ID: 920612461

View in Genome Browser
Species Human (GRCh38)
Location 1:207454710-207454732
Sequence GCTGTCTGGTCGGCCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920612449_920612461 23 Left 920612449 1:207454664-207454686 CCGGGAGCTGGGACCTCCAGAAT 0: 1
1: 0
2: 0
3: 27
4: 259
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
920612446_920612461 28 Left 920612446 1:207454659-207454681 CCCCTCCGGGAGCTGGGACCTCC 0: 1
1: 0
2: 1
3: 30
4: 407
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
920612452_920612461 10 Left 920612452 1:207454677-207454699 CCTCCAGAATTGGAGGCTGCGCC 0: 1
1: 0
2: 0
3: 17
4: 102
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
920612448_920612461 26 Left 920612448 1:207454661-207454683 CCTCCGGGAGCTGGGACCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 276
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
920612447_920612461 27 Left 920612447 1:207454660-207454682 CCCTCCGGGAGCTGGGACCTCCA 0: 1
1: 0
2: 1
3: 15
4: 187
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75
920612453_920612461 7 Left 920612453 1:207454680-207454702 CCAGAATTGGAGGCTGCGCCACA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920612461 Original CRISPR GCTGTCTGGTCGGCCCGGTG TGG Intronic
901045479 1:6393352-6393374 GGTGTCTGGCAGGCCCGGCGCGG + Intronic
901622986 1:10604159-10604181 CCTGTCAGGTGGTCCCGGTGAGG + Intronic
901623230 1:10605893-10605915 GCTGTGTGTTCTGCCTGGTGTGG + Intronic
915937063 1:160095849-160095871 GCTGCCTGGGCAGCCCTGTGGGG - Intronic
918488469 1:185054494-185054516 GGCGTCTGGCCGGCCCGGAGGGG - Intronic
919593927 1:199538190-199538212 GCTCTCTGCTCAGCCCTGTGGGG - Intergenic
920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG + Intronic
923106254 1:230856241-230856263 GCTCTCTGGTAGGCCTGTTGGGG - Intronic
923138507 1:231140203-231140225 GCTGCTTGGTGGGCCCTGTGGGG + Intergenic
1073839649 10:107483721-107483743 TCTGTGTGGTCTGCCCAGTGTGG + Intergenic
1074618494 10:115093498-115093520 GCTGTGGGGTCGGCCCGCTAAGG + Intronic
1075446552 10:122517416-122517438 CCTGTCTGGTGGGCGTGGTGAGG + Intergenic
1076335826 10:129705908-129705930 CCTGTCTGCCCGGCCCTGTGTGG - Intronic
1076858600 10:133129201-133129223 GCTCTCTGGATGGCCCGGCGGGG + Exonic
1077353006 11:2101406-2101428 GCTGTGGGGTGGGCCAGGTGGGG - Intergenic
1077541576 11:3149047-3149069 GCTCTGTGGTGGGCCCAGTGGGG - Intronic
1080610015 11:33895865-33895887 GCTGTCTGGTAGAGCAGGTGGGG - Intergenic
1080633499 11:34103444-34103466 GCTGTGTGTTGGGCCGGGTGTGG + Intergenic
1083784420 11:64935550-64935572 GCTGGCTGGTCTGACAGGTGAGG + Intronic
1089947748 11:122495248-122495270 GCTGTCAGGTGGGCCGGGAGCGG + Intergenic
1102057105 12:109904998-109905020 GCTGCCTGGTCTGCCAGGTGCGG + Intronic
1103726722 12:123000889-123000911 TCTGTCCGGTCGGCCAGGTTGGG - Intronic
1109327258 13:60882893-60882915 TCTGTCTGGTGGGCCTAGTGTGG - Intergenic
1113720668 13:112553576-112553598 GCTGTCTGGACAGCCCTGGGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1122689391 14:103524573-103524595 GCTGTCTGGCCAGCCCAGAGGGG - Intergenic
1122830385 14:104392912-104392934 GATGTCTGGGAGGCCGGGTGGGG + Intergenic
1125427176 15:39560792-39560814 GCTGTCATTTCGGCCGGGTGTGG + Intergenic
1126814421 15:52440556-52440578 GATGACTGGTGGGCCAGGTGCGG - Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1138126892 16:54446593-54446615 ACTGACTGGTGGGCCCAGTGGGG - Intergenic
1143719285 17:8798854-8798876 GCTCCCTGCTCGGCTCGGTGGGG - Exonic
