ID: 920601801

View in Genome Browser
Species Human (GRCh38)
Location 1:207333134-207333156
Sequence TCTCAGAACCTGATGGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920601798_920601801 7 Left 920601798 1:207333104-207333126 CCCAGAGCTTCTAAAGTACAAAA 0: 1
1: 0
2: 0
3: 27
4: 396
Right 920601801 1:207333134-207333156 TCTCAGAACCTGATGGTATTTGG 0: 1
1: 0
2: 4
3: 32
4: 373
920601799_920601801 6 Left 920601799 1:207333105-207333127 CCAGAGCTTCTAAAGTACAAAAT 0: 1
1: 0
2: 0
3: 14
4: 227
Right 920601801 1:207333134-207333156 TCTCAGAACCTGATGGTATTTGG 0: 1
1: 0
2: 4
3: 32
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920601801 Original CRISPR TCTCAGAACCTGATGGTATT TGG Intronic
900713511 1:4129693-4129715 TCTCAGTCCCTCATGGCATTGGG + Intergenic
901243691 1:7711299-7711321 ACTCCCAACGTGATGGTATTAGG - Intronic
904204966 1:28848273-28848295 ACTCCCAACGTGATGGTATTGGG - Intronic
904984517 1:34533940-34533962 TCTCAGAACGTGACTTTATTTGG - Intergenic
907289611 1:53404826-53404848 ACTCCCAACGTGATGGTATTTGG - Intergenic
907669045 1:56458594-56458616 TCTCAGAGCATGATCTTATTTGG + Intergenic
907776617 1:57522141-57522163 TCTCAGAAAGAGCTGGTATTTGG + Intronic
908029544 1:59985226-59985248 CCTCAGAACATGATCTTATTTGG + Intergenic
908031795 1:60008460-60008482 TCTCAAAATCTGACTGTATTTGG + Intronic
908721749 1:67133597-67133619 TCTCAGACTGTGATTGTATTTGG + Intronic
908804321 1:67914632-67914654 TCTCAGACCATGACTGTATTTGG + Intergenic
909845026 1:80382541-80382563 TCTCAGAACGTGACTGTATTTGG + Intergenic
910286258 1:85557679-85557701 TCTCAGAATGTGATTGTATTTGG + Intronic
910475020 1:87597213-87597235 CCTCAGAACGTGATTGTATTTGG + Intergenic
911320571 1:96409216-96409238 TCTCAGTACCTGATGGTTATGGG + Intergenic
911998505 1:104798786-104798808 TCTCAGAATGTGACTGTATTTGG + Intergenic
912249661 1:107997770-107997792 TCTCAGAAACTCCTGGGATTTGG + Intergenic
915597509 1:156904002-156904024 TCCCAGAAGCTGCAGGTATTGGG - Exonic
915921764 1:159981095-159981117 TCTCGGAATGTGATTGTATTTGG + Intergenic
916525390 1:165604462-165604484 CCTCAGAATGTGATTGTATTTGG + Intergenic
917707813 1:177652287-177652309 TCTCAGAAAATGATAGTCTTAGG - Intergenic
919026904 1:192183869-192183891 TCTCAAAAGCAGATGCTATTAGG - Intronic
919740929 1:200981234-200981256 TCTCAGACCTTGGTGGAATTTGG - Intronic
920446941 1:206024807-206024829 CCTCAGAACGTGACTGTATTTGG - Intergenic
920601801 1:207333134-207333156 TCTCAGAACCTGATGGTATTTGG + Intronic
921458736 1:215403889-215403911 TCTCAAAACATGACTGTATTTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923432450 1:233936437-233936459 TCTCAGAACAAGAGGGTAGTGGG + Intronic
923574925 1:235149718-235149740 TCTCAGTACCTGGTTGCATTTGG - Intronic
924215627 1:241818628-241818650 TTTCAGTACTTTATGGTATTCGG - Intergenic
924627695 1:245709556-245709578 TCTCAGGACCTCATGGGATGAGG + Intergenic
1064006613 10:11704032-11704054 CCTCAGAACCTGCGGTTATTTGG + Intergenic
1064136463 10:12754879-12754901 CCTCAGAATCTGACTGTATTTGG - Intronic
1064314817 10:14245559-14245581 CCTCAGAACGTGAATGTATTTGG + Intronic
1064362904 10:14681691-14681713 TCCCAGAACCTCATGGAATGGGG + Intronic
1064554766 10:16537397-16537419 GCTCAGAATGTGATTGTATTTGG + Intergenic
1064936323 10:20682836-20682858 CCCCAGAATGTGATGGTATTTGG + Intergenic
1065002864 10:21352876-21352898 TCTCAGAATGTGATTATATTTGG - Intergenic
1065264623 10:23962019-23962041 TCTCAGAATATGACTGTATTTGG - Intronic
1065393998 10:25214642-25214664 TCTCAGAATGTGATTGTATTTGG + Intronic
1065801022 10:29352466-29352488 CCTCAGAATGTGATGTTATTTGG + Intergenic
1065819955 10:29516515-29516537 TCTCAGAGCCTGGTGGTCTGCGG - Intronic
1065952965 10:30668370-30668392 TCTCAGAGCCTGGTGGTCTGCGG + Intergenic
