGG + Intronic
1045078139 8:98593489-98593511 GCCCAGTTCATAACAGGCCAAGG - Intronic
1045140911 8:99281272-99281294 GCCCAGTTCCTAACAGGCCACGG + Intronic
1045144670 8:99328023-99328045 GCCTGGTTCCTAATAGACCATGG - Intronic
1045531479 8:102989208-102989230 GCCCAGTTCTTAACAGGCCATGG - Intergenic
1045601490 8:103722670-103722692 GCCCAGTTCCTAACAGGTCATGG + Intronic
1045672444 8:104571269-104571291 GCCCACTTCCTAATAGGCCACGG - Intronic
1045946740 8:107805108-107805130 ACCCAGTTCCTAACAGGCCATGG + Intergenic
1046313496 8:112469736-112469758 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1046349296 8:112985572-112985594 GCCCAGTTCCTAACAGGCGAAGG - Intronic
1046759828 8:118009579-118009601 GCCCGGTTCCTAACAGGCCACGG - Intronic
1047177263 8:122553684-122553706 GCCCAGTCCCTAACAGGCCACGG + Intergenic
1047260792 8:123257799-123257821 GCCCAGTTCCTAACAGGTCATGG + Intronic
1047286981 8:123495857-123495879 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1048066083 8:130970180-130970202 GCCCAGTTCCTAACAGGCCGTGG - Intronic
1048140083 8:131785823-131785845 GCCCAGTTCCTTACAGGCCACGG + Intergenic
1048159705 8:132004283-132004305 GCCTGGTTCCTAATAGGCCATGG - Intronic
1048258468 8:132924324-132924346 GCCCAGTTCCTAACAGGCCATGG + Intronic
1048434309 8:134401752-134401774 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1048587028 8:135783610-135783632 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1048779394 8:137985095-137985117 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1048938165 8:139374296-139374318 GCCCGGTTCCTAATAGGCCATGG + Intergenic
1049115612 8:140684431-140684453 GCCCAGTTCCTAACAGACTATGG + Intronic
1050074231 9:1847092-1847114 GCCCAGTTCCCAACAGGCCGGGG + Intergenic
1050127665 9:2376058-2376080 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1050164153 9:2746821-2746843 GCCCAGTTCATAACAGGCCATGG - Intronic
1050424098 9:5496235-5496257 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1050558817 9:6812669-6812691 TCCCTGTTCCTAACAGGCCGCGG + Intronic
1050658973 9:7862302-7862324 GCCCAGTTCCTAACAAGCCAAGG - Intronic
1050663897 9:7913490-7913512 GCCCGGTTCCTAACAGACCACGG + Intergenic
1051063836 9:13077472-13077494 GCCCACTTCCTAACAGACCACGG + Intergenic
1051831908 9:21288715-21288737 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1052699463 9:31920566-31920588 GCCCACTTCCTAACAGGCCATGG - Intergenic
1052715753 9:32114998-32115020 CCCCAGTTCCTAACAGACCATGG + Intergenic
1053136690 9:35655316-35655338 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1053201728 9:36156616-36156638 GCCCAGTTCTTAACAGGCCATGG - Intronic
1055045357 9:71918509-71918531 GCCCAGTTCCTGACAGGCCATGG - Intronic
1055057902 9:72040342-72040364 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1055354930 9:75428064-75428086 GCCCAGTTCCTAACAGGCTAAGG - Intergenic
1055805096 9:80084030-80084052 GCCCAGTGCCTAACAGGCCGGGG + Intergenic
1055965413 9:81860924-81860946 GCCCAGTTCCTAACAGGCCATGG + Intergenic
1056115071 9:83433909-83433931 GCCCGGTTCCTACTGGTCTGTGG + Intronic
1056275080 9:84986528-84986550 GCCCAGTTCCTAACAGGACAGGG + Intronic
1056406062 9:86276351-86276373 GCCCTGTTCCTAACAGGCCATGG + Intronic
1056512685 9:87320756-87320778 GCCCAGTTCCTAACAGTCCATGG + Intergenic
1056566607 9:87778175-87778197 GCCCAGTTCCTAACAGACCATGG + Intergenic
1056706482 9:88956312-88956334 ACCCAGTTCCTAACAGGCCATGG + Intergenic
1056986779 9:91370760-91370782 GCCCGGTTCCTAACAGGCCGTGG + Intergenic
1056993947 9:91437152-91437174 GGCCAGTTCCTAACAGGCCAGGG + Intergenic
