ID: 920613536

View in Genome Browser
Species Human (GRCh38)
Location 1:207466576-207466598
Sequence TATTCTACCCCCATTGCTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920613530_920613536 10 Left 920613530 1:207466543-207466565 CCTCCGCCTATCCTAAATGGCCG 0: 1
1: 0
2: 0
3: 0
4: 22
Right 920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
920613535_920613536 -10 Left 920613535 1:207466563-207466585 CCGGATTAGTTATTATTCTACCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
920613532_920613536 7 Left 920613532 1:207466546-207466568 CCGCCTATCCTAAATGGCCGGAT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
920613533_920613536 4 Left 920613533 1:207466549-207466571 CCTATCCTAAATGGCCGGATTAG 0: 1
1: 0
2: 1
3: 1
4: 33
Right 920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
920613534_920613536 -1 Left 920613534 1:207466554-207466576 CCTAAATGGCCGGATTAGTTATT 0: 1
1: 0
2: 0
3: 1
4: 63
Right 920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920613536 Original CRISPR TATTCTACCCCCATTGCTGT TGG Exonic
904629652 1:31831356-31831378 TGTTGTACCCCCATTATTGTGGG + Intergenic
905954713 1:41982699-41982721 TATTCTATCACCAATTCTGTCGG - Intronic
906459362 1:46025526-46025548 GATTCTAGCCCCTTTGCTGCTGG - Intronic
909069974 1:70982340-70982362 TATTCCACCCCCCAGGCTGTTGG + Intronic
909695338 1:78462233-78462255 TTTTTTTCCCCCATTTCTGTGGG + Intronic
909837813 1:80279467-80279489 GATTCAACCACCATTTCTGTTGG + Intergenic
916749083 1:167708045-167708067 TATTCTTTCACCATTACTGTGGG + Intergenic
917118755 1:171627560-171627582 TCTTCTACCCCCATAGTAGTTGG + Intergenic
919203525 1:194390799-194390821 TCTTCTACTACCATTGGTGTTGG - Intergenic
920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG + Exonic
921489108 1:215752718-215752740 TATTATTCTCCCATTGCTTTTGG + Intronic
921530618 1:216278012-216278034 TATTCTAACTACATTGCTATTGG + Intronic
923680252 1:236112937-236112959 TATTCTACCTCCAGAGCAGTGGG + Intergenic
924032539 1:239900738-239900760 TTTTCTCCCCTCATTGCTGTAGG - Intronic
1066209933 10:33226615-33226637 TATTATACCCTCATCTCTGTTGG + Intronic
1067735568 10:48847586-48847608 TATTCTCACCCCATCTCTGTCGG - Intronic
1069627453 10:69877002-69877024 CCTTCTACCCCCACTGCTATGGG - Intronic
1069674195 10:70235648-70235670 TATCCTGTCCCCTTTGCTGTGGG + Intergenic
1072238405 10:93472861-93472883 ACTTCTTCCCCCATTGCTGCAGG - Intronic
1074451724 10:113564662-113564684 TATTCTTCCCACTTTTCTGTAGG - Intronic
1076291412 10:129348627-129348649 TATTGTTCACCCAATGCTGTCGG - Intergenic
1086996458 11:93362275-93362297 TATTTTCTCCCCATTGCTGGGGG - Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1087893449 11:103561400-103561422 TATTCTACCAACATTTCTGTGGG + Intergenic
1088876545 11:113941204-113941226 TATTCTGGACCCTTTGCTGTTGG - Intronic
1090062193 11:123473664-123473686 GATTCTACCCACCTTGCTGCAGG + Intergenic
1095711898 12:45298501-45298523 AATTCTACCCCCACTACTGAGGG - Intronic
1096717868 12:53501811-53501833 CATTCTTCCCCCCTTGCTTTGGG + Intronic
1097134939 12:56844528-56844550 TATTATACTCCCATACCTGTGGG - Intergenic
1100128532 12:91460676-91460698 GATTCTACCCCCAGTGATTTAGG - Intergenic