1066160497 10:32722713-32722735 TCTCAGAATGTGATCTTATTTGG - Intronic
1066964339 10:42247910-42247932 GCTCATAAGCTGTTGGTATTAGG - Intergenic
1067788264 10:49268494-49268516 TCTCAGAATGTGACCGTATTTGG - Intergenic
1067975429 10:51019525-51019547 TCTAAGAGCCTTATGGTTTTAGG - Intronic
1068025062 10:51632358-51632380 ACTCAGAAACTCTTGGTATTTGG + Intronic
1069397033 10:68000620-68000642 TCTCAGAATATGATCTTATTTGG + Intronic
1070503917 10:77096500-77096522 TCGCAGAACCTGATCGCAGTAGG - Intronic
1071096623 10:81982800-81982822 TCTCAGAATGTGACTGTATTTGG - Intronic
1071175370 10:82920290-82920312 TTTAAGAAACTGATGGTAGTTGG + Intronic
1071754054 10:88515865-88515887 TCTCAGAATGTGACTGTATTAGG + Intronic
1072876058 10:99174705-99174727 CCTGAGAACATGATTGTATTTGG + Intronic
1073493029 10:103867458-103867480 TCTCAGAATGTGAATGTATTTGG + Intergenic
1073546001 10:104349534-104349556 CTTCAGAATGTGATGGTATTTGG - Intergenic
1075064329 10:119279288-119279310 CCTCAGAACATGACTGTATTTGG - Intronic
1075327518 10:121546270-121546292 TCTCAGAGCCTGAAGGGATCAGG + Intronic
1075902617 10:126055203-126055225 TCCCAGAACCAGCTGGGATTTGG - Intronic
1076165395 10:128278407-128278429 GCTCAGAAAGTGATGGCATTTGG + Intergenic
1078725324 11:13924990-13925012 TCTCAGGACCTCATGGTTCTAGG + Intergenic
1079454981 11:20628556-20628578 TCTCATAACGTGACTGTATTTGG - Intronic
1080571698 11:33563012-33563034 CCTCAGAACGTGACTGTATTTGG - Intronic
1080574230 11:33583647-33583669 TCTCAGGACCTGATGGTTTGTGG + Intronic
1080580427 11:33637847-33637869 TCTCAGAATGTGACTGTATTTGG - Intronic
1080900797 11:36488683-36488705 TCTCAGAACCTGCAGTTGTTAGG + Exonic
1082867718 11:57914854-57914876 CCTCAGAATGTGATGGCATTTGG - Intergenic
1085753842 11:79187653-79187675 CCTCAGAATCTGATTGTATTTGG + Intronic
1085788298 11:79474259-79474281 TCTCAGAATGTGATTGTATTTGG + Intergenic
1085832668 11:79918148-79918170 TCTGAGAACGTGACTGTATTTGG - Intergenic
1085857104 11:80187618-80187640 TGTTAGAACCTGACTGTATTTGG - Intergenic
1086852440 11:91825801-91825823 CCTCAGAATGTGATAGTATTTGG - Intergenic
1086878488 11:92126627-92126649 ACCCACAACTTGATGGTATTTGG - Intergenic
1087698370 11:101407271-101407293 ACTCTGAAGGTGATGGTATTAGG - Intergenic
1088354987 11:108933590-108933612 TCTCAGAGCCTGAAGTTATTGGG + Intronic
1088363055 11:109011302-109011324 TCTCAGAATGTGACAGTATTTGG + Intergenic
1090254550 11:125274292-125274314 TTTCAGAACCTTATGGTCTCGGG + Intronic
1090644458 11:128756462-128756484 ACTCAGAATGTGATTGTATTTGG - Intronic
1090808040 11:130215133-130215155 TCTCACAACCTGAAGGTCTCTGG - Intergenic
1091225313 11:133953594-133953616 ACTCAGATCCTGCTGGTAGTTGG - Intronic
1092120434 12:6039881-6039903 TCTCCCAAACTGCTGGTATTAGG - Intronic
1093091536 12:14926648-14926670 TCTCAGAACCTAATATTAATTGG + Intronic
1093172897 12:15879036-15879058 TCTCAGAATGTGACTGTATTTGG - Intronic
1093540661 12:20280372-20280394 TCTCAGAATGTGACTGTATTTGG - Intergenic
1093637197 12:21485241-21485263 TCTAAAAGCCTGATTGTATTTGG - Intronic
1095598470 12:43987035-43987057 TCTCAGAATGTGATTATATTTGG + Intronic
1097717186 12:62979479-62979501 TCTCAGAATGTGACTGTATTTGG - Intergenic
1097945221 12:65360186-65360208 TCTCAGAATGTGACTGTATTTGG - Intronic
1100366602 12:93926989-93927011 TCTCAGAATGTGACTGTATTTGG + Intergenic
1101956943 12:109220301-109220323 TCTCTGCACCTGATGGTATTTGG + Intronic
1102247637 12:111365316-111365338 TCTCAGAGCCTGGTGGAATGAGG + Intronic
1102746692 12:115255198-115255220 TCTCAAGACCTGATGGGAGTAGG - Intergenic
1102793392 12:115667327-115667349 AGTCAGCTCCTGATGGTATTTGG - Intergenic
1103130869 12:118467396-118467418 TCTCAGAATGTGAAAGTATTTGG - Intergenic
1103136758 12:118514173-118514195 TGTCAGAATCTGAAGGAATTAGG + Intergenic
1103149020 12:118620885-118620907 CCTCAGAACGTGACGTTATTTGG + Intergenic
1103679886 12:122685019-122685041 TCTCAGAATGTGACTGTATTTGG - Intergenic
1104591678 12:130088922-130088944 TCTCAGAATCTGACCATATTTGG - Intergenic
1104654191 12:130560891-130560913 CCTCAGAACATGATGTTCTTTGG + Intronic
1104793507 12:131499314-131499336 TCACAGATCCTGATGTAATTGGG + Intergenic
1106106908 13:26741372-26741394 TCTAAGACCCTGATGGTGGTAGG - Intergenic
1109767793 13:66927818-66927840 CCTCAGAAGCTGACTGTATTTGG - Intronic
1110134427 13:72047942-72047964 TCTCAGAATGTGATTGTATTTGG - Intergenic
1110759539 13:79216128-79216150 ACTCTCAATCTGATGGTATTAGG - Intergenic
1112364524 13:98745431-98745453 TCTCAGAACTTGACCTTATTTGG + Intronic
1112473281 13:99708746-99708768 ACTCAGAATGTGATTGTATTTGG + Intronic
1114177975 14:20340883-20340905 TCTCAGAATCTGCCTGTATTTGG + Intergenic
1115781052 14:36768627-36768649 TCACAGAACCTGAAGAGATTTGG - Intronic
1115944751 14:38646969-38646991 ACTCACAATGTGATGGTATTTGG + Intergenic
1119129718 14:72160551-72160573 TCTCAGAATGTGACTGTATTTGG + Intronic
1119608822 14:76044487-76044509 TCTCAGAACCTAGTCGTTTTGGG + Intronic
1120375477 14:83700240-83700262 TGTGGGAACCTTATGGTATTTGG - Intergenic
1120821056 14:88912275-88912297 TCTCAGAACGTAATCATATTTGG + Intergenic
1121131197 14:91448985-91449007 CCTCAGAATGTGATGGTATTTGG - Intergenic
1121147829 14:91600985-91601007 TCTGAGAACTAAATGGTATTTGG + Intronic
1121227354 14:92330849-92330871 ACTCACAATGTGATGGTATTTGG - Intronic
1121329567 14:93041404-93041426 TCCCAGAACCTGCTGGTCTCTGG - Intronic
1121455484 14:94036143-94036165 TCTCTGAGCAGGATGGTATTGGG + Intronic
1122095399 14:99366793-99366815 CCTCAGAGTGTGATGGTATTTGG - Intergenic
1124085091 15:26542157-26542179 TCTCATAACCAGCTGGTTTTAGG - Intergenic
1124352576 15:28968692-28968714 TCTCAGAACCTGCCCTTATTTGG + Intronic
1124616621 15:31246868-31246890 TCTCAGAATTTGAATGTATTTGG - Intergenic
1127350067 15:58142342-58142364 TCTCATCAAATGATGGTATTAGG - Intronic
1130386573 15:83417275-83417297 TCTCAGAAAATGACTGTATTTGG - Intergenic
1130726190 15:86442035-86442057 TCTCAGTTCCTGAGGGTATTGGG - Intronic
1131452103 15:92550244-92550266 TCTCAGAACATGATTTTATTTGG + Intergenic
1131630869 15:94175706-94175728 TCTCAGAATGTGACTGTATTTGG + Intergenic
1134775839 16:16852725-16852747 TTTCAGAATGTGATGATATTTGG + Intergenic
1134854676 16:17508468-17508490 TCTCAGATCATGACTGTATTTGG + Intergenic
1135087450 16:19486773-19486795 TCTCAGAATGTGACTGTATTTGG - Intronic
1135820484 16:25680860-25680882 TCTCAGAATGTGACCGTATTTGG - Intergenic
1136624192 16:31451814-31451836 TGGCAGAACCTGATAGGATTAGG - Intergenic
1138732851 16:59215134-59215156 TCTCAGAAATTGGTGGTGTTGGG - Intergenic
1140144377 16:72291423-72291445 TCTCAGAATGTGATCTTATTTGG - Intergenic
1140966547 16:79971898-79971920 ACTCAAAACCTTATGGAATTTGG + Intergenic
1140997955 16:80279381-80279403 TCTCAGAAACTGATGGATTGAGG - Intergenic
1142089518 16:88202602-88202624 TCTCAGAACCTGAGGCTCTGGGG + Intergenic
1144075290 17:11714025-11714047 TCTCATAACCAGTTGGTATAAGG + Intronic
1144154989 17:12491625-12491647 TCTCAGAATGTGACTGTATTTGG + Intergenic
1144430469 17:15186760-15186782 TCTCAGAATGTGATTATATTTGG + Intergenic
1146079780 17:29768758-29768780 TCTAGGACACTGATGGTATTAGG - Intronic
1146089107 17:29858438-29858460 TCTCAGAATGTGGTTGTATTTGG + Intronic
1146997552 17:37334317-37334339 TTTAAGAACCTGTTGATATTTGG - Intronic
1147417197 17:40300891-40300913 TCTCAGAAGTTGATGGTAACAGG + Exonic
1150632107 17:66887059-66887081 CCTCAGAACATGACTGTATTTGG - Intergenic
1151159978 17:72157127-72157149 TCTCAGAATGTGATTGTATTTGG + Intergenic
1151861801 17:76769486-76769508 CCCCAAAACATGATGGTATTTGG - Intronic
1151983993 17:77530224-77530246 TCTCAGGATATGATTGTATTTGG + Intergenic
1152269214 17:79313898-79313920 TTTCAGAGGCTGAAGGTATTTGG - Intronic
1153354096 18:4116973-4116995 TCTCAGAATGTGACTGTATTTGG + Intronic
1155699039 18:28720421-28720443 TATCTGAACCTCATGGTTTTGGG - Intergenic
1156413028 18:36854028-36854050 TCTCAGAAGGTGATTGTGTTTGG + Intronic
1157407997 18:47439968-47439990 TCTCAGATCCTGAATGTCTTTGG + Intergenic
1157709356 18:49839211-49839233 ACTCAGCACCTGACGGTATTCGG + Exonic
1157803245 18:50637935-50637957 ACTCAGAATGTGATTGTATTTGG - Intronic
1158309587 18:56144081-56144103 CCTCAGAATTTGATGCTATTTGG - Intergenic
1158480241 18:57815468-57815490 TCACAGATCCTGATATTATTTGG + Intergenic
1159814581 18:73057326-73057348 ACTCAGAATGTGATGGTATTTGG + Intergenic
1163360050 19:16840199-16840221 CCTCAGAACGTGACTGTATTTGG + Intronic
1163451052 19:17377612-17377634 TCTCAGTACCTGCTGTGATTAGG + Intergenic
1163628635 19:18405078-18405100 TCTGAGGACCTGAGGGTGTTGGG - Intergenic
1165174391 19:33916747-33916769 TCTCAGAATGTGAGGGTATTTGG + Intergenic
1165240612 19:34463860-34463882 TCTCAGAATCTGATTGTATTTGG - Intronic
1167340305 19:48911779-48911801 TCTCAGAATGTGATCTTATTTGG - Intronic
1168080592 19:54007373-54007395 CCTCAGAACATGACTGTATTTGG - Intronic
1168252490 19:55148460-55148482 TCTCAGAATCTGTGGGTATTGGG - Intronic
1168265156 19:55219317-55219339 CCTCAGAATGTGATTGTATTTGG - Intergenic
926364534 2:12121189-12121211 GCACAGCACCTGATGGTTTTGGG - Intergenic
927540047 2:23901023-23901045 TATCAGAATCAGATGGAATTTGG - Intronic
928613272 2:33011381-33011403 TCTCAGAATGTGAGTGTATTTGG + Intronic
929079140 2:38105386-38105408 CCTCAGAACATAATTGTATTTGG + Intronic
929247036 2:39713440-39713462 CCTCAGAACGTGACAGTATTTGG + Intronic
929326196 2:40614320-40614342 ACTCACAATGTGATGGTATTAGG - Intergenic
929687303 2:44045784-44045806 TCTCAGAATGTGATGGTATTTGG + Intergenic
931914341 2:66936567-66936589 TCACAAAATCTGATGGTATAAGG + Intergenic
932633445 2:73367163-73367185 TCTCAGTACCTGAGTTTATTAGG - Intergenic
933632388 2:84672819-84672841 TCTCAGAATGTGACTGTATTTGG - Intronic
935581538 2:104759928-104759950 TCTCAAAACTTGATAATATTGGG - Intergenic
936980797 2:118263415-118263437 CCTCAGAACGTGATCTTATTTGG + Intergenic
937051496 2:118895064-118895086 CCTCAGAACATGACTGTATTTGG - Intergenic
937240447 2:120457792-120457814 CCTCCTAACATGATGGTATTAGG + Intergenic
939425532 2:142031781-142031803 TCTCAGAATCTGATCTTATTTGG + Intronic
939814371 2:146875786-146875808 TCTCCCAACGTGATAGTATTTGG + Intergenic
940985077 2:160044537-160044559 TCTCAGAATTTAAAGGTATTGGG - Intronic
941855078 2:170222712-170222734 TCTCAGAACGTGAACTTATTTGG - Intronic
942526605 2:176859968-176859990 CCTCAGAACGTGACTGTATTTGG - Intergenic
942567739 2:177283228-177283250 ACTTAGGACCTGATTGTATTGGG - Intronic
942667435 2:178334909-178334931 TTTCAGAACTGGTTGGTATTAGG - Intronic
942674237 2:178410887-178410909 TCTCAGAATGTGACTGTATTTGG - Intergenic
943762479 2:191624941-191624963 TCTCAGAATATGATTGTATTTGG - Intergenic
943894264 2:193333232-193333254 TCTCAGAATGTGATCTTATTTGG + Intergenic
943978675 2:194517136-194517158 AGTGAGAAACTGATGGTATTTGG - Intergenic
944663402 2:201939678-201939700 TCTGTGAACCTGCTGGTGTTGGG - Intergenic
945395503 2:209310773-209310795 TCTCAGAATGTGACTGTATTTGG + Intergenic
945805647 2:214486936-214486958 TCTCAGAATGTGATTGTGTTTGG + Intronic
946461789 2:219875496-219875518 TCTCAGAACCTCCTGGGACTAGG - Intergenic
947140177 2:227013372-227013394 TCTCAGAATGTGACTGTATTTGG + Intronic
947922757 2:233892631-233892653 CCTCAGAACATGACTGTATTTGG - Intergenic
1170059308 20:12242902-12242924 CCTCAGAACGTGATCTTATTTGG + Intergenic
1171494698 20:25547720-25547742 CCTCAGAATGTGATTGTATTTGG - Intronic
