ID: 920592395

View in Genome Browser
Species Human (GRCh38)
Location 1:207232909-207232931
Sequence GTACACTCCTTACCTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920592390_920592395 1 Left 920592390 1:207232885-207232907 CCTGGCTGATATAGCCCACACCC No data
Right 920592395 1:207232909-207232931 GTACACTCCTTACCTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920592395 Original CRISPR GTACACTCCTTACCTAACAC TGG Intergenic
No off target data available for this crispr