ID: 920596827

View in Genome Browser
Species Human (GRCh38)
Location 1:207280192-207280214
Sequence AGGGAGAGCACAGTTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920596827_920596841 25 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG No data
920596827_920596837 14 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596837 1:207280229-207280251 GTGGCTGCTGCCTGAAGAAGGGG No data
920596827_920596835 12 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596835 1:207280227-207280249 ATGTGGCTGCTGCCTGAAGAAGG No data
920596827_920596843 29 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596843 1:207280244-207280266 AGAAGGGGATGAAGGAGGGGTGG No data
920596827_920596829 -5 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596829 1:207280210-207280232 TCCCTCCTCCACACACCATGTGG No data
920596827_920596842 26 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596842 1:207280241-207280263 TGAAGAAGGGGATGAAGGAGGGG No data
920596827_920596838 21 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596838 1:207280236-207280258 CTGCCTGAAGAAGGGGATGAAGG No data
920596827_920596836 13 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596836 1:207280228-207280250 TGTGGCTGCTGCCTGAAGAAGGG No data
920596827_920596840 24 Left 920596827 1:207280192-207280214 CCCACAGTAACTGTGCTCTCCCT No data
Right 920596840 1:207280239-207280261 CCTGAAGAAGGGGATGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920596827 Original CRISPR AGGGAGAGCACAGTTACTGT GGG (reversed) Intergenic