ID: 920624146

View in Genome Browser
Species Human (GRCh38)
Location 1:207579625-207579647
Sequence GAGTGGATCAATGCAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920624146_920624149 2 Left 920624146 1:207579625-207579647 CCTCAATCTGCATTGATCCACTC No data
Right 920624149 1:207579650-207579672 TAATTTACATGTAACTGAAATGG 0: 1
1: 0
2: 8
3: 47
4: 484
920624146_920624150 3 Left 920624146 1:207579625-207579647 CCTCAATCTGCATTGATCCACTC No data
Right 920624150 1:207579651-207579673 AATTTACATGTAACTGAAATGGG 0: 1
1: 0
2: 15
3: 91
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920624146 Original CRISPR GAGTGGATCAATGCAGATTG AGG (reversed) Intronic
No off target data available for this crispr