ID: 920624558

View in Genome Browser
Species Human (GRCh38)
Location 1:207584420-207584442
Sequence TAGGATGCTTAATTTGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920624558 Original CRISPR TAGGATGCTTAATTTGGGAA AGG Intronic
901367132 1:8762202-8762224 TAGGAGGCTGAAATTGGTAAGGG - Intronic
909113322 1:71505994-71506016 TAGGATGCCTGATTAGTGAAGGG + Intronic
910006954 1:82409333-82409355 TAGGATGCTTAAATTAAGAAAGG - Intergenic
913690222 1:121272560-121272582 GAGGATTCTTAATTTGGTGAAGG + Intronic
914147318 1:145007399-145007421 GAGGATTCTTAATTTGGTGAAGG - Intronic
915802854 1:158812937-158812959 TAAAATGCTTAATTTGGAATGGG + Intergenic
916988472 1:170216655-170216677 TAGGCTGATTAGTTGGGGAATGG - Intergenic
917537418 1:175884451-175884473 TAGGTTGCTGCATTTGGGAGGGG + Intergenic
918651404 1:186967888-186967910 TAGGATGATTAATCTGACAATGG + Intronic
920477542 1:206291047-206291069 GAGGATTCTTAATTTGGTGAAGG + Intronic
920624558 1:207584420-207584442 TAGGATGCTTAATTTGGGAAAGG + Intronic
921566487 1:216727786-216727808 TAGGCTCCATAATTTGGGAATGG - Intronic
921658700 1:217772917-217772939 TAGGATGTTGCATTTGGGATAGG + Intronic
921658713 1:217772993-217773015 TAGGATGTTGCATTTGGGATAGG + Intronic
921658719 1:217773031-217773053 TAGGATGTTGCATTTGGGATAGG + Intronic
922745183 1:228039305-228039327 TGGGCTGCTTAGTCTGGGAAGGG - Intronic
1064617531 10:17176976-17176998 AAGGAGGCAGAATTTGGGAAAGG + Intronic
1067935957 10:50612160-50612182 GAAGATGCTTAAATTTGGAAGGG - Intronic
1068808811 10:61231975-61231997 AAGGAGGCTTGTTTTGGGAAAGG + Intergenic
1069096995 10:64271070-64271092 TAAGATGATTAATTTGGATAGGG + Intergenic
1069164232 10:65130532-65130554 CAGCATGCTTAATTTGTGAAGGG - Intergenic
1069457169 10:68561928-68561950 AAGGTTGGTTAATTTGGGAGAGG - Intronic
1071417231 10:85452657-85452679 CAGGAGGCTTAGTGTGGGAATGG - Intergenic
1071921159 10:90352076-90352098 TAGCATGCTCAAGCTGGGAAAGG + Intergenic
1072749528 10:97967646-97967668 TAGGATGATTCATGTGGTAATGG - Intronic
1073037404 10:100573822-100573844 TTGGATGGATGATTTGGGAATGG + Intergenic
1073980702 10:109150103-109150125 AAGGATGTTTGGTTTGGGAAAGG + Intergenic
1076466776 10:130688404-130688426 CAGGATGCTTACTCTGGGACAGG - Intergenic
1077005517 11:353774-353796 TGGGATACTGGATTTGGGAAAGG + Intergenic
1078653057 11:13213663-13213685 AAGGATGCATCATTAGGGAAGGG + Intergenic
1079655088 11:22976682-22976704 AAGGATGCTAGATTTGGGAGGGG + Intergenic
1080209112 11:29765072-29765094 TGGGCAGCTTAATTTGGTAAGGG - Intergenic
1081135298 11:39432883-39432905 TAGGATACTCAATTTTGGTATGG - Intergenic
1081515216 11:43822244-43822266 TTGTTTGCTTTATTTGGGAATGG + Intronic
1084309674 11:68309671-68309693 CAGGTTTCTAAATTTGGGAAGGG - Intergenic
1085852962 11:80142822-80142844 CAGGATGCTTAATTTCAAAATGG + Intergenic
1088059920 11:105634928-105634950 TAGGGTGTGTAATTTGGGAGCGG + Intronic
1090233123 11:125124421-125124443 TATGGTGCTTAAGTTGGAAATGG - Intergenic
1092270829 12:7021958-7021980 AAGGTGGCTTAGTTTGGGAAAGG - Intronic