1152846324 17:82601875-82601897 GCTGCCTGGTGGGTCCTGTGAGG - Exonic
1156109636 18:33709963-33709985 GCTGACTGATGGGCCGGGTGCGG + Intronic
1157592330 18:48843243-48843265 GCTGACTGGGCTGCCCAGTGCGG + Intronic
1160353163 18:78202167-78202189 GCTGTGTGGTGGGCCGTGTGGGG + Intergenic
1163638956 19:18450820-18450842 GCTGGCTGGTGGGCCCGGGGTGG + Exonic
1163745414 19:19043683-19043705 GCTGCCTGGTGGGCTTGGTGGGG - Intronic
1164937322 19:32224490-32224512 GCTGCCAGGGCGGCCCGGCGGGG - Intergenic
1167333506 19:48870695-48870717 CCAGCCTGGTCGGCCGGGTGCGG + Intergenic
928166792 2:28977721-28977743 GCTGGCTGGTGGGCCAGGAGAGG + Intronic
1170655142 20:18279594-18279616 GCTGTCTGGAGGGCTCAGTGAGG + Intergenic
1172704654 20:36874103-36874125 ACTGTGTGGTCGGCCGGGCGCGG + Intergenic
1174215367 20:48912196-48912218 GCTGTCTGTTCTTCCCTGTGGGG + Intergenic
1176059981 20:63168288-63168310 GCTGCCTGGGGGGCCCGGTGTGG - Intergenic
1176382004 21:6118345-6118367 GCTGCCTGGCAGGCCCGGGGCGG - Exonic
1176666279 21:9690257-9690279 GCTGCCTGGGCAGCCCTGTGTGG + Intergenic
1179741468 21:43419894-43419916 GCTGCCTGGCAGGCCCGGGGCGG + Exonic
1180162254 21:46003320-46003342 GCTCTCTGGCCGGCCCACTGCGG + Intronic
1181081321 22:20417721-20417743 TCTGTTTGTGCGGCCCGGTGGGG - Intergenic
1181440941 22:22934893-22934915 GCTGTGTGGTGGGACCCGTGTGG + Intergenic
1182668082 22:31973500-31973522 GCTGTGTGTTCAGCCCAGTGGGG + Intergenic
954265979 3:49470525-49470547 GCTCGCTGTTCGGCCCGGGGCGG + Intronic
965765692 3:172127946-172127968 GCTGTATCCTCGGCCGGGTGTGG - Intronic
966408406 3:179623380-179623402 ACTGTTTGGTAGGCCGGGTGCGG + Intronic
967373425 3:188774214-188774236 GCTCTCTGGTCTGCCCAGTTTGG + Intronic
968454963 4:693052-693074 CCTGTCTGGCAGGCCCGGGGCGG - Intergenic
968691204 4:1991257-1991279 TCTCTCTGGTCGGCTCCGTGAGG - Intronic
985408742 4:189662079-189662101 GCTGCCTGGGCAGCCCTGTGTGG - Intergenic
986730687 5:10632691-10632713 GCTGGCTGTGCGGCCTGGTGTGG - Intronic
988825311 5:34929682-34929704 GCTCGCTGGCTGGCCCGGTGCGG + Exonic
992812962 5:80408010-80408032 GCTCTCTGCGCTGCCCGGTGGGG + Exonic
996093412 5:119373409-119373431 CCTGTCTTGACGTCCCGGTGAGG - Intronic
996544493 5:124663387-124663409 GCTGTGTGGTAGGCCAGGTCTGG - Intronic
998149295 5:139747770-139747792 GCTGGCTGGGGGGCCCGGTGGGG - Intergenic
1002190118 5:177473530-177473552 TCTGTCCGTTCGGCCCGGTCCGG - Intronic
1002468972 5:179423344-179423366 GCTGACTGGTGGGCCAGGAGCGG + Intergenic
1005968368 6:30742823-30742845 GCTGCCTGGTTAGCCCGGGGAGG + Intergenic
1013288190 6:108698335-108698357 GCTGTCTGGTAGGCACAATGTGG - Intergenic
1018937912 6:168285665-168285687 GCGGTCTGGCCTGCTCGGTGTGG - Intergenic
1025958990 7:66204504-66204526 GCTCTCTGCTAGGCCAGGTGGGG - Intergenic
1033422047 7:141212237-141212259 GCTGTCTGCTGGTCCCGGGGTGG + Intronic
1034494088 7:151409894-151409916 GCTGCCTTGTTCGCCCGGTGGGG - Intronic
1035583334 8:753875-753897 CCTGTCCGGGCGGCGCGGTGCGG + Intergenic
1042916159 8:73878278-73878300 GCAGTCTGGGGGGCCCGGCGTGG + Intronic
1048867149 8:138769530-138769552 GCTGCCTTGTCCTCCCGGTGGGG + Intronic
1049542093 8:143213303-143213325 GCTGTTCGGGCGGCCAGGTGCGG + Intergenic
1057979911 9:99650370-99650392 GCTTTCTGGTGGGGCTGGTGGGG - Intergenic
1062424946 9:136501870-136501892 TCTGTCTGGTCGTCCAGGTCAGG + Exonic
1203659820 Un_KI270753v1:31504-31526 GCTGCCTGGGCAGCCCTGTGTGG - Intergenic
1195813067 X:108855334-108855356 ACTGTCTGGTCGGCCGGGTGCGG - Intergenic