ID: 920625835

View in Genome Browser
Species Human (GRCh38)
Location 1:207597847-207597869
Sequence AGTATCTACGAGCAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 14, 3: 80, 4: 705}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920625829_920625835 29 Left 920625829 1:207597795-207597817 CCAATGTCCGTAGCAGCTTTGTT 0: 1
1: 1
2: 1
3: 80
4: 681
Right 920625835 1:207597847-207597869 AGTATCTACGAGCAGATGAATGG 0: 1
1: 0
2: 14
3: 80
4: 705
920625830_920625835 22 Left 920625830 1:207597802-207597824 CCGTAGCAGCTTTGTTCAAAATA 0: 1
1: 3
2: 21
3: 142
4: 628
Right 920625835 1:207597847-207597869 AGTATCTACGAGCAGATGAATGG 0: 1
1: 0
2: 14
3: 80
4: 705
920625832_920625835 -2 Left 920625832 1:207597826-207597848 CCAAAAGGTAGAAACAACCCAAG 0: 19
1: 238
2: 883
3: 2137
4: 3582
Right 920625835 1:207597847-207597869 AGTATCTACGAGCAGATGAATGG 0: 1
1: 0
2: 14
3: 80
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920625835 Original CRISPR AGTATCTACGAGCAGATGAA TGG Intronic
901962250 1:12836689-12836711 AGTGTCCATCAGCAGATGAATGG + Intergenic
902787255 1:18740747-18740769 AGTATCCATCAACAGATGAATGG + Intronic
903300701 1:22376571-22376593 AGCATTTAGGAGCAAATGAAAGG + Intergenic
905587826 1:39135177-39135199 AGTATCCATCAACAGATGAATGG - Intronic
906816272 1:48883005-48883027 AGTGTCCATCAGCAGATGAATGG - Intronic
906903500 1:49864010-49864032 AGTGTTCACCAGCAGATGAATGG + Intronic
907177856 1:52541946-52541968 AGTATCCACCAACAGATGAATGG + Intronic
907221436 1:52909910-52909932 AGTATCTATCAACAGATGATTGG + Intronic
907336144 1:53701010-53701032 AATATCTATCAGCTGATGAATGG - Intronic
908505857 1:64799315-64799337 AGTGTCCACCAACAGATGAATGG - Intronic
909162174 1:72166530-72166552 AGTGTCTACCAGCAGACAAATGG + Intronic
909367887 1:74849475-74849497 AGTATCCATCAACAGATGAATGG - Intergenic
909386505 1:75063647-75063669 AGTATCCATCAGTAGATGAATGG - Intergenic
909579306 1:77215670-77215692 AGTGTCTATCAGTAGATGAATGG + Intronic
910030799 1:82720227-82720249 AGTTTCCAACAGCAGATGAATGG - Intergenic
910323314 1:85975364-85975386 AGTATCCACCAACAGATGACTGG + Intronic
910576388 1:88769558-88769580 AGTATCTGTTAGCAGATAAATGG + Intronic
910931858 1:92450721-92450743 AGTGTCTACCAACAGACGAATGG - Intergenic
911399373 1:97355816-97355838 AGTGTCTATCAGCAGATGAATGG - Intronic
911419690 1:97624716-97624738 AGTATCTATCAACAGATAAATGG + Intronic
911596863 1:99807785-99807807 AGTGTCCACCAACAGATGAATGG + Intergenic
911950142 1:104163017-104163039 AGTGTCTATCAACAGATGAACGG + Intergenic
912857735 1:113186338-113186360 AGTGTCCATGAGCAGACGAATGG + Intergenic
912908130 1:113729020-113729042 AGTGTCCATCAGCAGATGAACGG + Intronic
913541414 1:119824701-119824723 AGTGTCCATCAGCAGATGAATGG + Intergenic
914359332 1:146918656-146918678 AGTGTCCATCAGCAGATGAACGG - Intergenic
914494417 1:148181219-148181241 AGTGTCCATCAGCAGATGAACGG + Intergenic
915337678 1:155156363-155156385 AGTGTCCATCAGCAGATGAATGG + Intergenic
916367861 1:164054021-164054043 AGTATCTATGAGCGGATGTTGGG - Intergenic
916451528 1:164925154-164925176 AGTGCCTAGGTGCAGATGAAAGG + Intergenic
916670675 1:167016733-167016755 AGTATCCATCAGCAGATGAATGG + Intronic
916672685 1:167037499-167037521 AGTGTCCATCAGCAGATGAATGG - Intergenic
916877978 1:168990655-168990677 AGTATCTGTCAACAGATGAATGG + Intergenic
917002866 1:170379459-170379481 AGTATCCATCAACAGATGAATGG - Intergenic