1173597259 20:44266825-44266847 TCTCAGAATGTGACTGTATTTGG - Intronic
1175202966 20:57290650-57290672 TCTCAGAATGTGACGTTATTTGG - Intergenic
1177422214 21:20874580-20874602 TCTCAGAATGTGATCTTATTTGG - Intergenic
1177668919 21:24200009-24200031 TCTCAGAATCTGACTGTGTTTGG + Intergenic
1178077727 21:29027561-29027583 TCTCAGAACTTGATACTCTTAGG - Intronic
1178272729 21:31207689-31207711 TTTCAGAAATTGATGGTCTTTGG - Intronic
1178402183 21:32296257-32296279 TCTCAGAATGTGACTGTATTTGG - Intronic
1179098680 21:38337567-38337589 CCTCCGAATGTGATGGTATTTGG - Intergenic
1180055235 21:45355293-45355315 TCTCAGAAGGTGACTGTATTTGG + Intergenic
1180154484 21:45971404-45971426 CCTCAGATCCTGATGCTTTTGGG + Intergenic
1180200814 21:46222988-46223010 TCTCAGACCCTGGTGGTCATGGG - Intronic
1182093464 22:27611423-27611445 TTGCAGAACCTGAAGGTAATGGG + Intergenic
1182425665 22:30270745-30270767 TGTCAGAACGTGACTGTATTTGG - Intergenic
1182636612 22:31732744-31732766 TCTGAAAACCTGCTGGTTTTGGG + Intronic
1183210657 22:36449357-36449379 GCTCAGAACCTGAAGGACTTGGG + Intergenic
1183503847 22:38197672-38197694 TCTCAGAATGTGACTGTATTTGG - Intronic
1185187948 22:49414112-49414134 TCTCAGAACGTCACTGTATTTGG - Intergenic
949852764 3:8435524-8435546 TCTCAGAATCTGACCTTATTTGG + Intergenic
952838674 3:37626220-37626242 TGTCAGAACCTGATGTAGTTGGG + Intronic
955168227 3:56536321-56536343 TCTCAGAATGTGACTGTATTTGG - Intergenic
955973404 3:64458314-64458336 TCTCAGAACGTGACTGTATCTGG + Intergenic
958621142 3:96562724-96562746 CCTCAGAATATGATTGTATTTGG + Intergenic
958891317 3:99786293-99786315 CCTCCGAAAGTGATGGTATTAGG + Intronic
958940719 3:100310246-100310268 TCTCAGAATGTGACTGTATTTGG - Intronic
958966379 3:100563348-100563370 TCTCTGAATGTGATTGTATTTGG - Intronic
959147382 3:102565363-102565385 TCTCACAATGTGATTGTATTTGG - Intergenic
959187225 3:103059684-103059706 TCTCTGAATCTGATTATATTGGG + Intergenic
959246475 3:103876447-103876469 TCTCAGAATGTGACCGTATTTGG + Intergenic
961435055 3:126911247-126911269 TCTCAGAACCTTCTGGCACTTGG + Intronic
961730017 3:128958147-128958169 TCTCAGAATGTGATCTTATTTGG - Intronic
961959710 3:130842345-130842367 CCTCAGAATGTGATGTTATTTGG + Intergenic
962896019 3:139715488-139715510 CCTCAGAATCTGACTGTATTTGG + Intergenic
963995798 3:151707085-151707107 TCTCAAAACATGCTGGTATCTGG + Intergenic
965509581 3:169553914-169553936 TCTCAGAATATGACTGTATTTGG - Intronic
965806577 3:172548354-172548376 TCTCAGAATGTGACTGTATTTGG + Intergenic
966282872 3:178255099-178255121 TCTCTAAATGTGATGGTATTAGG + Intergenic
966577784 3:181522258-181522280 TCCCCCAACGTGATGGTATTTGG - Intergenic
967465538 3:189801923-189801945 TCTCAAAACCAGATTTTATTAGG - Intronic
967568049 3:190994095-190994117 TCTCAGAAAGCAATGGTATTGGG - Intergenic
970682045 4:18520559-18520581 ATTCACAACATGATGGTATTTGG - Intergenic
970892366 4:21061769-21061791 TCTCAGAATGTGACTGTATTTGG + Intronic
972365717 4:38372537-38372559 TCTCGGAATGTGATGTTATTTGG + Intergenic
975286319 4:72625508-72625530 CCTCAGAACATGATCTTATTTGG + Intergenic
975922643 4:79410692-79410714 ACTCAAAACCTAATGGAATTAGG - Intergenic
976803307 4:89018161-89018183 CCTCAGAATGTGATTGTATTTGG + Intronic
976885711 4:89981094-89981116 TCTCAGAATGTGATTGTGTTAGG + Intergenic
977363891 4:96041966-96041988 TCTCAGAATGTGATCATATTTGG + Intergenic
977372444 4:96156466-96156488 CCTCAGAATGTGATAGTATTTGG + Intergenic
978937561 4:114396540-114396562 CCTCAGACCATGATGTTATTTGG + Intergenic
979616533 4:122748772-122748794 TCTCAGAATGTGACTGTATTTGG - Intergenic
980852260 4:138396942-138396964 TCTCCTAATGTGATGGTATTAGG + Intergenic
980996703 4:139785989-139786011 TCTCAGAATGTGACTGTATTTGG + Intronic
981353755 4:143763210-143763232 TCTTAGAAGGTGATTGTATTTGG - Intergenic
981497635 4:145411752-145411774 TCTCAGAACCTGGCTATATTTGG + Intergenic
982112745 4:152071700-152071722 TTTCAGAACCTGAGGGTTGTAGG - Intergenic
982599578 4:157429923-157429945 CCTCAGAACGTGACTGTATTTGG - Intergenic
982882881 4:160742320-160742342 TCTCAGAATGTGACTGTATTTGG + Intergenic
983454717 4:167948770-167948792 TCTCAGAACCTCCTGGAGTTTGG + Intergenic
984311509 4:178066645-178066667 TCTCAGAAGCTGTTTGTACTAGG + Intergenic
984539312 4:181018064-181018086 TCTCAGAATGTCATTGTATTTGG + Intergenic
985698584 5:1357322-1357344 CCTCAGAATGTGACGGTATTTGG - Intergenic
987033048 5:13993416-13993438 TCTCAGAATCTTTGGGTATTGGG - Intergenic
987081816 5:14431985-14432007 TCTCAGAATGTGACTGTATTTGG - Intronic
987910575 5:24138939-24138961 TCCCAGAAGCTGAAGGAATTTGG + Intronic
988139975 5:27224994-27225016 TCTCAGAATGTGACTGTATTTGG - Intergenic
988721201 5:33881035-33881057 TCTGTGAACCTGTTGGTAGTAGG + Intronic
988998914 5:36741091-36741113 TCTCAGAATATGACTGTATTTGG - Intergenic
989384897 5:40845409-40845431 CCTCAGAATGTGATGTTATTTGG - Intronic
989603459 5:43221565-43221587 TCTCTGAACCTGTTCTTATTCGG - Intronic
990791407 5:59484110-59484132 TCTCAGTAGTTGATGATATTGGG - Intronic
991529173 5:67596396-67596418 TCTGAGAATGTGATAGTATTGGG - Intergenic
992022810 5:72641182-72641204 TCTCTGAACCTGTTCTTATTTGG - Intergenic
992523984 5:77587672-77587694 CCTCAGAATGTGATTGTATTTGG + Intronic
992581125 5:78177614-78177636 CCTCAGAATCTGATCTTATTTGG + Intronic
992708833 5:79428184-79428206 CCTCAGAACTTGATGGCTTTAGG - Intronic
993061337 5:83042558-83042580 TCTCAGCACCTGGTGATTTTGGG - Intergenic
993140837 5:84031176-84031198 TCTCAGAATGTGATTATATTTGG - Intronic
993724976 5:91356473-91356495 TGTGAGAACAAGATGGTATTTGG - Intergenic
994282511 5:97922377-97922399 GTTCAGAATGTGATGGTATTTGG - Intergenic
994565017 5:101433396-101433418 TCTTATAACCTGATGGTAATTGG + Intergenic
995105014 5:108367178-108367200 TTTTAAAACTTGATGGTATTTGG - Intronic
995400774 5:111738775-111738797 CCTCAGAATGTGATTGTATTTGG + Intronic
996381919 5:122870996-122871018 TCAGAGAATCTGATGGTCTTGGG + Intronic
996613844 5:125415666-125415688 CCTCAGAACATTATTGTATTTGG - Intergenic
999122757 5:149221898-149221920 TCTTAGAACAGGAGGGTATTTGG - Intronic
999378539 5:151103931-151103953 ACTCAGAACATGATGTAATTTGG + Intronic
999740258 5:154544458-154544480 TCTCAGAATGTGACTGTATTTGG + Intergenic
999902678 5:156102577-156102599 TCTCAGAAACTGCTAGAATTTGG - Intronic
1000614365 5:163411316-163411338 TCTGCGAACATGATGTTATTTGG + Intergenic
1003311264 6:4971780-4971802 TCTCAGAATGTGACTGTATTTGG - Intergenic
1005633545 6:27732052-27732074 TTTAAAAACCTGATGGTAGTGGG - Intergenic
1005838932 6:29727825-29727847 GCTCAGAACCTCAGGGTATGGGG - Intronic
1005906723 6:30267675-30267697 TCTCAGAACTTGTTTGTATAGGG + Intergenic
1006915742 6:37592864-37592886 TCTCAGAATGTGATCTTATTTGG - Intergenic
1007939895 6:45770578-45770600 TCTCAGAATATGACTGTATTCGG - Intergenic
1008773920 6:55011396-55011418 TCTCAGAATGTGACTGTATTTGG - Intergenic
1009731032 6:67607188-67607210 CCTCAGAAACTGATGGCTTTAGG - Intergenic
1010073012 6:71766357-71766379 TCTTAGTACCTGTAGGTATTAGG - Intergenic
1010273308 6:73939544-73939566 TCTCAGAATGTGACTGTATTTGG + Intergenic
1011130214 6:84044732-84044754 TCTCAGAATGTGACTGTATTTGG - Intronic
1011166537 6:84454050-84454072 CCTCAGAACATGATTGTACTTGG + Intergenic
1011567558 6:88693495-88693517 TCCCAGAACCTGATGGCTTCAGG + Intronic
1012459082 6:99440853-99440875 TCTCAGACAGTGCTGGTATTGGG - Intronic
1013756027 6:113462686-113462708 CCTCAGAGTCTGATTGTATTTGG + Intergenic
1013798763 6:113915455-113915477 CCTCAGAATGTGATGGTATTTGG - Intergenic