1092894353 12:12998729-12998751 TACGATGCCTCATTTGTGAAAGG - Intronic
1093548855 12:20382994-20383016 TAGGATGCCTCATTTGGCAGTGG - Intronic
1093727623 12:22533142-22533164 AAAGATGTTTAACTTGGGAAGGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1098799043 12:74930310-74930332 TAGGATGAATAACTTAGGAAGGG + Intergenic
1099526243 12:83722041-83722063 GAGGATTATTAAGTTGGGAAAGG + Intergenic
1103224146 12:119272401-119272423 TAGGAAGGTTAAGTTGGGAGGGG - Intergenic
1104640996 12:130467166-130467188 AAGGAGGCTTGTTTTGGGAAAGG - Intronic
1106011958 13:25832646-25832668 TAGAGTTCTTATTTTGGGAATGG - Intronic
1106372800 13:29152974-29152996 TGGGAGGCTTAATGTGTGAAAGG + Intronic
1107292342 13:38869051-38869073 TGAGATGCCAAATTTGGGAAAGG - Intronic
1107679531 13:42834020-42834042 TAAAATGCTTCATTTGGGACTGG - Intergenic
1108066388 13:46581838-46581860 AAGGATGATTAATTATGGAATGG - Intronic
1109928872 13:69185538-69185560 TAGGATGAGTAATTTGGAAATGG + Intergenic
1111438962 13:88253067-88253089 TAGAATGTATAATTTGGAAAGGG + Intergenic
1113348048 13:109499859-109499881 GAGGATGGTGCATTTGGGAAAGG + Intergenic
1115127110 14:30008979-30009001 AATGATAATTAATTTGGGAAGGG + Intronic
1115157347 14:30356297-30356319 TAGGATTCTTAACTCTGGAAAGG - Intergenic
1118099639 14:62582384-62582406 TTGGATCAGTAATTTGGGAAAGG - Intergenic
1120655272 14:87181756-87181778 AAGGATTCTTGATTTGGGGATGG - Intergenic
1125418459 15:39477828-39477850 TACTATGTTTAATTTGAGAATGG + Intergenic
1126533790 15:49738613-49738635 TTTGATGCTTAATTTGGTGAAGG - Intergenic
1126662252 15:51044796-51044818 AAGGATGCCTAAATAGGGAATGG + Intergenic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1131673320 15:94645511-94645533 GAGGATGCTCAGCTTGGGAAGGG - Intergenic
1131735404 15:95326627-95326649 TAAGATGCTTACCTTTGGAAGGG - Intergenic
1133069635 16:3236208-3236230 TAGGAAGCTGAAATTGAGAAAGG - Intronic
1133568230 16:7015513-7015535 ATTGATGCTTGATTTGGGAAGGG - Intronic
1136547497 16:30964011-30964033 TAGGATTCCTGGTTTGGGAAAGG + Intronic
1137811490 16:51357008-51357030 AAGGAAGCTTTATTTGGGATGGG + Intergenic
1138028980 16:53544055-53544077 ACTGCTGCTTAATTTGGGAAAGG - Intergenic
1140848132 16:78909002-78909024 AAGGTTGTTTATTTTGGGAAAGG + Intronic
1144016022 17:11197175-11197197 TAGGAGGTTTGTTTTGGGAAGGG - Intergenic
1145066986 17:19768198-19768220 TAAGTTGCTTATTTTGGTAAAGG - Intergenic
1145753771 17:27374782-27374804 GAGGATGCAAGATTTGGGAATGG + Intergenic
1146236375 17:31168464-31168486 TAGGATGCGTACTTTGGAATTGG + Intronic
1146478171 17:33180041-33180063 TAGGTTTCTTAAAGTGGGAATGG - Intronic
1147657630 17:42099585-42099607 TAGGTTGCTTCATCAGGGAAAGG - Intergenic
1148021325 17:44556096-44556118 TAGGATTTTAAATTTGGAAAGGG - Intergenic
1152420864 17:80192461-80192483 CAGGCTGGTTAATTCGGGAAAGG - Intronic
1153835728 18:8962407-8962429 TAGGATCCTAAATATGGGACAGG - Intergenic
1154016444 18:10622363-10622385 TAGCTTGCTTTGTTTGGGAAAGG - Intergenic
1154157445 18:11955005-11955027 TAGGATGCTTATCTTGGAGAAGG - Intergenic