917279360 1:173366226-173366248 AGTGTCTATCAACAGATGAATGG + Intergenic
917393935 1:174571020-174571042 AGTGTGCATGAGCAGATGAATGG + Intronic
917558073 1:176112954-176112976 AGTGTCCATCAGCAGATGAAAGG - Intronic
920625835 1:207597847-207597869 AGTATCTACGAGCAGATGAATGG + Intronic
920862184 1:209719148-209719170 AGTGTCTATCAGTAGATGAATGG + Intronic
921032081 1:211342884-211342906 AGCATCTATCAACAGATGAATGG - Intronic
921295655 1:213699447-213699469 AGTGTCCATCAGCAGATGAATGG - Intergenic
921519696 1:216144869-216144891 AGAAGCTATGAGCATATGAATGG - Intronic
922319365 1:224471953-224471975 AGTGTCTATGAACAAATGAATGG - Intronic
922559323 1:226557371-226557393 AGTGTCCATCAGCAGATGAATGG - Intronic
922779709 1:228241674-228241696 AGTGTCCAACAGCAGATGAATGG + Intronic
1063726557 10:8643344-8643366 GGTATCTAGGGGCAGATCAAGGG + Intergenic
1063836203 10:10016380-10016402 AGTATCCACCAACAGATGAATGG - Intergenic
1064361907 10:14673526-14673548 AGTGTCTATCAACAGATGAAGGG - Intronic
1064407485 10:15077187-15077209 AGTATCCATCAGCAGATGATGGG + Intergenic
1064619284 10:17198402-17198424 AGTGTCTATCAACAGATGAATGG + Intronic
1065554026 10:26896045-26896067 AGTGTCCATCAGCAGATGAATGG + Intergenic
1065599249 10:27352263-27352285 AGTGTCCATCAGCAGATGAATGG - Intergenic
1066234536 10:33472311-33472333 CGTATCCACAAGCAGATGAATGG - Intergenic
1066324007 10:34336714-34336736 AGTATTTAGGAGCAAATGAGAGG - Intronic
1066491634 10:35900325-35900347 AGTGTCCATGAACAGATGAATGG - Intergenic
1066538324 10:36415740-36415762 AGTGTCCATGAACAGATGAATGG - Intergenic
1066645170 10:37599702-37599724 AGTGTCCATGAACAGATGAATGG - Intergenic
1066700635 10:38124081-38124103 AGTGTCTAACAGCAGATGAATGG + Exonic
1066991046 10:42514137-42514159 AGTGTCCATCAGCAGATGAATGG - Intergenic
1067016759 10:42762339-42762361 AGTGTCCACCAACAGATGAATGG - Intergenic
1067800855 10:49358634-49358656 AGTATCCATCAACAGATGAATGG + Intergenic
1067971792 10:50980062-50980084 AGTATCCACTGGCAGATGAATGG + Intergenic
1068403917 10:56565645-56565667 AATATCCACCAACAGATGAATGG + Intergenic
1068445070 10:57110247-57110269 AGTGTCCATCAGCAGATGAATGG + Intergenic
1068629637 10:59286014-59286036 AGTGTCCATGAGCGGATGAATGG + Intronic
1068750142 10:60583111-60583133 AGTATCTATCAGCAGATAAATGG + Intronic
1069064409 10:63927546-63927568 AGTATCTATCAACAAATGAATGG - Intergenic
1069088250 10:64167490-64167512 AGTGTCCACCAACAGATGAATGG - Intergenic
1069148163 10:64921963-64921985 AGTTTCTACCAACAGATAAATGG + Intergenic
1070317355 10:75327489-75327511 AGTGTCTACCAACATATGAATGG - Intergenic
1070478485 10:76854380-76854402 AGCATCTATCAACAGATGAATGG + Intergenic
1070946091 10:80393065-80393087 AGTATCTATCAACAGATGAATGG - Intergenic
1071214488 10:83384109-83384131 AGTGTCTATCAACAGATGAATGG - Intergenic
1071852466 10:89588206-89588228 AGTGTCTATCAGCAGATGAATGG - Intronic
1071896173 10:90069250-90069272 AGTATCCATCAACAGATGAATGG - Intergenic
1071910590 10:90228272-90228294 AATATCTACCAGTAGATGAATGG - Intergenic
1071911550 10:90240323-90240345 AGTATCAATCAACAGATGAATGG + Intergenic
1072347872 10:94526624-94526646 AGTATCCAACAACAGATGAATGG - Intronic
1072920231 10:99570604-99570626 AGTGTCCATCAGCAGATGAATGG + Intergenic
1073894417 10:108138204-108138226 AGTGTCTATCAACAGATGAACGG + Intergenic
1074017941 10:109553612-109553634 AGTGTCCATCAGCAGATGAATGG - Intergenic
1074429065 10:113377889-113377911 AGTTTCTAAGAGCAGAGGACAGG + Intergenic
1075170986 10:120114225-120114247 AGGATCTATCAACAGATGAATGG - Intergenic
1075400015 10:122154176-122154198 AATAACTATGAGCATATGAATGG - Intronic
1075753944 10:124795891-124795913 AGTGTCTAACAACAGATGAATGG - Intergenic
1077528422 11:3083170-3083192 AGTATCCATGAACAGATGAATGG + Intergenic
1077775418 11:5266209-5266231 AGTGTCTATCAACAGATGAACGG + Intronic
1078959357 11:16247303-16247325 AGTGTCTATCAACAGATGAATGG - Intronic
1079214882 11:18500216-18500238 AATATTTATCAGCAGATGAATGG - Intronic
1079604263 11:22344699-22344721 AGTGTCCATCAGCAGATGAATGG - Intronic
1080563484 11:33486012-33486034 AGTGTCCACTAACAGATGAATGG - Intergenic
1080598339 11:33796875-33796897 AGTGTCTGTGAACAGATGAATGG + Intergenic
1081232565 11:40603792-40603814 AGCATCTAAGAGGAAATGAAAGG + Intronic
1082864955 11:57890466-57890488 AGTGTCCAACAGCAGATGAATGG - Intergenic
1083047277 11:59748415-59748437 AGTGTCCATGAGCAGAAGAATGG + Intronic
1083369776 11:62169362-62169384 AGATTGTACGAGCAAATGAACGG + Intergenic
1083806015 11:65074432-65074454 AATGTCTACCAGCAGCTGAATGG - Intronic
1083978006 11:66139744-66139766 AGTGTCTATCAACAGATGAATGG - Intronic
1085147887 11:74219493-74219515 AGTGTCTATCAGTAGATGAATGG + Intronic
1085365111 11:75934091-75934113 AGTGTCCATTAGCAGATGAATGG + Intronic
1085658021 11:78334642-78334664 AGTGTCTATCAGCAGTTGAATGG - Intronic
1086340061 11:85839673-85839695 AGTGTCCACCAGCAGATGAATGG - Intergenic
1086532996 11:87808308-87808330 AGTGTCCACTAACAGATGAAAGG + Intergenic
1086554835 11:88096967-88096989 AGTGTCCATCAGCAGATGAATGG - Intergenic
1086787455 11:90987448-90987470 AATATCTAGGAGCAGATGAAGGG + Intergenic
1086921525 11:92593198-92593220 AGTGTCTATGGACAGATGAATGG - Intronic
1087166198 11:95005904-95005926 AGTATCTGCAAATAGATGAATGG - Intergenic
1087346116 11:96973221-96973243 GGTATCTAACAACAGATGAATGG + Intergenic
1087997845 11:104833224-104833246 AGCATCTATCAACAGATGAATGG - Intergenic
1088411101 11:109535536-109535558 AGTGTCTATCAACAGATGAATGG - Intergenic
1088432277 11:109771831-109771853 AGTGCCTATCAGCAGATGAATGG - Intergenic
1088602098 11:111489534-111489556 AGTATCCATCAACAGATGAATGG + Intronic
1088925082 11:114293886-114293908 AGTGTCCATTAGCAGATGAATGG + Intronic
1089371132 11:117958887-117958909 AGTGTTCACCAGCAGATGAATGG + Intergenic
1090850836 11:130569249-130569271 TGTCTCTACGAGAAAATGAAAGG + Intergenic
1091459977 12:636983-637005 AGTGTCCATCAGCAGATGAATGG + Intronic
1093091322 12:14924265-14924287 CGTGTCCATGAGCAGATGAATGG - Intronic
1093476023 12:19555295-19555317 AGTGTCTGTGAACAGATGAATGG - Intronic
1093593386 12:20933260-20933282 AGCATCTAGGAAAAGATGAATGG - Intergenic
1093716391 12:22387618-22387640 AGTATCCATCAACAGATGAATGG + Intronic
1093992065 12:25601050-25601072 AGTATCCACCAACAGATGAATGG + Intronic
1094228348 12:28073135-28073157 AGTGTCCACCAGCAGATAAATGG + Intergenic
1094323001 12:29206027-29206049 AGTATCTGAGAGTAAATGAAAGG - Intronic
1094345084 12:29459234-29459256 AGTATCCATCAACAGATGAATGG + Intronic
1094355845 12:29576385-29576407 AGTGTCTATGGACAGATGAATGG + Intronic
1094630009 12:32164709-32164731 ACTATCTACGTGCTGTTGAAAGG - Intronic
1094705899 12:32914169-32914191 AATATCTATCAACAGATGAATGG + Intergenic
1094763676 12:33565251-33565273 TGTGTCTATCAGCAGATGAATGG + Intergenic
