ID: 920587288

View in Genome Browser
Species Human (GRCh38)
Location 1:207178811-207178833
Sequence CCTGCCACACAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920587284_920587288 3 Left 920587284 1:207178785-207178807 CCCTATTTCTGTTGACGGGGAGA No data
Right 920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG No data
920587285_920587288 2 Left 920587285 1:207178786-207178808 CCTATTTCTGTTGACGGGGAGAG No data
Right 920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920587288 Original CRISPR CCTGCCACACAGATGGCACA TGG Intergenic
No off target data available for this crispr