1105318181 13:19288427-19288449 TATTTTTTCCCCACTGCTGTTGG - Intergenic
1106439275 13:29751093-29751115 GAGTCTACACTCATTGCTGTGGG + Intergenic
1112572905 13:100610042-100610064 TTTTGTATCTCCATTGCTGTCGG - Intronic
1114937014 14:27551067-27551089 TATTCTCTTCCCATTGCTGTTGG - Intergenic
1116840009 14:49810413-49810435 AATTCTATCCCCATTGGTCTTGG + Intronic
1117436468 14:55719350-55719372 TTTCCTATCCCCATTGCTGGCGG + Intergenic
1118518402 14:66552653-66552675 TATTCCACCCTCATTTCTGAAGG + Intronic
1118857909 14:69638363-69638385 TAATCTACCCCCATCACTCTTGG + Intronic
1122395929 14:101430649-101430671 TATTCTTCCTCCATTGCCTTGGG + Intergenic
1123818355 15:24001701-24001723 TATTATACAGCAATTGCTGTAGG - Intergenic
1124509374 15:30310032-30310054 TATTTTAACTCCCTTGCTGTGGG - Intergenic
1124710391 15:32005404-32005426 GATTCTAACCCCATTGTTCTGGG - Intergenic
1129527702 15:76231590-76231612 TATTTTACTACCATTGCTATAGG - Intronic
1130708814 15:86259303-86259325 AATTCTATCTCCATTTCTGTTGG + Intronic
1130807896 15:87345880-87345902 TCAGCTGCCCCCATTGCTGTGGG + Intergenic
1137959638 16:52869369-52869391 TTTTCTTTCCACATTGCTGTTGG - Intergenic
1140260406 16:73373345-73373367 CATTCTACCCCCATTGACCTAGG + Intergenic
1146923126 17:36727077-36727099 GATTCTATCCCCATTGCTTGAGG - Intergenic
1155464714 18:26121364-26121386 TAGTCTAGCCCCTTTTCTGTAGG - Intergenic
1156416488 18:36897515-36897537 TATCCAACCTCCATTTCTGTTGG - Intronic
1156534590 18:37850294-37850316 CCTTCTACCCCCATGGCTCTTGG - Intergenic
1158902152 18:61973955-61973977 TATTCTGCTTCTATTGCTGTAGG - Intergenic
927084454 2:19660538-19660560 TATTCGACTCACATTTCTGTTGG - Intergenic
930266179 2:49202122-49202144 TATTGTACCACAATTTCTGTTGG + Intergenic
932465658 2:71922500-71922522 TATTCAAACCCCATTGCATTTGG + Intergenic
935580925 2:104755344-104755366 ACTTCTAGCCCCACTGCTGTGGG - Intergenic
935591986 2:104853080-104853102 TATTCGACCCCAATGGCTTTAGG - Intergenic
937863696 2:126732436-126732458 TATTCTGCTCCCACTGGTGTGGG - Intergenic
942476662 2:176333057-176333079 TATTCTTTCCACATTCCTGTTGG - Intronic
945002038 2:205362041-205362063 TATTCAAACCCATTTGCTGTAGG + Intronic
947929113 2:233948695-233948717 TCTCCTACCCCCACTACTGTGGG - Intronic
1169142321 20:3233561-3233583 AATTCTCCCCCCAGTTCTGTGGG + Exonic
1170871885 20:20213482-20213504 TATTTTACCTCCATGGCAGTTGG + Intronic
1170947547 20:20904901-20904923 TATTCTACTCACAATTCTGTGGG + Intergenic
1170955034 20:20972193-20972215 TATTCTCCAGCCAGTGCTGTTGG - Intergenic
1177301145 21:19246368-19246390 TTTCCTACCCCCAATGATGTGGG - Intergenic
1177642890 21:23866425-23866447 TATTTTACCCCATTTGTTGTTGG - Intergenic
949743577 3:7263789-7263811 TACCCTACCGCCATTGCTGTGGG - Intronic
950937944 3:16862083-16862105 TATTCTACCAACATTACTGTTGG - Intronic
952945668 3:38476755-38476777 TATTCTGCCCCCATTCCCATTGG + Intronic
960629241 3:119712213-119712235 TATTTTTTCCCCATTTCTGTTGG - Intronic
962225375 3:133602306-133602328 TATTCTACCTTCATTGTTGAAGG - Intronic
965837941 3:172871581-172871603 TTTTCTACCCCAAATGCTTTGGG + Intergenic
970135913 4:12923674-12923696 AATTCTTCTCCCCTTGCTGTAGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
977094854 4:92728294-92728316 TATTATATCACAATTGCTGTGGG + Intronic
982234227 4:153237263-153237285 TATTATAACCACATTGTTGTAGG + Intronic
985318055 4:188679342-188679364 TATGCTACCTCCATTGTTTTTGG + Intergenic
986106062 5:4660783-4660805 CATTATACGCCCATTTCTGTGGG + Intergenic
990698957 5:58454688-58454710 TATCCTATCCTCATTGATGTAGG + Exonic
991310087 5:65229008-65229030 CATTCTCCCCCAACTGCTGTAGG + Intronic
992804423 5:80323170-80323192 ATTTCTACCCCCATCCCTGTTGG + Intergenic
992979205 5:82150075-82150097 TATGATACACCTATTGCTGTGGG + Intronic
995652618 5:114387010-114387032 TTTTCTACCCTAAATGCTGTAGG - Intronic
996241086 5:121202733-121202755 TATTCTTCTCACATTGCTGGAGG - Intergenic
996384269 5:122894225-122894247 CATTCTACACCCATGTCTGTAGG + Intronic
996924056 5:128801563-128801585 TATTCTTCCCCCATTACTCATGG - Intronic
997454994 5:134010138-134010160 TATTCCACCCCCCTTGATGCTGG + Intergenic
1002551855 5:180000136-180000158 TATTTCACCCCCATTTCTGAAGG + Intronic
1006763178 6:36481729-36481751 TATTCCTCCCCCATTGGTGGAGG - Exonic
1012138527 6:95590873-95590895 TATTTTACTATCATTGCTGTAGG + Intronic
1012641214 6:101617755-101617777 TTTTCTACCCATATTTCTGTTGG + Intronic
1013764511 6:113559049-113559071 TAATCTACCCACATTCTTGTAGG + Intergenic
1017362805 6:153595718-153595740 AATTTTACCCACATGGCTGTTGG + Intergenic
1017647267 6:156550929-156550951 TATTCTTTCCCCACTGCAGTCGG - Intergenic
1019738449 7:2661555-2661577 CATTCTGCCCCCAGGGCTGTTGG + Intronic
1019870648 7:3757712-3757734 TCTTCCAACCCCATTGCTGGAGG + Intronic
1021926734 7:25541094-25541116 TAATCTTCACCCATTTCTGTAGG - Intergenic
1024112943 7:46164669-46164691 TCTTCTATCCACACTGCTGTAGG + Intergenic
1025003172 7:55335219-55335241 CATTCTGCCCCCGCTGCTGTAGG - Intergenic
1031466873 7:122123893-122123915 AATTCTTCCTCCATTCCTGTGGG + Intronic
1031512157 7:122664268-122664290 TATTCTAGCCCCCCAGCTGTTGG - Intronic
1034052717 7:147999929-147999951 ATTTCTACCCCCAGTACTGTGGG + Intronic
1040400246 8:47043384-47043406 GGTTCCACCACCATTGCTGTAGG + Intergenic
1042249622 8:66742775-66742797 TTTTGTATCTCCATTGCTGTTGG + Intronic
1042389626 8:68218476-68218498 TATTCTACCACCTTTTCTTTGGG + Intronic
1043199957 8:77354509-77354531 TATTCTACCAATGTTGCTGTCGG + Intergenic
1045762421 8:105626296-105626318 TGTTATGCCCCCATAGCTGTTGG + Intronic
1048094505 8:131276822-131276844 TATTCTTACCCTATTGATGTTGG + Intergenic
1048608912 8:136000806-136000828 GACTCAACCCCCATTGCTGGAGG + Intergenic
1056130817 9:83584773-83584795 GATTCTGCACTCATTGCTGTGGG + Intergenic
1058423471 9:104855721-104855743 TATTTTACCAGCATTGATGTCGG - Intronic
1185953962 X:4468545-4468567 TAGTCTCCCCCTGTTGCTGTAGG - Intergenic
1189131635 X:38504351-38504373 TATTTTACCCTCATTACTGAAGG - Intronic
1190520685 X:51276757-51276779 TATAAAACCACCATTGCTGTGGG - Intergenic
1191760581 X:64643569-64643591 TCTTGTACCCCCATAACTGTTGG - Intergenic
1192726968 X:73763847-73763869 GATTCTACCCCAGTGGCTGTTGG + Intergenic
1192759881 X:74086007-74086029 AATTCCACCACCATTGCTGTGGG + Intergenic
1194929701 X:99871391-99871413 TCTTCTAGCCCCATTTTTGTAGG - Intergenic
1195692777 X:107641711-107641733 TATTCCACCCCCCTTACTTTGGG - Intronic
1196266500 X:113653652-113653674 GACTCTACCCCCATGGCTCTGGG - Intergenic