1095684607 12:45018742-45018764 AGCATCTAGGAACAGATAAATGG + Intronic
1095806597 12:46326486-46326508 AATATTTACTAGCTGATGAATGG + Intergenic
1096219397 12:49819427-49819449 AGTATCCATCAGTAGATGAATGG + Intronic
1096535709 12:52271533-52271555 AATGTGTACCAGCAGATGAATGG + Intronic
1097304017 12:58049310-58049332 AGTATCCATCAACAGATGAATGG + Intergenic
1097857589 12:64481752-64481774 AGTATTTACCAGCAAATCAAAGG - Intronic
1098101466 12:67022042-67022064 AGTATCTATCAACAGATGAATGG - Intergenic
1098706179 12:73692724-73692746 AGTGTCTACCAACAGATGAACGG + Intergenic
1098992634 12:77081013-77081035 AGTGTCCATCAGCAGATGAATGG + Intergenic
1100173223 12:92001065-92001087 AGTGTCTAACAACAGATGAACGG + Intronic
1100224840 12:92545636-92545658 AGTGTCCATCAGCAGATGAATGG + Intergenic
1100523948 12:95402788-95402810 AGTATCTACCAGCTAAGGAATGG - Intergenic
1100683490 12:96957662-96957684 AGTATCTGTCAGCAGATGAATGG + Intergenic
1101434482 12:104653381-104653403 AATGTCTATGAACAGATGAATGG - Intronic
1101566918 12:105915335-105915357 AGTGTCTATCAACAGATGAATGG - Intergenic
1102642130 12:114376224-114376246 AGTATCCATGAGTGGATGAATGG + Intronic
1103069445 12:117928556-117928578 AGTGTCCACGAGCAGATACATGG - Intronic
1103115404 12:118325113-118325135 AGTGTTTATCAGCAGATGAATGG - Intronic
1103712859 12:122925843-122925865 AATATCTATCAACAGATGAATGG + Intronic
1104318798 12:127730308-127730330 AGTGTCCACCAACAGATGAATGG + Intergenic
1105302318 13:19147156-19147178 AATGTCTACCAGCTGATGAATGG + Intergenic
1105539502 13:21303187-21303209 AGTGTCCATGAACAGATGAATGG - Intergenic
1105998231 13:25693510-25693532 AGTGTATCTGAGCAGATGAAGGG + Intronic
1106075263 13:26455105-26455127 AGTGTCTATCAACAGATGAATGG + Intergenic
1106448151 13:29855043-29855065 AGTGTCTATGAACAGATGAATGG - Intergenic
1106668674 13:31881088-31881110 AGTCTCCACTAACAGATGAATGG + Intergenic
1106675339 13:31952649-31952671 AGATTCTACGAACAGATGAACGG + Intergenic
1106740203 13:32632741-32632763 AGTGTCCACTAGCAGAAGAATGG + Intronic
1106961292 13:35001422-35001444 AGTGTCCATCAGCAGATGAATGG + Intronic
1107085769 13:36426600-36426622 AGTGTCTATGAACAGGTGAATGG + Intergenic
1107318734 13:39162806-39162828 AGTGTCCACCAACAGATGAATGG - Intergenic
1108349167 13:49574839-49574861 AATATCCATGAACAGATGAATGG + Intronic
1108787238 13:53919684-53919706 AGTGTCCATGAACAGATGAATGG - Intergenic
1110027157 13:70554970-70554992 TGTATCCACTAGCAGAGGAATGG - Intergenic
1110072273 13:71191879-71191901 AGTCTCCACGAGCAGAAGAGTGG - Intergenic
1110124893 13:71930455-71930477 AGTGTCTATCAACAGATGAATGG - Intergenic
1110508507 13:76320013-76320035 AGTATCCAACTGCAGATGAATGG - Intergenic
1110594485 13:77304227-77304249 CGTTTCCATGAGCAGATGAATGG + Intronic
1110910874 13:80961252-80961274 AGTGTCCATCAGCAGATGAATGG - Intergenic
1111630027 13:90838675-90838697 TGTGTCTATCAGCAGATGAATGG - Intergenic
1111677806 13:91408442-91408464 GGTATCCATCAGCAGATGAATGG - Intronic
1111891863 13:94092522-94092544 AGTATCCATCAACAGATGAACGG - Intronic
1112080633 13:95966145-95966167 AGTGTCTATCAACAGATGAATGG + Intronic
1112148672 13:96731481-96731503 AGTATCTATGAAAAGATAAATGG - Intronic
1112523020 13:100115029-100115051 AGTATCCATCAACAGATGAATGG + Intronic
1112822410 13:103352311-103352333 AATATCTATCAACAGATGAATGG - Intergenic
1112926486 13:104681374-104681396 ATTATCTATGTGCAGATAAAAGG - Intergenic
1114687260 14:24545184-24545206 AGTGTCCATCAGCAGATGAATGG - Intergenic
1114889807 14:26904803-26904825 AGTATCTACCAACAGATGAATGG + Intergenic
1115127323 14:30012000-30012022 AGTATCCATCAACAGATGAATGG + Intronic
1115196074 14:30800852-30800874 AGTATCCATCAACAGATGAATGG - Intergenic
1115352960 14:32415933-32415955 AGTATCCATCAACAGATGAATGG - Intronic
1115381061 14:32739761-32739783 AGTATCCACCAACAGAAGAATGG - Intronic
1115904514 14:38191344-38191366 TGTCTCTACCAGAAGATGAAAGG - Intergenic
1116269660 14:42745340-42745362 AGTGTCCACCAACAGATGAATGG + Intergenic
1116803764 14:49470625-49470647 AGTGTCTATCAACAGATGAATGG + Intergenic
1116981224 14:51173103-51173125 AATGTCTATCAGCAGATGAATGG - Intergenic
1117264133 14:54068022-54068044 AGTGTCCAACAGCAGATGAATGG - Intergenic
1117903026 14:60554944-60554966 AGTGTCTATCAGCAGATGAACGG + Intergenic
1118544048 14:66864870-66864892 AGTGTCCATCAGCAGATGAATGG + Intronic
1118652696 14:67914468-67914490 AGTATCCATCAGCAGATGAATGG - Intronic
1118949742 14:70424025-70424047 AGTGTCCATCAGCAGATGAATGG + Intergenic
1119372305 14:74157349-74157371 AGTGTCTATCAACAGATGAATGG - Intronic
1119852980 14:77879201-77879223 AGTATTTCCTAACAGATGAATGG - Intronic
1120562654 14:86015832-86015854 AGTCTTTATCAGCAGATGAATGG - Intergenic
1120918526 14:89731802-89731824 AGTGTCTATGAACAGATAAATGG - Intergenic
1122026642 14:98882452-98882474 AGTATCCATGAACAGATGAATGG + Intergenic
1123282385 15:18013116-18013138 AGAATCTACGAGTAGATAATTGG + Intergenic
1123793258 15:23745609-23745631 AGTGTCTATCAACAGATGAATGG + Intergenic
1123884488 15:24711294-24711316 AATGTCTACAAACAGATGAATGG + Intergenic
1124062229 15:26305018-26305040 AATAACTAAGAACAGATGAAAGG + Intergenic
1124131361 15:26990014-26990036 AGTGTCCATGAACAGATGAATGG - Intronic
1124966464 15:34436498-34436520 AGTATTTACTGGCAGAAGAAAGG - Intronic
1124969481 15:34472036-34472058 AGCATCTGCCAACAGATGAATGG - Intergenic
1125052424 15:35315790-35315812 AGTGTGTATGAACAGATGAACGG + Intronic
1125290815 15:38144466-38144488 AATATCCACCAACAGATGAATGG + Intergenic
1125446314 15:39761322-39761344 AGTATCCACCAACAGATGAATGG + Intronic
1126044284 15:44624119-44624141 AGTGTCTATCAACAGATGAATGG + Intronic
1126472248 15:49025977-49025999 AGTGTCCATCAGCAGATGAATGG + Intronic
1126717271 15:51532123-51532145 AGTATCCATCAACAGATGAATGG + Intronic
1126941317 15:53769096-53769118 TGTGTCTATCAGCAGATGAATGG + Intergenic
1126963184 15:54021577-54021599 AGTGTCTACCAGTGGATGAATGG - Intronic
1126986593 15:54318121-54318143 AGTATCTATCAGTAGATGAATGG - Intronic
1127155338 15:56118584-56118606 AGTGTCTATCAGCAGATGAATGG - Intronic
1127813610 15:62586367-62586389 AGGAGCTGCCAGCAGATGAAGGG + Intronic
1127880165 15:63150109-63150131 AGTATCTATCAACTGATGAATGG + Exonic
1128154317 15:65383282-65383304 AGTATCTGGGAGCAGGAGAAGGG + Exonic
1129571749 15:76693584-76693606 TGTGTCTACCAACAGATGAATGG + Intronic
1129947715 15:79555435-79555457 GGTGTCTACTAACAGATGAATGG - Intergenic
1130010252 15:80147136-80147158 AGTGTCCATCAGCAGATGAATGG + Intergenic
1130533389 15:84765258-84765280 AGTATCTATCAACAGATGAAAGG - Intronic
1130947868 15:88562441-88562463 AGTGTCTACCAGTAGATGAATGG + Intergenic
1131216914 15:90545233-90545255 AGTATCCATTAGCGGATGAATGG - Intronic
1131949966 15:97671451-97671473 AGTATCCATCAACAGATGAATGG - Intergenic