1057020641 9:91694653-91694675 ACCCAGTTCCTAACAGGCTGGGG - Intronic
1058000126 9:99856488-99856510 GCCCAGTTCCTAACAGGCCATGG + Intronic
1058043999 9:100336290-100336312 GCCTGGTTCCTAACAGGCCGCGG - Intronic
1058155579 9:101511277-101511299 GCCCAGTTCCTAACAGGCCAAGG + Intronic
1058646102 9:107132709-107132731 GCCCAGTTCCTAACAGGCTGTGG - Intergenic
1058754404 9:108071071-108071093 GCCCAGTTCCTAATAGGACACGG + Intergenic
1059018959 9:110552749-110552771 GCCCAGTTCCTAACAGGCCATGG + Intronic
1059079382 9:111232352-111232374 GCCTGGTTCCTAATAGGCCATGG - Intergenic
1059318059 9:113444023-113444045 ACCCAATTCCTAATGGTCAGTGG + Intergenic
1059377799 9:113899399-113899421 GCCCAGTTCCCAACAGGCCACGG - Intronic
1059996242 9:119913158-119913180 GCTCAGTTCCTAACAGGCCATGG + Intergenic
1060904916 9:127296224-127296246 GCCCAGTTCCTAAGAGGCTATGG + Intronic
1061229409 9:129305498-129305520 GCCCGGTTCCTAACAGGCCATGG + Intergenic
1061976641 9:134071430-134071452 GCCCCGTTCCTAACAGGCCACGG + Intergenic
1062591850 9:137277932-137277954 GCCCAGTTCCTGCCAGTCAGTGG + Intronic
1203528286 Un_GL000213v1:110613-110635 GCCCAGGTCCTAACAGGCCAGGG + Intergenic
1185728183 X:2439900-2439922 GCCCAGTTACTAAAAGGCTGGGG + Intronic
1185785081 X:2884045-2884067 GCCCAGTTCCTAATAGGCCATGG + Intergenic
1185840925 X:3390527-3390549 GCCCAGTTCCTAACAGGCCATGG - Intergenic
1185861620 X:3584706-3584728 GCCCAGTTTCTAACAGGCCAGGG - Intergenic
1185928447 X:4173082-4173104 GCCCAGTTCCTAATGGGCCATGG - Intergenic
1186394145 X:9191121-9191143 GCCCGGTTCCTAACAGGCCACGG - Intergenic
1186577416 X:10781007-10781029 GCCCAGTTCCTAACAGGCCATGG + Intronic
1186615102 X:11177916-11177938 GCACAGTTCCTAAAAGTGCATGG - Intronic
1187013902 X:15307596-15307618 GCCCAGTTCCTAACAGGCCATGG + Intronic
1187014111 X:15308851-15308873 GCCCGGTTCCTAACAGGCCACGG - Intronic
1188741625 X:33790535-33790557 GTCCAGTTCCTAACAGGCCATGG - Intergenic
1189344231 X:40228387-40228409 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1189749855 X:44209688-44209710 GCCCAGTTCCTAACAGGCCACGG - Intronic
1190037612 X:47040283-47040305 GCCCGGTTCCTAACAGGCCATGG - Intronic
1190097295 X:47491953-47491975 GCCCAGTTCCTAACAGGCCTTGG + Intergenic
1190261014 X:48796854-48796876 GACCAATTCCTAATAGGCCATGG - Intergenic
1190379026 X:49820069-49820091 GCCCAGTTCCTAACAGGTCACGG - Intergenic
1190434764 X:50412873-50412895 GCCTGGTTCCTAATAGGCCATGG - Intronic
1190813417 X:53906973-53906995 GCCCAGTTCCTAACAGGCCACGG + Intergenic
1190951586 X:55150512-55150534 GCCTGGTTCCTAAGAGGCCGTGG + Intronic
1192156281 X:68748932-68748954 GCCCGGTTCCTAACAGGCCATGG - Intergenic
1192683597 X:73280578-73280600 GCCCAGTTCCTAACAGGTCATGG + Intergenic
1194592443 X:95815889-95815911 GCCCAGTTCCTAACAGGCTATGG + Intergenic
1195219193 X:102730383-102730405 ACCCAGTTCCTAACAGGCCATGG + Intronic
1195341934 X:103915028-103915050 GCCCGGTTCCTAACAGGCCACGG + Intergenic
1196032711 X:111108428-111108450 GCCCAGTTCCTAACAGACTGTGG - Intronic
1197840849 X:130744806-130744828 GCCCAGTTCCTAACAGGCCACGG - Intronic
1199283957 X:146035753-146035775 GCCTAGTTCCTAACAGGCCACGG - Intergenic
1199659927 X:150038566-150038588 GGCCAGTTCCTAACAGGCCACGG + Intergenic
1199739988 X:150726064-150726086 GCCCCGTTCCTAACAGGCCATGG - Intronic
1200802909 Y:7402553-7402575 GCCCAGTTTCTAACAGGCCAGGG + Intergenic
1201326447 Y:12765468-12765490 GCCCAGTTCTTAACAGGCCAGGG - Intronic
1201398638 Y:13577780-13577802 GCCCAGTTCCTAACATGCCAGGG - Intergenic
1201514544 Y:14804974-14804996 ACCCAGTTCCTAAAAGGCCATGG + Intronic