ID: 920615436

View in Genome Browser
Species Human (GRCh38)
Location 1:207487836-207487858
Sequence CTGCAGGTGCAGATGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920615428_920615436 17 Left 920615428 1:207487796-207487818 CCTAGCTGCGTGGGCTTAGTAAC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG 0: 1
1: 1
2: 1
3: 34
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920615436 Original CRISPR CTGCAGGTGCAGATGAAGGC AGG Intronic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
900343716 1:2200861-2200883 CTGCAGGTGGAGAGGGTGGCTGG + Intronic
900358493 1:2276229-2276251 CTCCAAGTACAGATAAAGGCAGG - Intronic
900578617 1:3396533-3396555 CTGCTGGTGCACGTGAAGGAAGG + Exonic
900908896 1:5580201-5580223 TTGGATGTGAAGATGAAGGCTGG + Intergenic
901645980 1:10716980-10717002 CTGCCTGTGCTGGTGAAGGCAGG - Intronic
901759237 1:11459940-11459962 CTGCAGGTGCCCAGGATGGCTGG - Intergenic
903205893 1:21782562-21782584 ATGGCGGTGGAGATGAAGGCAGG - Intronic
903261230 1:22132787-22132809 CTGCTGTGCCAGATGAAGGCAGG - Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903778748 1:25808896-25808918 GGGCAGGTCCAGAGGAAGGCAGG - Intronic
904035981 1:27558747-27558769 CTGGAGATGCTGATGAAGACAGG - Exonic
904627467 1:31815097-31815119 CTGCAGGTGCTGCTGAGGTCCGG - Exonic
904774469 1:32898274-32898296 CGGAAGGTGCTGATGAAGACAGG - Exonic
905459207 1:38111344-38111366 CGGCAGGTGCAGGAGAAAGCTGG + Intergenic
905896203 1:41547467-41547489 CTGCAGGTGGAGGGGATGGCAGG + Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
906724455 1:48033811-48033833 TTGCTTGTGCACATGAAGGCTGG + Intergenic
907608837 1:55847307-55847329 TGGCAGTTGCAGATGAAGACAGG + Intergenic
907866236 1:58402110-58402132 CTCCAGGAGCATATGAATGCAGG - Intronic
910566824 1:88653200-88653222 CTTCAGGTGCAAATGCAAGCTGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913495150 1:119421850-119421872 CTACTGGTGTAGATGAAGACTGG - Exonic
913505599 1:119513875-119513897 CTACTGGTGTAGATGAAGACTGG - Exonic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
914827359 1:151145666-151145688 CTGCAGGCGCAGACGAAGAGGGG + Intronic
915732856 1:158066611-158066633 CTACAGGAGCACATGGAGGCAGG - Intronic
916474234 1:165153342-165153364 CTGCAGGTGAAGAAAAAGGATGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917519315 1:175734913-175734935 CTTCAGGTGCAGATCAATACAGG - Intronic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920920080 1:210291644-210291666 CTGCAGGTGCCTAGGAAGGTGGG + Intergenic
921691534 1:218156794-218156816 CTGCAGGTGTCGCTGACGGCCGG - Intergenic
922163352 1:223094609-223094631 TGCCAGGTGAAGATGAAGGCAGG - Intergenic
922880334 1:228975689-228975711 CTCCCTGTGCAGATGAATGCAGG - Intergenic
924285103 1:242477687-242477709 CTGGTGGTGCAGAGGATGGCAGG + Intronic
1062875458 10:939769-939791 CTCCAGGTGCTTATGAAGTCTGG - Intergenic
1063898090 10:10703072-10703094 CTGCAGGTTCTGAAGAAGTCGGG - Intergenic
1067229275 10:44395527-44395549 CAGCAGGAGCAGCTGAGGGCAGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1069058078 10:63865459-63865481 CAGGAGGTGAAGGTGAAGGCAGG + Intergenic
1070555537 10:77524935-77524957 CTGCTGGTGCTGAGGGAGGCCGG - Intronic
1070688968 10:78510757-78510779 GTGCAGGGGCAGCTGCAGGCAGG - Intergenic
1070811199 10:79298942-79298964 CTGCATGCTCAGAGGAAGGCAGG - Intronic
1070845233 10:79516915-79516937 CGGGAGATGGAGATGAAGGCAGG - Intergenic
1071695223 10:87863280-87863302 CAGCAAGTGCAGCTGCAGGCTGG + Exonic
1073007900 10:100338814-100338836 CTGCAGGTTCAGATCTGGGCCGG + Intergenic
1073568745 10:104558050-104558072 CTGCAGGTGCTGGTGAAGGATGG + Intergenic
1073719194 10:106147165-106147187 CTGCCGGTGTAGTTGAAAGCAGG + Intergenic
1074207535 10:111297005-111297027 CTCAAGGTAGAGATGAAGGCAGG + Intergenic
1074434683 10:113424088-113424110 CTGCAGGTGCTGGGGAAGGCTGG + Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074849397 10:117427048-117427070 CTGTATGTCCAGGTGAAGGCTGG + Intergenic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075063705 10:119274614-119274636 CTTGAGGTGCAGGTGCAGGCTGG + Intronic
1075176064 10:120162386-120162408 CTTCAGGTGAAGAAGAACGCTGG + Intergenic
1075564861 10:123495785-123495807 CCGCAGGTGCAGTGAAAGGCAGG + Intergenic
1076468435 10:130701896-130701918 CTGCCGATGCGGATGAAGACAGG + Intergenic
1076501305 10:130938290-130938312 CTGCCAGTGCAGGTGAGGGCTGG - Intergenic
1077134790 11:993125-993147 CTGAGGGTGCTGAGGAAGGCAGG + Intronic
1077228416 11:1448242-1448264 CTGCAGGAGCTGAGGAGGGCAGG + Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078062244 11:8055707-8055729 CTTCAGGTGGAGCTGAGGGCTGG + Intronic
1078574044 11:12483654-12483676 CTGTAGCTGCAGATGAATGCAGG + Intronic
1080233767 11:30046108-30046130 CTGCAGCTGCTGATAAAGGGAGG - Intergenic
1080646856 11:34193810-34193832 CTGCAGGAGTAGATGAAAGGAGG + Intronic
1083201514 11:61123760-61123782 CGGCAGGTGCAGCTGAGGGCAGG - Intronic
1083423078 11:62567008-62567030 TAGCTGGTGCAGAGGAAGGCAGG + Exonic
1084272847 11:68038414-68038436 CTGCAGGTGGAGCTGACAGCTGG + Intergenic
1085643454 11:78207785-78207807 CTGCTGGGGCAGGAGAAGGCGGG + Intronic
1085781043 11:79409529-79409551 CTGCAGGTTCCCATGAAGGAGGG + Intronic
1086969253 11:93063101-93063123 CTGCAGATGCAGATCAAGTTTGG - Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1088787016 11:113191193-113191215 CTGCAGGTGGACATTGAGGCTGG + Intronic
1089692601 11:120196221-120196243 CTGCAGGTCCACAAGAATGCAGG + Intergenic
1091994799 12:4985002-4985024 TTGCAGTGGCAGATGATGGCAGG + Intergenic
1094038243 12:26093798-26093820 CTGCATGTGCAGAGGTGGGCAGG + Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097963884 12:65558609-65558631 GTGCAGATGAAGATGATGGCAGG + Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1099103793 12:78476766-78476788 GTGGAGGTGGAGGTGAAGGCAGG - Intergenic
1099958022 12:89370076-89370098 GGGCAGCTGCAGGTGAAGGCGGG - Intergenic
1100947795 12:99806423-99806445 GTGCAGGTGCTGCTGGAGGCAGG - Exonic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1104127333 12:125861032-125861054 CTGCAGGTGCAGAGGAGCGGAGG + Intergenic
1104595076 12:130115345-130115367 CTGCAGGTCTAGCTGGAGGCAGG + Intergenic
1104700028 12:130895899-130895921 CTGCAGGGGCTGAGGAGGGCAGG + Intergenic
1104768763 12:131346833-131346855 CTGGAGGTGCAGAACGAGGCTGG + Intergenic
1105483164 13:20798272-20798294 GAGCATGTGAAGATGAAGGCAGG + Intronic
1106355998 13:28983898-28983920 CTGCAGGTGCAGATTAGCACAGG + Intronic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1110760698 13:79227455-79227477 CTTCAGTGGCAGTTGAAGGCAGG + Intergenic
1113731815 13:112647078-112647100 TTGCAATAGCAGATGAAGGCCGG - Exonic
1113944246 13:114034663-114034685 CTGCAGGTGCTGGCGCAGGCTGG + Intronic
1115301202 14:31887479-31887501 GTGCAGGTGCACATGACGACAGG - Intergenic
1117627419 14:57654002-57654024 CACCATGTGAAGATGAAGGCAGG - Intronic
1117806440 14:59496593-59496615 TTACAGGTGCAGATGAGGGTTGG - Intronic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1119407588 14:74408114-74408136 CCGCAGGTGGGGATGTAGGCTGG + Intronic
1120092095 14:80343829-80343851 CTCCATTTGAAGATGAAGGCAGG - Intronic
1121257843 14:92544297-92544319 TTCCAGGTGTAGATGTAGGCGGG - Intronic
1121692784 14:95889762-95889784 CTGCAGGTGCACAGGAAGGGAGG - Intergenic
1122623161 14:103071101-103071123 CTGCAAGTCCTGATGGAGGCCGG + Intergenic
1122860163 14:104578974-104578996 CTGCTGGTGCATGTAAAGGCAGG - Intronic
1123017419 14:105382041-105382063 CTACAGGTGCAGCTGCAGGTGGG + Exonic
1123139554 14:106062017-106062039 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1123144586 14:106116503-106116525 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1123149168 14:106165072-106165094 GAGCAGGTGCACATGGAGGCTGG - Intergenic
1123152482 14:106196567-106196589 GAGCAGGTGCACATGGAGGCTGG - Intergenic
1123156792 14:106234930-106234952 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1123163489 14:106302595-106302617 CGGCAGGTGGAAATCAAGGCTGG - Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123172646 14:106389259-106389281 GAGCAGGTGCACATGGAGGCTGG - Intergenic
1123187880 14:106537678-106537700 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1123212575 14:106775025-106775047 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1125968857 15:43895714-43895736 CCGCAGGGGCAGATGACAGCTGG + Intronic
1127374429 15:58370075-58370097 CTGCAGGTGAAGATGTATCCTGG + Intronic
1127618574 15:60711069-60711091 CTGCAGGGGCAGAGCAAGGCTGG - Intronic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1130645980 15:85727505-85727527 CTGCAGTTGCAGAAGACTGCTGG + Intronic
1131449546 15:92527985-92528007 TTGCTGGGGCAGATGAAGTCTGG - Intergenic
1131972004 15:97902837-97902859 CACCACGTGGAGATGAAGGCAGG - Intergenic
1132117974 15:99151436-99151458 CTCAAGGTGAAGATCAAGGCTGG - Intronic
1133346751 16:5076194-5076216 CTGGATGTGCACCTGAAGGCTGG - Intronic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1135777352 16:25268513-25268535 GAGCAGGTGCAGATAAAGGCTGG - Intergenic
1136233285 16:28900343-28900365 CTGCAGGTGCTGATGGTGCCAGG - Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136795114 16:33009733-33009755 GTGCAGGTGCTGCTGAGGGCTGG + Intergenic
1136874802 16:33844649-33844671 GTGCAGGTGCTGCTGAGGGCTGG - Intergenic
1137587251 16:49671055-49671077 CTGCAGCTGCATGTGAAGGAAGG - Intronic
1137595010 16:49717610-49717632 CTTCAGGTGCAGCTGAATCCAGG - Intronic
1137746745 16:50826960-50826982 CTGTTGGTGCAGATGAGGTCTGG + Intergenic
1138455232 16:57117139-57117161 CCGCAGGGGCAGGAGAAGGCCGG + Intronic
1139569218 16:67800228-67800250 CTGCAGGAGCAAGGGAAGGCTGG + Intronic
1139801112 16:69523701-69523723 CTCCAGGGGCAGATCAAAGCCGG + Intergenic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1142263946 16:89055007-89055029 CAGCAGCTGCAGAGGAAGGTGGG - Intergenic
1203097368 16_KI270728v1_random:1271388-1271410 GTGCAGGTGCTGCTGAGGGCTGG + Intergenic
1142857102 17:2737216-2737238 TTCCAGGGGCAGGTGAAGGCAGG - Intergenic
1143116902 17:4586057-4586079 CTACTGGTGCAGATGAGGGTGGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143544327 17:7587643-7587665 CTGCAAGTGCAGAGGAATGGAGG - Exonic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145823310 17:27857310-27857332 CTCCCGGTGCTGATGAAGGGAGG + Intronic
1146118822 17:30170876-30170898 CTGCTGGTGCAGATGTAGGCTGG - Intronic
1146271935 17:31490285-31490307 CTACGGGTACAGATGAAGGAGGG - Intronic
1146480611 17:33202169-33202191 CTGCTGGTTCTGATGCAGGCAGG - Intronic
1146507329 17:33416671-33416693 CAGCATGTGCAGATGAATGAGGG - Intronic
1146679053 17:34793962-34793984 TAGCAGGTGCATAAGAAGGCTGG + Intergenic
1147583490 17:41639416-41639438 CTCCAGGGGCAGATGAGGCCAGG + Intergenic
1147897835 17:43762770-43762792 CACCATGTGAAGATGAAGGCAGG - Intergenic
1148732199 17:49844122-49844144 CTGCAGCTGGAGCTGAATGCTGG + Exonic
1149530988 17:57395117-57395139 GGCCATGTGCAGATGAAGGCAGG - Intronic
1151602337 17:75113934-75113956 CTCCAGGTGCAGGGGAAGGACGG + Intronic
1151733589 17:75925194-75925216 CTGCAGGTGCTGAAGGAAGCGGG - Intronic
1151988206 17:77557525-77557547 CTGTGGGTGCTGATGCAGGCCGG - Intergenic
1153691158 18:7595151-7595173 CTGCTGCTGTTGATGAAGGCAGG + Intronic
1153772350 18:8426071-8426093 CTGCTGGGGCAGGTGAGGGCGGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1155422204 18:25667589-25667611 CCTTAGGTGCAGATGCAGGCAGG - Intergenic
1156482479 18:37444987-37445009 CTTCAGGTGCAGACAGAGGCTGG + Intronic
1157614480 18:48978508-48978530 CAGCAGGTGCAATTGAAGGAAGG + Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158186009 18:54772371-54772393 CAGCATGTGCAAATGAAGACTGG + Intronic
1158274311 18:55749870-55749892 CTGTAAGTGCATATGAAGGAGGG - Intergenic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1160006002 18:75069437-75069459 GTGGAGGTGCAGCTGAAGGCGGG - Intergenic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1160561135 18:79756292-79756314 CGGCTGGTGCTGATGGAGGCTGG - Exonic
1161250692 19:3278655-3278677 CTGCAGGTGCATTTGTGGGCAGG + Intronic
1161302225 19:3548201-3548223 CTGCAGGTGCAGCAGGAGCCAGG + Exonic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1162337045 19:10068174-10068196 CTGCAGGAGATGATGGAGGCCGG + Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1162536173 19:11263842-11263864 CTGCCGGTGCAGAGGCATGCAGG - Intergenic
1164061419 19:21678435-21678457 CTGCTGGTGCAGAGCGAGGCTGG - Intergenic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164129939 19:22352628-22352650 AAGCAGGTGCAATTGAAGGCAGG - Intergenic
1164161550 19:22628506-22628528 CTGCAGGGGCACATGAGGGCTGG - Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1164169607 19:22713386-22713408 AAGCAGGTGCAATTGAAGGCAGG + Intergenic
1165044309 19:33092559-33092581 GTGGCGGTGCAGAGGAAGGCAGG + Intronic
1167619897 19:50554988-50555010 CTGCAGGGGCTGAGGAAGGGTGG - Intronic
1168218010 19:54940450-54940472 CTGCAGGTGAAAAGGAAGGATGG - Exonic
1168343581 19:55640115-55640137 CTGCAGGTGCAGCTGAGAGTGGG - Intronic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
925983581 2:9196854-9196876 TGCCAAGTGCAGATGAAGGCAGG + Intergenic
926332470 2:11836959-11836981 CTGCAGGTGCTGATGTTGGGGGG - Intergenic
926621043 2:15047645-15047667 GGGCCTGTGCAGATGAAGGCTGG + Intergenic
928100766 2:28436313-28436335 GTGCAGGTGCAGATCTGGGCTGG - Intergenic
931267318 2:60672256-60672278 TTGCAGGTGCAGATAAATGCTGG + Intergenic
931845321 2:66197919-66197941 CTCCAGGTGCCTATGAAGGGTGG + Intergenic
932174629 2:69588325-69588347 CTGAAGGTGCAGGTGATGTCAGG - Intronic
932702911 2:74003104-74003126 TTGCAGGTGGAAATAAAGGCTGG + Exonic
933775276 2:85767858-85767880 CTGCAGGGGCACAGGAGGGCAGG + Intronic
934723979 2:96603072-96603094 CAGCAGGTGCAGAGCAAGTCCGG - Intronic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
937986752 2:127641457-127641479 CTGCATGTGAGGATGAGGGCTGG + Intronic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
940068092 2:149652381-149652403 CTGCAGTTGCAACTCAAGGCTGG - Intergenic
940750917 2:157626463-157626485 CTGCAGATCCAGATGAAAGGTGG + Intronic
941806545 2:169716394-169716416 CTGCAGCTGCTGATGAAGGGAGG + Intronic
942389229 2:175475161-175475183 CTGCAGGTGCAGATGGTTCCAGG + Intergenic
942626264 2:177903870-177903892 CTGGAGTTCCAGATGAAAGCAGG + Intronic
944921741 2:204421298-204421320 CTGGAGGTGGAGGTGGAGGCTGG - Intergenic
945119107 2:206440580-206440602 CTGCAGTCGTAGGTGAAGGCAGG - Intergenic
945180647 2:207087727-207087749 CTGCAGGCCAAGGTGAAGGCAGG - Intronic
946404497 2:219485095-219485117 CAGCAGGTGCAGAGGAGGGTGGG + Intronic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
947301102 2:228689293-228689315 AGGCAGGAGCAGATGAAGGGAGG - Intergenic
948043114 2:234919984-234920006 CTCCAGGTGCAGACAAAGGCTGG - Intergenic
948678041 2:239610639-239610661 CTGCAGGTGTGGATGCAGGGAGG + Intergenic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
1169311271 20:4542389-4542411 GTCCAGGTGCAGATTAAGGGAGG + Intergenic
1169742160 20:8906764-8906786 CTGCAAGGGGAGAGGAAGGCAGG + Intronic
1170885974 20:20340122-20340144 CTCCAGGTGCCCATGATGGCTGG - Intronic
1171133187 20:22674020-22674042 CTCCAGGTGCAGCAGAGGGCAGG + Intergenic
1175252181 20:57616426-57616448 CTGCAGGTGCTGACAGAGGCTGG - Exonic
1175544542 20:59769719-59769741 CAGCAAGTGCAGATGATGGTTGG + Intronic
1175595071 20:60224464-60224486 CTGCTGCTGCAGCTGATGGCAGG + Intergenic
1175751303 20:61499792-61499814 CTCAAGGTGCAGATGAATTCAGG - Intronic
1176062748 20:63179377-63179399 CTGCGGCTGCAGATGGCGGCGGG - Intergenic
1176662673 21:9653807-9653829 CTGGAGCTGCAGATGATGTCAGG + Intergenic
1178498366 21:33105628-33105650 CTGCTGGGGAAGATGAAGGCTGG - Intergenic
1179071691 21:38077399-38077421 CTGCAGGAGCTGCTCAAGGCAGG + Intronic
1179080785 21:38168891-38168913 GTGCAGGTGCAGGTCAAGACAGG + Intronic
1179343505 21:40534520-40534542 CTCCAGGTCCACATCAAGGCGGG - Intronic
1179649039 21:42794721-42794743 CTGCAGGCACAGCTGAAAGCTGG + Intergenic
1180063652 21:45402265-45402287 TGGCAGGTGCAGGTGGAGGCAGG + Intergenic
1181343510 22:22200854-22200876 CTGCAGGAGCATATGGAGGGTGG - Intergenic
1181838942 22:25637853-25637875 CTGATGGTGCAGATGAAGTCTGG + Intronic
1183468003 22:37989790-37989812 CTGCAAGTGCAGCTGCAGGTTGG + Intronic
1184355818 22:43978963-43978985 TGGCAGGGGCAGAGGAAGGCAGG - Intronic
1185011495 22:48317034-48317056 CTGCAGGTGCAGGACAAAGCAGG + Intergenic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
950798453 3:15530379-15530401 CTGAAGGTGGAGATGATGGTTGG + Intergenic
950854504 3:16092414-16092436 CGGCAGGTGGAGCTGGAGGCAGG - Intergenic
952218116 3:31297623-31297645 CTGCAGCTGCAGATGAGCTCTGG + Intergenic
953882056 3:46695701-46695723 CTGCACGTGCAGCTGAGGGAAGG + Intergenic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
955640570 3:61078554-61078576 CTGCATGGGTAGATGAAAGCAGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
959162228 3:102736829-102736851 CTGCAGCTGCTGATGAAGGGAGG - Intergenic
959518702 3:107301295-107301317 CTGCAGGTCAAAATGGAGGCGGG - Intergenic
959910942 3:111763008-111763030 TTGCAGGTGCAGAAGAGGGTGGG - Intronic
960040748 3:113148088-113148110 CTCCAGTTGAAAATGAAGGCAGG + Intergenic
960534544 3:118802213-118802235 CTGCAGCTGCTGACGAAGGGAGG + Intergenic
961543857 3:127618548-127618570 GTGCAGGTGCAGGTGAGGGAAGG - Intronic
961673388 3:128550431-128550453 CTTCAGGTGCAGGTGAATCCAGG - Intergenic
962204676 3:133425086-133425108 CTGCTGGTGAGGAAGAAGGCAGG - Intronic
963490983 3:145999939-145999961 CAGCAGGTACCGATAAAGGCTGG - Intergenic
966248319 3:177833599-177833621 ATGCACGTGCAGAAGAAGACAGG + Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
969302135 4:6303425-6303447 CTCCAGCTGGAGATGAAGCCAGG - Intergenic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969527020 4:7709031-7709053 CTGCAGCTGCAGGAAAAGGCAGG - Intronic
969570579 4:8005967-8005989 CTGCCTGTGCAGATGCACGCAGG - Intronic
969869363 4:10095089-10095111 CAGAAGGCGCAGATGAAGACAGG + Intronic
970967853 4:21948794-21948816 CTGCAGGTGCGGGCGGAGGCCGG + Exonic
971311620 4:25530157-25530179 CTCCGGGTGCAGATGGTGGCAGG - Intergenic
971392586 4:26199980-26200002 CTGCAGTTGATGATGGAGGCCGG + Intronic
972634360 4:40870255-40870277 CTGCCAGTGCAGATGAGGGAGGG + Intronic
974766489 4:66353973-66353995 CTGAAGGTGATGAAGAAGGCAGG - Intergenic
980988244 4:139716240-139716262 CTGTGGGTGCAGGTGAAGCCAGG + Intronic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
983548714 4:168992464-168992486 ATGCAGGTGCAGATGCAGTTTGG - Intronic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
985412665 4:189702374-189702396 CTGGAGCTGCAGATGATGTCAGG - Intergenic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
985917084 5:2930340-2930362 GTGCAGGAGCATAAGAAGGCAGG - Intergenic
986087693 5:4468129-4468151 ATGCTGGTGAAGATGAAGGGTGG + Intergenic
986564306 5:9096110-9096132 CTGTTGGTGGAGATGTAGGCCGG - Intronic
987319657 5:16756725-16756747 TTCCAGGTGCAGGCGAAGGCAGG - Intronic
988939954 5:36134587-36134609 CACCATGTGAAGATGAAGGCAGG + Intronic
989997507 5:50853415-50853437 GTGCCAGTGCAGATGAGGGCAGG - Intergenic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
991001688 5:61789569-61789591 CTGCAGGAGCAGTTGAATTCCGG + Intergenic
991329053 5:65472260-65472282 CTACAGCTGGAGGTGAAGGCTGG + Intronic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
992287048 5:75246778-75246800 CACCAGGTGATGATGAAGGCAGG - Intergenic
993840700 5:92875623-92875645 TTGCAGGGGCAGATGTGGGCAGG + Intergenic
994690281 5:103010124-103010146 CTGCACCTGCATATGATGGCAGG + Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997303759 5:132824299-132824321 CTGCAGGGGCAGATGACTGCTGG - Exonic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999368240 5:151036870-151036892 CTGTTGGTGGAGATGATGGCGGG + Exonic
1000683309 5:164214752-164214774 ATGCAGGTGGTGATGATGGCTGG - Intergenic
1001656041 5:173351016-173351038 CTGAAGGTTCAGATGATTGCTGG + Intergenic
1002759485 6:190761-190783 CTGGAGGTGAAGGTGCAGGCTGG - Intergenic
1002819048 6:706784-706806 AGGCAGTGGCAGATGAAGGCAGG + Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1002951425 6:1816104-1816126 CTTCAGGGTCAGATCAAGGCAGG - Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003336162 6:5174976-5174998 ATTCATGTGCAGATGAAGGAAGG + Intronic
1003674658 6:8192217-8192239 CGGCAGTTATAGATGAAGGCGGG - Intergenic
1003688039 6:8323784-8323806 CTGCAAGAGTAAATGAAGGCAGG - Intergenic
1004351457 6:14893655-14893677 ATGCAGGTGCAGATAAAGGAAGG - Intergenic
1004493010 6:16135071-16135093 CTGCTGGTACAGAAGAGGGCTGG - Intronic
1005398466 6:25407449-25407471 GTACAGCTGCAGATGCAGGCAGG + Intronic
1006017284 6:31092051-31092073 CTGCAGGGGAACATGAAGACAGG - Intergenic
1006390487 6:33755311-33755333 CTGCAGGTGCAGATAAAATTAGG + Intergenic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1008665624 6:53712975-53712997 CTGCAAATCCACATGAAGGCTGG - Intergenic
1011449020 6:87473190-87473212 CTGCAGCCGCAGCGGAAGGCAGG - Intronic
1011657370 6:89564026-89564048 ATGCACCTGCAGGTGAAGGCTGG + Intronic
1014344121 6:120245914-120245936 GTTCAGTTGCAGATGAAGGATGG - Intergenic
1017732509 6:157330088-157330110 ATTCAGGTCAAGATGAAGGCTGG + Intergenic
1017844590 6:158245454-158245476 GTGCTGGTGCAGATGAAGGGAGG + Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018908399 6:168088257-168088279 CAGCAGGGGCAGGTGACGGCGGG - Intergenic
1019378244 7:707722-707744 CACCATGTGAAGATGAAGGCAGG + Intronic
1022905137 7:34848479-34848501 CTCCAACAGCAGATGAAGGCTGG - Exonic
1023280216 7:38561612-38561634 CTTCCGGTTCAGATGAAGGAGGG + Intronic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1024527652 7:50362408-50362430 CTGAAGGTGAAAAAGAAGGCAGG - Intronic
1024718730 7:52110232-52110254 CTGAAGGGAAAGATGAAGGCAGG + Intergenic
1026088038 7:67278772-67278794 CTGGGGGTGCAGTTGACGGCTGG - Intergenic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1029704173 7:102267116-102267138 CTACAGGTGCAGAGGCAGGGAGG + Intronic
1031057586 7:117010483-117010505 ATGCTGATGCAGATGCAGGCTGG + Intronic
1031478361 7:122249318-122249340 CACCATGTGAAGATGAAGGCAGG + Intergenic
1033210810 7:139458936-139458958 CTGCAGGTGCTGAGGCAGGGTGG - Intronic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1034073043 7:148206532-148206554 CTGCAGGTGCTGCTGAAGAAAGG - Intronic
1034835911 7:154351529-154351551 CTCCAGGTGCAGGTGCAGGTGGG - Intronic
1034840579 7:154391744-154391766 GTGTGGGTGCTGATGAAGGCAGG + Intronic
1035049999 7:155993266-155993288 CAGCAGGGGCTGATGGAGGCAGG - Intergenic
1035644352 8:1206783-1206805 CTGCAGGTGCAGACAAAGAATGG - Intergenic
1036692114 8:10950562-10950584 CAGCAGGTGCAAATGAAGAAAGG + Intronic
1036711854 8:11084993-11085015 CTGCAGGTGCACCTGGATGCAGG - Intronic
1039612041 8:38927876-38927898 CTGGAGCTGGAGATGACGGCTGG + Intronic
1039916233 8:41862348-41862370 ATGCAGGTGCATTGGAAGGCAGG + Intronic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1041004290 8:53484105-53484127 CTGCAGCTGCTGACGAAGGGAGG - Intergenic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1046198623 8:110893374-110893396 CTGCAGCTGTTGATGAAGGGAGG + Intergenic
1047348702 8:124053151-124053173 CTGCATCTGCCAATGAAGGCTGG + Intronic
1048695447 8:137023001-137023023 CTGCAGGTGCAGATCAAGTAAGG - Intergenic
1048766688 8:137852279-137852301 CTTCAGAGGCAGATGCAGGCTGG - Intergenic
1049207881 8:141371833-141371855 ATACATGTGGAGATGAAGGCCGG + Intergenic
1049386555 8:142345669-142345691 ATGCAGGTGCTGAGGAGGGCAGG - Intronic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049799939 8:144513029-144513051 GTGCAGGTGCAGGTGCAGGCTGG + Exonic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1053274645 9:36774055-36774077 CTCCAGCAGCAGATGAAGTCTGG - Intergenic
1056488701 9:87084425-87084447 ATCCCGGTGCAGCTGAAGGCTGG - Intergenic
1056676771 9:88682665-88682687 CTGGAGGTGAAGACGAAGCCAGG + Intergenic
1057274912 9:93671047-93671069 GTGCAGGTGTAGATGCAGGTGGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1060268501 9:122125993-122126015 CTGCAGGTACAGCAGCAGGCAGG - Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060804438 9:126565574-126565596 CTGCGGGTGCAGCTGCATGCAGG + Intergenic
1060818549 9:126648693-126648715 CTTCAGGTGAAGATGAGGCCTGG + Intronic
1061045781 9:128164080-128164102 CAGAAGGTGCAGGTGAGGGCAGG + Intergenic
1061543047 9:131288625-131288647 CTGCTCGCCCAGATGAAGGCAGG - Intergenic
1062321524 9:135992695-135992717 CTGCAGGTGCCCAGCAAGGCAGG - Intergenic
1062394964 9:136349113-136349135 CTGCAGGTGCAGACACTGGCTGG + Intronic
1203669926 Un_KI270755v1:612-634 CTGGAGCTGCAGATGATGTCAGG + Intergenic
1189745847 X:44168175-44168197 CTCCAGGTGCCAATAAAGGCAGG + Intronic
1189808157 X:44755547-44755569 CTGCAGCTTCACATGAAGTCAGG - Intergenic
1190813337 X:53906320-53906342 CTGCAAGTGGAGATGAAAGAAGG + Intergenic
1192143594 X:68665511-68665533 CTGCAGGTGAAGAAGAACGCTGG + Exonic
1192553062 X:72069288-72069310 CTGCAGAGGCAGATGAAGTGGGG + Intergenic
1195068525 X:101258541-101258563 CTGCAGGTGAGGATGGAGACAGG + Exonic
1196743965 X:119051411-119051433 TTGCAGGTGGAAATGAAGGTGGG + Intergenic
1197172040 X:123445015-123445037 CTGCTGATGTAGATAAAGGCTGG - Intronic
1199680286 X:150219764-150219786 CTGCGGAGGCAGAGGAAGGCTGG + Intergenic
1199716017 X:150507860-150507882 GGGCAGGGGCAGATGGAGGCTGG - Intronic
1200286840 X:154830862-154830884 CTTCAGCCGCAGCTGAAGGCGGG - Exonic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic
1202604146 Y:26624900-26624922 CTTCTGATGCAGATGAAGTCTGG - Intergenic