1013945731 6:115720009-115720031 TCTCATAACCAGATTGTATGGGG + Intergenic
1014610271 6:123534987-123535009 TCTCAGCACCAGATGCTAGTTGG + Intronic
1014960981 6:127684399-127684421 TCTCAGAATGTGACTGTATTTGG - Intergenic
1015056937 6:128914213-128914235 TCCCAGAACCAGCTGGTTTTTGG - Intronic
1015706944 6:136098317-136098339 TTTCAGAAACTAATGTTATTAGG - Intronic
1016019411 6:139220038-139220060 ACTCTCAAACTGATGGTATTAGG + Intergenic
1017568613 6:155716040-155716062 GCTCACAAACTGAAGGTATTGGG - Intergenic
1017818467 6:158031750-158031772 TCCCAGGACCTGATTGTACTGGG - Intronic
1018979083 6:168588515-168588537 TCTCCAAAGCTGATGGCATTTGG - Intronic
1019551057 7:1602736-1602758 CCTCAGAATGGGATGGTATTTGG + Intergenic
1019946958 7:4337630-4337652 TCTCAGAATGTGATTGTGTTTGG - Intergenic
1020058888 7:5137440-5137462 TCTCAGAGCCTGATGCTACCTGG + Intergenic
1020254071 7:6492114-6492136 TCTCAGAATGTGAGTGTATTTGG + Intergenic
1020430735 7:8113959-8113981 TCTCAAATCCTGATGCTGTTGGG - Exonic
1021538627 7:21732541-21732563 CCTCAGAATGTGATGTTATTTGG - Intronic
1021621858 7:22556853-22556875 GCTCAGAATGTGATGGTATTTGG - Intronic
1022581242 7:31557161-31557183 TCTCAGAATGTGCTGTTATTTGG - Intronic
1024144346 7:46497335-46497357 ACTCCAAAGCTGATGGTATTAGG + Intergenic
1024492430 7:50000844-50000866 CCTCAGAATGTAATGGTATTTGG + Intronic
1024564529 7:50670476-50670498 TCTCAGACCCAAAGGGTATTGGG + Intronic
1026235465 7:68522978-68523000 CCTCAGAATATGATGGTATATGG + Intergenic
1026559131 7:71433528-71433550 TCTCAGAAGCTGATGGCTATCGG + Intronic
1029170432 7:98626257-98626279 TCTCAGAACCTGTCCGGATTTGG + Intronic
1029892662 7:103947324-103947346 ACTCAGAATGTGATGTTATTTGG + Intronic
1029989558 7:104950675-104950697 TCTCAGAATGTGACTGTATTTGG - Intergenic
1030397452 7:109004949-109004971 TCTCAGAGCCAGATGGTCTGAGG - Intergenic
1030869178 7:114734212-114734234 TCACAGAATGTGATGGTGTTTGG - Intergenic
1031269204 7:119624091-119624113 TCTCAGAATGAGATGTTATTTGG - Intergenic
1031290289 7:119926061-119926083 TCTAAGAACCTTATCTTATTTGG + Intergenic
1031471810 7:122175937-122175959 TTTAAGAACTTGTTGGTATTTGG - Intergenic
1031824140 7:126541907-126541929 TCTCAGAATGTGACTGTATTTGG + Intronic
1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG + Intergenic
1034248091 7:149664540-149664562 ACTCAGTACCTGATGGGAGTAGG - Intergenic
1035586562 8:779627-779649 TCTCAGAAAATAATGCTATTAGG - Intergenic
1036214959 8:6871594-6871616 CCTCAGAAGGTGATTGTATTTGG + Intronic
1036769493 8:11569011-11569033 CCTCAGAATGTGATGGTATTTGG - Intergenic
1037517754 8:19650597-19650619 TCTCCACACCTGATGGTCTTGGG - Intronic
1037596509 8:20358691-20358713 TCTCAGAATGTGACTGTATTTGG + Intergenic
1038165738 8:25083668-25083690 TCTCAGAATGTGACTGTATTTGG + Intergenic
1038208700 8:25494730-25494752 TCTCAGAATGTGACTGTATTTGG + Intronic
1038653069 8:29423256-29423278 TCTCAGTACCTGATAGTAGGAGG - Intergenic
1039803968 8:40983146-40983168 TCTCAAAGCCTGAGGGAATTGGG - Intergenic
1040596377 8:48841476-48841498 CCTCAGAACGTGAGTGTATTTGG + Intergenic
1040909349 8:52502455-52502477 TCTCAGAATGTGACTGTATTTGG + Intergenic
1041684336 8:60629000-60629022 TTTCAGAATCTGACCGTATTTGG + Intergenic
1042179170 8:66067643-66067665 TCTCACAACAAGATGGTCTTGGG - Intronic
1042646270 8:70990006-70990028 TATCAGAACTTCATGGAATTAGG + Intergenic
1043202618 8:77389916-77389938 TCTCTGTACCTTATGATATTTGG + Intergenic
1043300668 8:78727033-78727055 TCTCAGGACCTAATGGTCTCAGG - Intronic
1044278340 8:90327923-90327945 TCTCAGAATGTGACTGTATTTGG + Intergenic
1044871723 8:96626380-96626402 TCTCAGCACATGACTGTATTTGG - Intergenic
1045219722 8:100186941-100186963 TCTCAGAACATGACTGTATTTGG - Intronic
1045303808 8:100939284-100939306 TCTCTGAACCTGATTTAATTTGG - Intronic