1132037249 15:98494914-98494936 AGTGTCTATCAGCAGATGAATGG - Intronic
1132160049 15:99532420-99532442 AGTGTCCACTGGCAGATGAATGG + Intergenic
1132189808 15:99843401-99843423 AGTATCTGCTAACAGATGAACGG + Intergenic
1133214197 16:4281238-4281260 AGTATCTATCAACTGATGAATGG + Intergenic
1133343255 16:5052876-5052898 AGTTTCTATCAGCAGATGAATGG + Intronic
1133775648 16:8893241-8893263 AGTTCATACGAGCAGGTGAAAGG - Exonic
1133988515 16:10686835-10686857 AGTATCTCATAACAGATGAATGG + Intronic
1134283700 16:12841340-12841362 AGTATCCATTAACAGATGAATGG + Intergenic
1134371197 16:13626704-13626726 AGTGTCCATCAGCAGATGAATGG + Intergenic
1134376069 16:13675089-13675111 AGTGTCCATCAGCAGATGAATGG - Intergenic
1134685148 16:16153290-16153312 GGTATCTACTGGCAGATAAACGG + Intronic
1134802788 16:17100846-17100868 ATTATCTCCGGGCAGAGGAAAGG + Intergenic
1135677231 16:24426335-24426357 AGTGTCCATCAGCAGATGAATGG - Intergenic
1136097708 16:27969611-27969633 AGTATCTATTATCTGATGAATGG - Intronic
1136153875 16:28369411-28369433 AGTATCCATCAACAGATGAATGG + Intergenic
1136209216 16:28745853-28745875 AGTATCCATCAACAGATGAATGG - Intergenic
1136353209 16:29725640-29725662 AGCATCCATCAGCAGATGAAAGG - Intergenic
1136468476 16:30461916-30461938 AGTATCTATCAACAGATGAATGG + Intergenic
1136934558 16:34447884-34447906 AGTGTCCATCAGCAGATGAATGG + Intergenic
1136970014 16:34963930-34963952 AGTGTCCATCAGCAGATGAATGG - Intergenic
1137639504 16:50016081-50016103 AATGTCTACCAGCTGATGAATGG - Intergenic
1137981020 16:53069627-53069649 AGTGTCCACCAACAGATGAATGG - Intronic
1138927211 16:61606997-61607019 AGTGTCTATGGACAGATGAATGG + Intergenic
1138943907 16:61824025-61824047 AGTATCCACTGACAGATGAATGG + Intronic
1139479731 16:67223698-67223720 TGTATGTATGAGCATATGAATGG + Intronic
1139970724 16:70772828-70772850 AATATCTATCAACAGATGAATGG + Intronic
1140621422 16:76737817-76737839 AGTAGCCACCAACAGATGAATGG - Intergenic
1141239450 16:82251582-82251604 AATATCCACCAGCAGATGCATGG - Intergenic
1141927816 16:87180805-87180827 AGTGTCTATCAACAGATGAATGG + Intronic
1142213299 16:88818612-88818634 CGTATCTTCGTGAAGATGAAAGG - Intronic
1144029622 17:11307932-11307954 AGTATCAACAAGCAAATGAAAGG + Intronic
1144302737 17:13937645-13937667 AGGATCTTCAAGCATATGAAAGG + Intergenic
1144441369 17:15285804-15285826 ACTCTCTACGTGCAGATGATGGG + Intergenic
1144508894 17:15857998-15858020 AGTGTCCACCACCAGATGAATGG - Intergenic
1144615880 17:16772097-16772119 AGTATCTACTAGCCCAAGAACGG - Intronic
1144896824 17:18543575-18543597 AGTATCTACTAGCCCAAGAACGG + Intergenic
1145054468 17:19691349-19691371 AGTATCCATGAACAGATGAATGG + Intronic
1145120247 17:20252757-20252779 AGTGTCCACCACCAGATGAATGG - Intronic
1145135390 17:20400637-20400659 AGTATCTACTAGCCCAAGAACGG - Intergenic
1145173009 17:20675638-20675660 AGTGTCCACCACCAGATGAATGG - Intergenic
1146090968 17:29877474-29877496 AGTGTCTACCAACAGATGAATGG + Intronic
1146109161 17:30071746-30071768 AGTGTCTATCAACAGATGAATGG + Intronic
1146248564 17:31314695-31314717 AGTGTCTATAAACAGATGAATGG - Intronic
1147290762 17:39441064-39441086 AGTGTCCACTAGCAGATGAATGG + Intronic
1149003971 17:51785165-51785187 AGTGTCCATCAGCAGATGAATGG - Intronic
1149053993 17:52340627-52340649 AGTATCCATCACCAGATGAATGG - Intergenic
1149156827 17:53641140-53641162 AGTATCCATAAACAGATGAAAGG - Intergenic
1149361577 17:55901118-55901140 AGAATCTTTGAGCAGCTGAAGGG - Intergenic