1154189067 18:12213303-12213325 TAGCTTGCTTTGTTTGGGAAAGG + Intergenic
1155996114 18:32333057-32333079 TAGGCTGCTGAACTTTGGAATGG + Intronic
1156439707 18:37172065-37172087 CAGTATGCTAACTTTGGGAATGG - Intronic
1157167879 18:45375180-45375202 AAGGAGGTTTATTTTGGGAAAGG - Intronic
1157322848 18:46647388-46647410 GAGGATGCTGAATGTGTGAAAGG + Intronic
1158899009 18:61944451-61944473 TAGGATTCTGAATTTAGTAATGG - Intergenic
1159112583 18:64076498-64076520 TAGGAGGTTTGTTTTGGGAAAGG - Intergenic
1163110356 19:15156944-15156966 TGGCATGCTGAAGTTGGGAAGGG - Intergenic
1166037958 19:40182932-40182954 GAGGAGGCTTAATTGAGGAAGGG + Intergenic
925635201 2:5935755-5935777 TAGGTTTATTAATTTGGAAAAGG + Intergenic
925929805 2:8697928-8697950 ATGAATGCTTAATTTGGGAGAGG - Intergenic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
928350333 2:30547001-30547023 GTGGGGGCTTAATTTGGGAAGGG - Intronic
931829774 2:66038724-66038746 TTTGCTGCTTCATTTGGGAAAGG - Intergenic
935089753 2:99883700-99883722 TAGGATGTTTCAGTTGGGAAGGG - Intronic
937714378 2:125014780-125014802 TAGGTTGCTTAATTATGGCATGG - Intergenic
937742159 2:125368095-125368117 TAGGCAGCAGAATTTGGGAAGGG - Intergenic
939007835 2:136809671-136809693 GAGGATTCTTAGCTTGGGAATGG + Intronic
939711726 2:145529587-145529609 TAGGATGTTTAATTAATGAATGG + Intergenic
944746884 2:202666112-202666134 TAGTTTGCTTAAATTGGGAATGG + Intronic
1169665549 20:8032000-8032022 CAGCATGCTTTATTTAGGAATGG + Intergenic
1170242004 20:14176891-14176913 TAAGCTCCTAAATTTGGGAATGG - Intronic
1173109899 20:40176728-40176750 TATGATGCCCATTTTGGGAAGGG - Intergenic
1177891482 21:26809198-26809220 TATAATACTTAATTTGGCAAGGG - Intergenic
1178097547 21:29232180-29232202 AAGGAGGCTTGTTTTGGGAAAGG + Intronic
1178274568 21:31225326-31225348 TTGAATTCTTAATTTGGAAAAGG - Intronic
1178688887 21:34734304-34734326 TATGGTGCCTAATATGGGAATGG - Intergenic
1182916693 22:34039715-34039737 GAGGATGGTTTATTTTGGAAAGG - Intergenic
1184579012 22:45399990-45400012 TAGAATGATTAATGTGGTAATGG + Intronic
950765469 3:15269942-15269964 TGGGATGCTTATTTTTTGAAAGG - Intronic
951427946 3:22570741-22570763 AATGATGATTAATTTTGGAAGGG - Intergenic
956987753 3:74722765-74722787 TATGATGATTAATATGTGAAAGG - Intergenic
957767488 3:84644831-84644853 TAGCATGCTTAATTTGTGCCAGG - Intergenic
959153608 3:102638941-102638963 TAGGATTCTGACTTTTGGAATGG + Intergenic
960047113 3:113209581-113209603 TAGGATGATTAAGTAGGAAAAGG + Intergenic
960339057 3:116453102-116453124 TAGGGAGCTTATTTTGGCAACGG + Intronic
963574387 3:147041520-147041542 TTGAATGCCTAATTAGGGAAAGG + Intergenic
964986818 3:162752530-162752552 AAGGAGGTTTACTTTGGGAAAGG - Intergenic
965504515 3:169497689-169497711 TAGGATGTTTGTTTTGGCAAAGG - Intronic
966630099 3:182063112-182063134 CAGGATGTTTCATTTGGGGATGG - Intergenic
966936601 3:184713959-184713981 TAGGATGTTTGGTTTGGGGAGGG - Intergenic
967510543 3:190306085-190306107 TAGGATAGTTAGTTTGGAAATGG - Exonic
970038774 4:11772140-11772162 TAAGATGCTTTATCTGGAAAGGG - Intergenic