1045569037 8:103350916-103350938 CCTCAGAGCATGATTGTATTTGG - Intergenic
1046042184 8:108919259-108919281 TCTCAGAACGTGAACTTATTTGG + Intergenic
1046570857 8:115964083-115964105 TCTGACAACCTGATGGTCATGGG - Intergenic
1046581915 8:116103504-116103526 TGCCAGAACCTGATGTTATCTGG + Intergenic
1046627228 8:116587993-116588015 TCTCAGAATGTGACTGTATTTGG - Intergenic
1047388052 8:124427646-124427668 TCTCAGAATGTGATCTTATTTGG - Intergenic
1048049162 8:130801015-130801037 ACTCACAAGGTGATGGTATTAGG - Intronic
1049345648 8:142137173-142137195 CCTCAGAACGTGAAGTTATTTGG - Intergenic
1049638428 8:143702213-143702235 CCTCAGAACATGACTGTATTTGG - Intronic
1051466906 9:17389847-17389869 TCTCAGAACGTGGCTGTATTTGG + Intronic
1052264260 9:26553225-26553247 CCTCAGAATTTGATTGTATTTGG + Intergenic
1053754663 9:41293404-41293426 GCTCAGTACCTGACGGTATTCGG - Intergenic
1054260185 9:62857708-62857730 GCTCAGTACCTGACGGTATTCGG - Intergenic
1055182646 9:73407140-73407162 CCTCAGAATATGATTGTATTTGG + Intergenic
1055788804 9:79899480-79899502 TCTCAGAATGTGATGGTATTTGG + Intergenic
1056178605 9:84060311-84060333 CCTCAGAATGTGATTGTATTTGG + Intergenic
1056442528 9:86635001-86635023 TCTCAGAATGTGACTGTATTTGG - Intergenic
1056598986 9:88031256-88031278 TCTCAGAATGTGACTGTATTTGG - Intergenic
1056827688 9:89888123-89888145 TCTCAGAATGTGACTGTATTTGG - Intergenic
1057309445 9:93932943-93932965 TCTCAGAAGGTGAATGTATTTGG - Intergenic
1057353007 9:94316185-94316207 ACTCCTAACGTGATGGTATTTGG - Intergenic
1057654739 9:96941406-96941428 ACTCCTAACGTGATGGTATTTGG + Intronic
1058735509 9:107890423-107890445 TCTCAGAATGTGACTGTATTTGG + Intergenic
1058933815 9:109749000-109749022 TCTCAGAATGTGACTGTATTTGG - Intronic
1059830568 9:118090710-118090732 CCTCAGAATGTGATTGTATTTGG + Intergenic
1059909223 9:119023782-119023804 TCTCAGAATGTGACTGTATTTGG - Intergenic
1061752218 9:132787171-132787193 TCTCTGAAACTGCTGTTATTTGG - Intronic
1202798952 9_KI270719v1_random:155211-155233 GCTCAGTACCTGACGGTATTCGG + Intergenic
1185433199 X:21297-21319 CCTCAGAACGTGAGTGTATTTGG - Intergenic
1185442401 X:233365-233387 CCTCAGAACGTGAGTGTATTTGG - Intergenic
1186001063 X:5011063-5011085 TCTCAGAATGTGACTGTATTTGG - Intergenic
1186367483 X:8910627-8910649 TTTAAGAACCTGATTGCATTGGG + Intergenic
1186509393 X:10119068-10119090 TCTCAGAACATGATGGCCTCTGG - Intronic
1186517328 X:10175615-10175637 TCTCTGAACTTGATGTTCTTGGG + Intronic
1186659214 X:11651373-11651395 AGTGAGAACATGATGGTATTTGG + Intronic
1187329016 X:18318905-18318927 CCTCAGAATGTGATGGTATTTGG + Intronic
1187868507 X:23745196-23745218 TCTCAGAACTTTTTTGTATTTGG - Intronic
1188067816 X:25682917-25682939 TCTCAGAATGTGACTGTATTTGG - Intergenic
1188262298 X:28035617-28035639 TCTCAGAATATGATTGTATTTGG - Intergenic
1188855054 X:35184080-35184102 CCTCAGAATGTGATTGTATTTGG + Intergenic
1189223835 X:39396201-39396223 TCTCAGAACCATATGGCATTGGG - Intergenic
1189367947 X:40403529-40403551 TCTCAGAATGTGACTGTATTTGG + Intergenic
1190413561 X:50160330-50160352 TCTCAGAATGTGACAGTATTCGG - Intergenic
1190469122 X:50759127-50759149 TCTCAGAACATGAATGAATTTGG + Intronic
1193704261 X:84801877-84801899 TCTCACTACCTGATAGTATTAGG - Intergenic
1194665022 X:96667909-96667931 TCTCAGAATATGACTGTATTTGG - Intergenic
1194979271 X:100423704-100423726 TCTCAGCACAGGTTGGTATTAGG + Intergenic
1197825352 X:130584364-130584386 TCTCAGAATGTGATCTTATTTGG - Intergenic
1198817120 X:140603500-140603522 CCTCAGAATGTAATGGTATTTGG - Intergenic
1198944924 X:142000575-142000597 CCTCAGAACATGACTGTATTTGG + Intergenic
1200759586 Y:7025747-7025769 CCTCAGAATGTGATGCTATTTGG - Intronic
1201611563 Y:15848714-15848736 CCTCAGAATATGATTGTATTTGG - Intergenic