1149672154 17:58424244-58424266 AGTATCCATCAACAGATGAATGG + Intronic
1150539704 17:66084411-66084433 AGTATCCATCAGCGGATGAATGG + Intronic
1150541807 17:66108865-66108887 AGTATCCATCAACAGATGAATGG + Intronic
1153333153 18:3894919-3894941 AACATCTAAGAGCAGTTGAAAGG - Intronic
1153670457 18:7407052-7407074 AGTCTCCACGAACAGAAGAATGG - Intergenic
1156003872 18:32417470-32417492 AGCATCCATCAGCAGATGAATGG + Intronic
1156647390 18:39182077-39182099 AGTGTCTACCAAAAGATGAATGG + Intergenic
1156715814 18:40008905-40008927 AATGTCTACCAACAGATGAATGG + Intergenic
1156827270 18:41446261-41446283 AGTGTCTATCAACAGATGAATGG + Intergenic
1157983593 18:52411309-52411331 AGTAACTAAGAGCTGAAGAAGGG - Intronic
1158105203 18:53877656-53877678 AGTATCCATTAGCAGATAAATGG - Intergenic
1158804622 18:60955319-60955341 AGTATCCATCAACAGATGAATGG + Intergenic
1159626412 18:70700411-70700433 AGTGTCCATCAGCAGATGAATGG - Intergenic
1159686956 18:71434513-71434535 AGTTTCCATCAGCAGATGAATGG + Intergenic
1159845124 18:73449950-73449972 AGTATCCATCAACAGATGAATGG - Intergenic
1160235588 18:77083585-77083607 AACATCTACCAACAGATGAATGG + Intronic
1160303512 18:77708558-77708580 AGCATCTACTAACAGATGAATGG + Intergenic
1160390825 18:78530837-78530859 AGCATCCATCAGCAGATGAATGG + Intergenic
1162119519 19:8454468-8454490 AGTGTCTACCAATAGATGAATGG - Intronic
1164389836 19:27808755-27808777 ACTGTCTACCAACAGATGAATGG + Intergenic
1165566960 19:36738619-36738641 AGTGTCCATCAGCAGATGAATGG + Intronic
1165883402 19:39059562-39059584 AGTGTCCATCAGCAGATGAATGG - Intergenic
1166403722 19:42503884-42503906 AATGTCTATCAGCAGATGAATGG - Intergenic
1168376272 19:55882547-55882569 AGTGTCCACCAGCAGATGAGTGG - Intergenic
1168398335 19:56067375-56067397 CGTGTCTATCAGCAGATGAATGG + Intergenic
1168563138 19:57400268-57400290 AGTATCCACTAACAGATGAATGG - Intronic
926017441 2:9466898-9466920 AGTATCCATTAACAGATGAATGG - Intronic
927223848 2:20741856-20741878 AGTGTCCATCAGCAGATGAATGG - Intronic
927348347 2:22074412-22074434 AGTGTCCATCAGCAGATGAATGG + Intergenic
927614927 2:24583643-24583665 AATATCTATCAACAGATGAATGG + Intronic
927622820 2:24680042-24680064 AGTGTCTGCCAACAGATGAATGG - Intronic
927839233 2:26427966-26427988 AGTGTCCATCAGCAGATGAATGG - Intronic
928586086 2:32759983-32760005 AGTATCCATCAACAGATGAATGG - Intronic
929121199 2:38485317-38485339 AGTGTCTATCAACAGATGAATGG + Intergenic
929168043 2:38903493-38903515 AGCATCCAGGAGCAGATGAATGG + Intronic
929230281 2:39552591-39552613 AGTGTCTATGTGCAGATGAATGG - Intergenic
929348062 2:40911412-40911434 AGTATCCACAAATAGATGAATGG - Intergenic
929621133 2:43355118-43355140 AGTGTCCATCAGCAGATGAATGG - Intronic
930527109 2:52543775-52543797 AGTGTCCATGAACAGATGAATGG - Intergenic
930592442 2:53344249-53344271 AGTGTCTATCAACAGATGAATGG + Intergenic
930749725 2:54922642-54922664 AGTATCTATCAACAAATGAATGG + Intronic
931011678 2:57923111-57923133 AGTGTCCATCAGCAGATGAATGG - Intronic
931398592 2:61910063-61910085 CATATCTACAAGCAGGTGAAAGG - Intronic
931445308 2:62322395-62322417 AATATCTATCAACAGATGAATGG - Intergenic
931529778 2:63200441-63200463 AGTGTCCATTAGCAGATGAATGG + Intronic
931530050 2:63203940-63203962 AGTGTCCATCAGCAGATGAATGG - Intronic
932223406 2:70019513-70019535 AGTGTCCATCAGCAGATGAATGG + Intergenic
932643471 2:73476287-73476309 AGTGTCTATCAACAGATGAATGG - Intronic
