ID: 920597164

View in Genome Browser
Species Human (GRCh38)
Location 1:207283696-207283718
Sequence CCATACAGTGAGAGTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920597164_920597167 11 Left 920597164 1:207283696-207283718 CCTCACTCACTCTCACTGTATGG No data
Right 920597167 1:207283730-207283752 TTATGTTTATTAATCATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920597164 Original CRISPR CCATACAGTGAGAGTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr