ID: 920614168

View in Genome Browser
Species Human (GRCh38)
Location 1:207472966-207472988
Sequence GAAAGTTTACACAGGGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920614168_920614176 19 Left 920614168 1:207472966-207472988 CCTGCTCCCCTGTGTAAACTTTC 0: 1
1: 1
2: 3
3: 14
4: 156
Right 920614176 1:207473008-207473030 TCACATGTCCATATTGCAAATGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920614168 Original CRISPR GAAAGTTTACACAGGGGAGC AGG (reversed) Exonic
903172920 1:21564646-21564668 GGAAGTTTAAACACGAGAGCTGG - Intronic
904782056 1:32957298-32957320 GAAAGACTTCACAGAGGAGCAGG - Intronic
904824805 1:33267118-33267140 GCAAGTTTACCCAGGAGAGTGGG - Intronic
906193269 1:43912814-43912836 GCAGCTTCACACAGGGGAGCTGG + Intronic
907053672 1:51345703-51345725 GAAAGTTTACACTGGAGATGGGG - Intergenic
907741200 1:57167725-57167747 GTAAGGCTACACAGGGGAGGTGG - Intronic
908386931 1:63651777-63651799 CAAAGTTTACACTGTGGAGAAGG + Exonic
908506168 1:64802373-64802395 GAAAACTTACAAAAGGGAGCAGG - Intronic
909493444 1:76251236-76251258 GAAAGTTTACACGAAGGAGTGGG - Intronic
910160390 1:84266285-84266307 GAAAGTTTACAAATGTGTGCTGG + Intergenic
912936560 1:114008194-114008216 GTAAGGTTGCACAGGGGAGCAGG + Intergenic
915195642 1:154187438-154187460 GAAAGCTAACAAAGGGGAGAGGG + Intronic
916747368 1:167694856-167694878 GAAAGCTCACACAGAGGATCAGG - Intronic
917696834 1:177533963-177533985 CCAAGGTTGCACAGGGGAGCAGG + Intergenic
917730592 1:177871099-177871121 GGAAGTTTACTCATGGGAGCTGG - Intergenic
918562522 1:185887139-185887161 GAAAGTGTACACATGGCAGGTGG - Intronic
919293406 1:195663224-195663246 GAAAGAGTGCACAGGGGAGGTGG - Intergenic
920560901 1:206937707-206937729 TAAAGTCTACACAGTGGACCTGG - Exonic
920614168 1:207472966-207472988 GAAAGTTTACACAGGGGAGCAGG - Exonic
921854619 1:219968216-219968238 GAAAGTTTAAAGAAGGGAGGAGG + Intergenic
922564252 1:226590860-226590882 GAAAGACTTCACAGGAGAGCAGG - Intronic
924432280 1:244007410-244007432 GCAGGTGGACACAGGGGAGCTGG + Intergenic
1064674386 10:17746736-17746758 AAAAGGTTGCACAGAGGAGCAGG + Intergenic
1067800554 10:49355491-49355513 GAAAGTTGACTTAGGGGTGCAGG - Intergenic
1071991359 10:91103556-91103578 GAATGTTTCCACCGGGGAGATGG + Intergenic
1072619260 10:97068763-97068785 GACAGACTACACTGGGGAGCTGG - Intronic
1073654457 10:105397855-105397877 GAAGGTTTACACAAGGGCGATGG + Intergenic
1075724791 10:124605745-124605767 AGCAGTTTACACAGGGGAGGCGG + Intronic
1078606293 11:12778917-12778939 AAAAGTGTAAACAGGGGAGTGGG - Intronic
1079430181 11:20382117-20382139 TAAACTTCACACAGGTGAGCTGG + Intronic
1079495675 11:21040980-21041002 GAAAGTTGACAAAGGAAAGCTGG - Intronic
1079841579 11:25407917-25407939 GTAAGTTTACAAAGAGGAGAAGG + Intergenic
1081203096 11:40241990-40242012 GAAATTTTTCACTGGGGAGCTGG + Intronic
1081893669 11:46566573-46566595 GAAAGATTACAGACGGGACCCGG + Intronic
1084061116 11:66675490-66675512 GAAAGTTTGCATAGTGGAGATGG - Intronic
1085732214 11:79009767-79009789 GAAAGCTTACACTGGGAAGCAGG - Intronic
1089184547 11:116606025-116606047 GAAAGGTTTCACAGAGGAGGTGG - Intergenic
1090961763 11:131563465-131563487 GAAAGTGAAGAAAGGGGAGCAGG - Intronic
1091129112 11:133129062-133129084 AAGAGTTTACACAGGGGAAGGGG + Intronic
1091897408 12:4116631-4116653 GGAAGTTATCACAGGGGAGAAGG + Intergenic
1092953880 12:13531808-13531830 GAAAAGTTAGACAGGAGAGCTGG + Intergenic
1093982613 12:25491367-25491389 GAAAGTCTACAGAGGGGTGGTGG + Intronic
1095159994 12:38905262-38905284 GTCAGGTGACACAGGGGAGCGGG - Intronic
1095285800 12:40408893-40408915 GAAAGTTTAAATAGGCCAGCAGG - Intronic
1098753012 12:74320199-74320221 GAAACTTTGCCCAGGGGACCAGG - Intergenic
1101330957 12:103757606-103757628 CAAAGTGTAAACAGGGGAGAGGG + Intronic
1103124403 12:118408921-118408943 GACTGTTTACATAGGAGAGCTGG + Intronic
1103172548 12:118833999-118834021 GATACTTTACATAGGGCAGCTGG + Intergenic
1104379604 12:128295554-128295576 GAAAGCATACCCAGGGGAGGGGG - Intronic
1105886612 13:24648158-24648180 GAAAGTTTTCACAGAAGAGTGGG - Intergenic
1107384897 13:39897640-39897662 GAAAGTTTAAAAACGGGAGAGGG + Intergenic
1107950675 13:45458764-45458786 GGGAGTCTACAGAGGGGAGCAGG - Intergenic
1110782537 13:79482280-79482302 CAAAGTTTACACAGTTAAGCTGG - Intronic
1111151040 13:84253908-84253930 GAAAGATTACAGTGGGTAGCTGG + Intergenic
1112319703 13:98395307-98395329 GAAGGTTTCCGCCGGGGAGCCGG + Exonic
1112976673 13:105328182-105328204 GGAAGTTGACAAAGGTGAGCTGG - Intergenic
1113613138 13:111662015-111662037 GAGAGTTGAGAGAGGGGAGCTGG + Intronic
1116654328 14:47632097-47632119 GAAAGATTAAACAGGGCATCAGG - Intronic
1118359127 14:65041294-65041316 AAATGTTTACACAGTGCAGCAGG - Intronic
1122596588 14:102897792-102897814 GAAAGCTCACACAGAGTAGCTGG - Intronic
1123882227 15:24687132-24687154 GGAAGTTTCAGCAGGGGAGCAGG + Intergenic
1126323702 15:47451564-47451586 GAAAGGTTACATAGGAGAGCAGG + Intronic
1127566270 15:60191937-60191959 GAAGGTTTGGAAAGGGGAGCAGG + Intergenic
1128579022 15:68795923-68795945 AAAAGTGTTCACAGAGGAGCAGG + Intronic
1131636355 15:94236917-94236939 GGAAGATTACACAGGTGACCAGG + Intronic
1134139043 16:11700993-11701015 GAGAGTTTACAAAGGGAAACTGG + Intronic
1137716372 16:50600866-50600888 GAGAGTTTGCACAGGGAAGGTGG - Intronic
1140254756 16:73325470-73325492 GAAGCTTTCCACAGGGGAGGTGG + Intergenic
1141583751 16:85019148-85019170 GAAATTTTACATGGGGGACCGGG - Intergenic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1145805951 17:27730037-27730059 TAAAGTTTTCACAGGGGAAAGGG - Intergenic
1146874793 17:36400512-36400534 CAAAGTTTCCACAGGGGAGAGGG - Intronic
1147064594 17:37912367-37912389 CAAAGTTTCCACAGGGGAGAGGG + Intergenic
1147155145 17:38540941-38540963 GAAAATTTCCACAGGGAGGCTGG + Intronic
1147364722 17:39952528-39952550 GAGAGTCTGCACGGGGGAGCAGG + Intergenic
1148734101 17:49854924-49854946 GAAAGCTTACACAGGGCAGGGGG + Intergenic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1150026544 17:61681006-61681028 GCAACTTTTCACAGGGCAGCAGG + Intergenic
1150242198 17:63643537-63643559 GAAACTGTACAAAGGGGAGAAGG + Intronic
1164321676 19:24153699-24153721 GAAAGTTTACACAGCTGAGGCGG - Intergenic
1167971308 19:53189141-53189163 AAAAGTTGACACAGTGGAGGAGG + Intronic
925729769 2:6910872-6910894 GAATGAGGACACAGGGGAGCTGG + Intergenic
927482381 2:23464536-23464558 GAAAGCTTAGGCAGGGGAGTGGG - Intronic
928819100 2:35339131-35339153 GAAACTTTGCCCAGGGGAGAGGG + Intergenic
928859969 2:35846035-35846057 GAGAGATCACACAGGTGAGCAGG + Intergenic
929442761 2:41978344-41978366 GAAAGAATCCACAGTGGAGCAGG + Intergenic
931571770 2:63676213-63676235 GAAAGTTTACAAAGGGGAGCCGG + Intronic
932973104 2:76570043-76570065 GAAAATTAACACTAGGGAGCCGG - Intergenic
937145204 2:119638632-119638654 GAATGTTGACAAAGGGTAGCAGG - Intronic
938652559 2:133398929-133398951 GGAAGTTTATAAAGTGGAGCTGG + Intronic
941574474 2:167213768-167213790 GAAAGTTTACACATGTGAGATGG - Intronic
941668451 2:168264642-168264664 GAAAGCTTACACATGGTAGTTGG - Intergenic
942027249 2:171922521-171922543 AAAAGTTTACCAAGGGGAGGAGG + Intronic
943748091 2:191483211-191483233 GGGAGTTTGCACAGGGGTGCAGG + Intergenic
944122082 2:196251229-196251251 GAAAGTCTTTTCAGGGGAGCCGG - Intronic
946015534 2:216601139-216601161 GAAGGCTTGCACAGGGGAGGTGG + Intergenic
947682888 2:232051894-232051916 GGATGTTTGCACATGGGAGCTGG + Intronic
948206334 2:236164550-236164572 GAGAGGCTACGCAGGGGAGCTGG - Intergenic
1169464284 20:5823769-5823791 GAAAGTTTACACAGTTGTGTTGG + Intronic
1170026352 20:11892340-11892362 TAAAGTTAAAACAGGGGATCTGG - Intronic
1170270342 20:14520673-14520695 GAAAGTTTACACAAAGTAGGTGG - Intronic
1172038816 20:32029581-32029603 GAAGGTTTTCAGAGGAGAGCTGG + Intronic
1175353208 20:58341127-58341149 GAAAGTGTTGACTGGGGAGCTGG + Intronic
1179266950 21:39812346-39812368 GAAAGATTGCAGAGGGGAGCTGG + Intergenic
1179709039 21:43201477-43201499 GAAAGTTGAAACAGGGGATTTGG - Intergenic
1180466193 22:15613732-15613754 CAAAGTTTCCACAGGGGAAAGGG + Intergenic
1183801481 22:40168851-40168873 AAAAGATTTCACAGGGGAGGAGG - Intronic
1184104868 22:42361683-42361705 GAAAGAGTATACTGGGGAGCGGG + Intergenic
1184425512 22:44406916-44406938 GAAAGTCTTCGCAGGGGAGGTGG - Intergenic
1185118749 22:48953024-48953046 GAAAGGTTATGCTGGGGAGCCGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952409283 3:33032930-33032952 GACATTTGACACAGGGAAGCTGG - Intronic
955095387 3:55792194-55792216 CAAAGATTGCAAAGGGGAGCTGG - Intronic
956028067 3:65005223-65005245 GAAAGTATACTCAGGTAAGCTGG - Intergenic
958813466 3:98890262-98890284 GAAAGTTTAGACAGAGATGCAGG + Intronic
961699951 3:128735627-128735649 GAAAAGTTAAACATGGGAGCTGG + Intronic
962849155 3:139295006-139295028 GACAGTAAACACAGGGAAGCCGG - Intronic
963266745 3:143247254-143247276 GAAAGTTTACCCCGCAGAGCAGG + Intergenic
963571182 3:146998441-146998463 GATAGGTTTCACAGGTGAGCAGG + Intergenic
963979912 3:151525965-151525987 GAACATGTACACCGGGGAGCGGG + Intergenic
967293511 3:187944315-187944337 GAAAGACTTCACAGGGGAGGTGG + Intergenic
968151459 3:196339804-196339826 GAAAGTTAACACTGGGGACAAGG - Intergenic
970038732 4:11771662-11771684 AAAAGTTAACACAGGAGAACTGG - Intergenic
980316314 4:131205887-131205909 GATTGTTTATACAGAGGAGCTGG + Intergenic
981524417 4:145695605-145695627 CAAAGTTGACAAAGGGGATCTGG - Intronic
982298020 4:153849784-153849806 GAAAGATTTCACAGAGCAGCAGG - Intergenic
982840894 4:160184982-160185004 TGAAGATTACAGAGGGGAGCTGG - Intergenic
984230199 4:177087918-177087940 AAAATTTTACATAAGGGAGCAGG + Intergenic
987908164 5:24105741-24105763 CAAAGGTTGCACAGGGCAGCAGG + Intronic
995252504 5:110009644-110009666 GAAAGTGTAGACAGAGAAGCAGG + Intergenic
999018588 5:148137550-148137572 GAAAATGTAGAAAGGGGAGCTGG - Intergenic
1000250932 5:159494670-159494692 ACAAGTTTACACAGTGGAACTGG + Intergenic
1000754667 5:165143350-165143372 CAAAGTTTACTCAGAGGAGAAGG + Intergenic
1001068435 5:168559967-168559989 GAAATCTTACAAAGGGGAACTGG + Intronic
1003623223 6:7720675-7720697 GAAAATTCAAACAGGGGAGGGGG - Intergenic
1004044641 6:12012270-12012292 GAAATATTAAACAGGGGAGCGGG - Intronic
1006946629 6:37788670-37788692 GAGAGTGTGCACAGGGGATCTGG + Intergenic
1008974207 6:57405273-57405295 GAAATTTTGCACAGGGGAGCTGG + Intronic
1009163096 6:60306796-60306818 GAAATTTTGCACAGGGGAGCTGG + Intergenic
1012562824 6:100606130-100606152 GAAATTTTATACCGGGGTGCAGG - Intronic
1012978073 6:105801513-105801535 GAAACTTCACAGAGGGAAGCAGG + Intergenic
1013611458 6:111799855-111799877 GCACGTTTCCACAGGGGAGCTGG - Intronic
1014168274 6:118250207-118250229 GAAAAATTAAACAGGGGAGAGGG - Intronic
1015378834 6:132543787-132543809 GAAAGTAGAGACAGGGTAGCTGG - Intergenic
1017651471 6:156587061-156587083 GAAAGAATACACAGGGTAACAGG + Intergenic
1020404534 7:7817019-7817041 GAACGTTTACACAGAGGAGCAGG - Intronic
1021519652 7:21526670-21526692 CCAAGTTTGCACAGGGCAGCAGG - Intergenic
1022699442 7:32744440-32744462 GAAAGTTTCCAGTGGGGAGGGGG + Intergenic
1023892588 7:44403915-44403937 CAAAGCTTTCACAGGGGAGAAGG + Intronic
1026202206 7:68224052-68224074 GAAAGGTTACAAAGGGGCACGGG + Intergenic
1026405141 7:70057341-70057363 GAAAATCTCCACAGCGGAGCTGG - Intronic
1027005693 7:74690730-74690752 GAGAGTTTACACAGGCTTGCTGG - Intronic
1028170244 7:87587573-87587595 GAAAGTTTACCAAGTGTAGCTGG + Intronic
1028291268 7:89067676-89067698 AAAATTTTACAAAGGGAAGCAGG + Intronic
1029652865 7:101905734-101905756 GAATCTCTACACAGGGCAGCTGG - Intronic
1029728416 7:102423956-102423978 GAAAGTTCAAACGGGGAAGCCGG - Intronic
1030005275 7:105112433-105112455 GAAAGTTTGCAGAGGGCTGCTGG - Exonic
1031468370 7:122141749-122141771 GAAAACTTAGACATGGGAGCTGG + Intronic
1034293422 7:149950022-149950044 GGAAGTGCACCCAGGGGAGCAGG + Intergenic
1034812644 7:154146831-154146853 GGAAGTGCACCCAGGGGAGCAGG - Intronic
1036399848 8:8398368-8398390 GAGAGTTTCAACAGGGGATCTGG - Intergenic
1036670310 8:10779934-10779956 GAAAATGTACACAGTGGACCTGG + Intronic
1043625903 8:82258117-82258139 GAAAGCTTTCCCAGGGGAGGTGG - Intergenic
1044640999 8:94381655-94381677 CAAAGTTTTAACAGGAGAGCTGG + Intronic
1050256428 9:3796798-3796820 GAAAGGTTTCAGAGGGGAGATGG + Intergenic
1050601503 9:7257497-7257519 GAAAGTTTACACTTGGAAGAAGG - Intergenic
1058011018 9:99977218-99977240 GCAAGTTTATACAGGGCACCAGG + Intergenic
1058641135 9:107086589-107086611 GATAGTTTTCACAGTGGAGATGG + Intergenic
1060114879 9:120932050-120932072 GAAAATGAACACAGGGAAGCAGG + Intergenic
1192450782 X:71243423-71243445 TAAAGATTACAAAGGGGACCTGG + Intronic
1193873580 X:86832869-86832891 GAAGGGTTACACTGGGAAGCAGG + Intergenic
1195491480 X:105475456-105475478 GAAAGGTTAAACATGGGAGATGG - Intronic
1199668132 X:150118436-150118458 GAAAGTTTACCCAGGGACTCTGG + Intergenic
1199753271 X:150841342-150841364 GGAAGTTTACACAGGGAAACTGG + Intronic
1199794782 X:151183657-151183679 GAAATTTGGCACAGGGGTGCAGG - Intergenic