970708735 4:18836716-18836738 GAGGATTATTAATTTAGGAAGGG - Intergenic
971133655 4:23841552-23841574 TTGGCTGCTTAATTTGGTCATGG - Intronic
975628183 4:76370955-76370977 TAGGATGAGAAATTTAGGAAAGG - Intronic
976516566 4:85974452-85974474 TAGGATACATCATTTGGGGAGGG - Intronic
976867180 4:89743426-89743448 GATGATGTTTAATTTGGGAAAGG + Intronic
976912886 4:90329228-90329250 AAGAATGATTGATTTGGGAAAGG + Intronic
977673331 4:99720661-99720683 GAGAATCCTTAGTTTGGGAAAGG + Intergenic
978140671 4:105314111-105314133 TAGGAGGCTTTATTTGGCATTGG - Intergenic
979843065 4:125470286-125470308 TAGGATTTTTAATATGGAAAAGG + Intronic
983147115 4:164230073-164230095 AAGGATGCTTAACTGGGGACTGG - Intronic
983859273 4:172685050-172685072 TAGAATGCTTAATATGTGCAAGG - Intronic
985441640 4:189985735-189985757 TAGGTTCCTTAATTTTGGACAGG + Intergenic
986902890 5:12458833-12458855 TAGGCTTCTAAATTCGGGAATGG - Intergenic
987395363 5:17418035-17418057 AAGGAGGCTTGTTTTGGGAAAGG - Intergenic
987771354 5:22309849-22309871 TAAGATGTTTAATTTGGGAAGGG + Intronic
987799037 5:22669130-22669152 TAGTATGCTGTATTTGAGAATGG - Intronic
988707110 5:33737292-33737314 TGGGAAACTTAATTAGGGAAGGG - Intronic
989887130 5:46903815-46903837 TGTGAGGCTTAATTTGGAAACGG + Intergenic
990894876 5:60688074-60688096 TAGGTTGCTTATTATGTGAAAGG + Intronic
990898930 5:60729242-60729264 TGGGATGCTGAAGTTGGGCAGGG + Intergenic
992509526 5:77419238-77419260 TTGGATGGTTAATTTGGGGCAGG + Intronic
992963048 5:81974343-81974365 AAGGAATCTTAATTAGGGAATGG + Intronic
993390586 5:87315658-87315680 TAGAATGTTTAATATGGGAGAGG + Intronic
994603074 5:101932652-101932674 TAGAATGATAAATTTGGTAATGG + Intergenic
994772908 5:104006030-104006052 TAACATGCGTAATGTGGGAATGG + Intergenic
995310593 5:110705927-110705949 AAGGATGCTTCTGTTGGGAAGGG + Intronic
995376055 5:111475541-111475563 TAGTTTGCATAATTTGGTAATGG - Intronic
995647934 5:114334175-114334197 TAGCTTTCTTAATTTGAGAAGGG - Intergenic
995662565 5:114501256-114501278 TAGGCTTCTTTATTTGGGAGTGG - Intergenic
997275993 5:132590663-132590685 TAGAATGCTTACTTTGGTAATGG - Intronic
998480108 5:142455994-142456016 TAATATGCTTGATTTGGAAAAGG + Intergenic
999806022 5:155082040-155082062 AAGGAGGTTTATTTTGGGAAAGG + Intergenic
1000189656 5:158897806-158897828 TAAGATGATTAGTTTGGAAATGG + Intronic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1002095747 5:176829713-176829735 TAGGATGCCCAATATGGCAAGGG - Intronic
1004399597 6:15276141-15276163 TAGGCAGCTTAAATAGGGAAGGG - Intronic
1005773855 6:29107636-29107658 TAGGTAGTCTAATTTGGGAATGG - Intergenic
1012979330 6:105813133-105813155 TAGCAAGCTTATTTTGGGCAAGG + Intergenic
1013951391 6:115786642-115786664 AAGGAATCTTAACTTGGGAAGGG - Intergenic
1015237489 6:130987756-130987778 TAGGAGGCTAAAATTGGGAAAGG + Intronic
1017511045 6:155114761-155114783 TAAGATGTTTGATTTGTGAAAGG + Intronic
1018205529 6:161434191-161434213 TAGAATGCTTACTATTGGAATGG - Intronic
1021032185 7:15751119-15751141 TAGGATGCTGTATTTTTGAATGG - Intergenic
1022559210 7:31332099-31332121 TAGGAAGATTAATTTGGCATTGG + Intergenic
1023042663 7:36185668-36185690 TAGGATGCATGATTTGGAAAGGG - Intronic
1023481573 7:40640817-40640839 TAGTCTGCTTCATTTGGCAAAGG - Intronic
1024493649 7:50016687-50016709 TAGGATAATTTATTTGGAAATGG - Intronic
1024960173 7:54966176-54966198 TAGGATACTTTTCTTGGGAAGGG + Intergenic
1025875551 7:65477293-65477315 GACGTTTCTTAATTTGGGAAAGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1031507700 7:122606898-122606920 TAGGATGTATAATTTGGCGAGGG + Intronic
1031869899 7:127080136-127080158 AAGGGTCCTTAAATTGGGAAGGG + Intronic
1032839866 7:135705242-135705264 TAGTATGTTTAATTTGTTAACGG - Intronic
1034482667 7:151334714-151334736 AAGGTGGCTTAATTTTGGAAAGG - Intergenic
1035839590 8:2796007-2796029 TAGGATGGAAAATATGGGAAGGG - Intergenic
1036048017 8:5165595-5165617 AAGGAAGTTTAGTTTGGGAAAGG + Intergenic
1036999507 8:13701355-13701377 TACAATGCTTCTTTTGGGAATGG + Intergenic
1037107786 8:15130749-15130771 TAGTATGCATAATTTTGGCATGG - Intronic
1037730492 8:21519630-21519652 TAAGATGCTTAATTTACGAAGGG - Intergenic
1040435840 8:47390760-47390782 TTGGATGATTAAGCTGGGAATGG + Intronic
1046289751 8:112142111-112142133 TTTCCTGCTTAATTTGGGAAGGG - Intergenic
1046442698 8:114279804-114279826 TAAGCTGCTAAATTTGGGGATGG - Intergenic
1046522575 8:115344297-115344319 TATGAGGCTTATATTGGGAAAGG - Intergenic
1047131668 8:122027369-122027391 TATGATGCTTGATTTGAAAAGGG + Intergenic
1048012121 8:130466343-130466365 TAGGTTACTTTATTTGGAAATGG - Intergenic
1051388306 9:16535646-16535668 TAGGAAGCTTCATTTGGTAGTGG - Intronic
1052163962 9:25299048-25299070 TTGGATGCTTACTATGGGCAAGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1055382934 9:75728918-75728940 AAGGATTTTTAATTTGGTAAAGG - Intergenic
1056913772 9:90727836-90727858 AAGGCTGCTAACTTTGGGAAGGG - Intergenic
1058405532 9:104669246-104669268 TAGGAAGATTAATTTGGAAAAGG - Intergenic
1059890028 9:118791410-118791432 TAGGATGGTAAATTAGGGAAAGG + Intergenic
1060110313 9:120902143-120902165 GAGGATGCTTCAGTTGGCAACGG - Intergenic
1060110953 9:120905857-120905879 GAGGATGCTTCAGTTGGCAACGG - Intronic
1188528896 X:31115608-31115630 CAGGATGCTTAATTTTAGTATGG + Intronic
1191009645 X:55747271-55747293 TAGGATTCTAAAATTTGGAATGG - Intronic
1193603159 X:83533939-83533961 TAGAATTCTTAATTTGAGCATGG - Intergenic
1193725314 X:85031738-85031760 TAGGAAGATTAATTTGGCTAGGG + Intronic
1193769882 X:85575851-85575873 CAAGTTGCTTGATTTGGGAAAGG + Intergenic
1194296869 X:92136852-92136874 TATGATAATAAATTTGGGAAGGG + Intronic
1195573434 X:106422565-106422587 AAGGAAACTTAATTTGCGAAAGG + Intergenic
1195720112 X:107859118-107859140 AAGGATATTTAGTTTGGGAAGGG + Intronic
1196543815 X:116939459-116939481 AAGGAGGTTTACTTTGGGAAAGG - Intergenic
1197292272 X:124673413-124673435 TCGGATGATTAATTTGAGAGTGG + Intronic
1200614383 Y:5361427-5361449 TATGATAATAAATTTGGGAAGGG + Intronic
1201274697 Y:12286603-12286625 GACGTTTCTTAATTTGGGAAAGG + Intergenic