ID: 920600759

View in Genome Browser
Species Human (GRCh38)
Location 1:207321737-207321759
Sequence GGCGCGTCCTTGTTCTAACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 14}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920600752_920600759 13 Left 920600752 1:207321701-207321723 CCGCTGGGCGTAGCTGCGACTCG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 920600759 1:207321737-207321759 GGCGCGTCCTTGTTCTAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 14
920600751_920600759 17 Left 920600751 1:207321697-207321719 CCGGCCGCTGGGCGTAGCTGCGA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 920600759 1:207321737-207321759 GGCGCGTCCTTGTTCTAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920600759 Original CRISPR GGCGCGTCCTTGTTCTAACC CGG Exonic
915955236 1:160215324-160215346 TGCACGGCCTTGTTCTAACCCGG + Exonic
915955624 1:160217740-160217762 GGCTTGTCCTTGTTCCATCCAGG - Intronic
920600759 1:207321737-207321759 GGCGCGTCCTTGTTCTAACCCGG + Exonic
1065146386 10:22772444-22772466 GGCGCCACCTTGCTCTAATCTGG - Intergenic
1069441488 10:68432822-68432844 GGCTCTTCCTTCCTCTAACCTGG + Intronic
1143051660 17:4130993-4131015 GGGGCGTGCCTTTTCTAACCCGG + Intronic
1144749191 17:17636619-17636641 AGCCCGTCCTTGTTATAAACTGG + Intergenic
1148452568 17:47789748-47789770 GGCGCGTCTTTGTTCCGTCCAGG + Intergenic
935634096 2:105236865-105236887 GGCTCGTCCTTGTTCCCACGTGG - Intergenic
1182418887 22:30239032-30239054 GGCGCGACCTTGGCCTCACCTGG - Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184823980 22:46934654-46934676 GGCGCGTCCATGCTCTAGCCCGG + Intronic
1003682360 6:8268701-8268723 GGCGGGTCCTTCTTGTGACCTGG - Intergenic
1031746608 7:125506225-125506247 GGCCAGTCCTAGTGCTAACCTGG - Intergenic
1033875313 7:145810541-145810563 GGTGAGTCCTAGTTCTGACCTGG + Intergenic
1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG + Intergenic
1195716668 X:107825551-107825573 GCCTCTTTCTTGTTCTAACCTGG + Intergenic