933007191 2:77010555-77010577 AGTGTCTATCAACAGATGAATGG - Intronic
933512019 2:83252414-83252436 AATACCCACAAGCAGATGAATGG - Intergenic
934612210 2:95748762-95748784 AGTGTCCACCAACAGATGAATGG + Intergenic
934841942 2:97630694-97630716 AGTGTCCACCAACAGATGAATGG - Intergenic
934845450 2:97659132-97659154 AGTAACTGCCAGCAGATAAAGGG - Intronic
934996699 2:98968352-98968374 AGTGTCCATCAGCAGATGAATGG - Intergenic
935276056 2:101476020-101476042 AGTGTCTATGGACAGATGAATGG + Intergenic
935297260 2:101660810-101660832 AGTGTCTATCAACAGATGAATGG + Intergenic
936239453 2:110774390-110774412 AGTCTCTCTGAGCAGATGACAGG + Intronic
936439222 2:112536141-112536163 AGTGTCCATCAGCAGATGAATGG - Exonic
936703770 2:115045008-115045030 AGTATCCATCAACAGATGAATGG - Intronic
938918807 2:135973173-135973195 AGTATCCATCAACAGATGAATGG + Intronic
939054025 2:137340815-137340837 AGTGTCCACCAGAAGATGAATGG - Intronic
939307205 2:140427062-140427084 TGTCTCTACGAGAAAATGAAAGG - Intronic
940236736 2:151519226-151519248 AGTGTCTGTCAGCAGATGAATGG + Intronic
940251637 2:151683815-151683837 AATGTCTACCAACAGATGAATGG + Intronic
940386651 2:153081759-153081781 AGTGTCTATCAACAGATGAATGG - Intergenic
940404693 2:153287506-153287528 AGTAGCTCTCAGCAGATGAATGG + Intergenic
940412750 2:153385285-153385307 AGTGTCCATCAGCAGATGAATGG + Intergenic
940696907 2:156991224-156991246 AGTATGTATGAGCTTATGAAAGG - Intergenic
941277276 2:163505430-163505452 AGTGTCTATTAACAGATGAATGG - Intergenic
941478653 2:165978212-165978234 AGTCTCTATCAACAGATGAATGG + Intergenic
941881543 2:170485615-170485637 AGTATCCACCAGTAGAGGAACGG - Intronic
942203536 2:173595894-173595916 AGCATCCACCATCAGATGAATGG + Intergenic
942838703 2:180333767-180333789 AGTGTCTATCAACAGATGAATGG + Intergenic
943347685 2:186759188-186759210 AGTGTCTATCAACAGATGAATGG - Intronic
943400227 2:187399704-187399726 AGTGTCCATCAGCAGATGAATGG + Intronic
943503636 2:188724627-188724649 AATATCCATCAGCAGATGAATGG + Intergenic
944300633 2:198120707-198120729 AGTGTCCATCAGCAGATGAATGG - Intronic
944615971 2:201460754-201460776 AGTGTCTATCAACAGATGAATGG - Intronic
944619755 2:201502136-201502158 TGTACTTAGGAGCAGATGAAAGG + Intronic
944856224 2:203769881-203769903 AATATCCATGAACAGATGAACGG + Intergenic
944894261 2:204147886-204147908 AGTGTCTATAAACAGATGAATGG - Intergenic
944941641 2:204634380-204634402 AGTATCCATAAACAGATGAATGG - Intronic
945410647 2:209502479-209502501 AGTGTCTATCAACAGATGAATGG - Intronic
945527825 2:210910585-210910607 AGTGTCTATCAACAGATGAATGG + Intergenic
945713901 2:213334557-213334579 AGTGTCTATCAGCAGATGAATGG + Intronic
945844150 2:214923464-214923486 AGTGTCAATCAGCAGATGAATGG - Intergenic
947130493 2:226918703-226918725 AGTATCCATCAACAGATGAATGG - Intronic
947458264 2:230277872-230277894 AGTCTCTATCAACAGATGAATGG - Intronic
947584913 2:231349183-231349205 AGTGTCCATCAGCAGATGAATGG + Intronic
948065948 2:235080228-235080250 AGTATCTGTCAACAGATGAATGG - Intergenic
948553754 2:238793328-238793350 AGTGTCCACAAACAGATGAATGG - Intergenic
1168759299 20:338306-338328 AGTGTCTATCAACAGATGAATGG - Intergenic
1168937904 20:1683494-1683516 AGTGTCTATCAACAGATGAATGG + Intergenic
1169322805 20:4648346-4648368 AGTATCCATTAGCAGATGAATGG + Intergenic
1169498458 20:6136525-6136547 GGTATCTAACAACAGATGAATGG - Intergenic
1169528759 20:6460497-6460519 AGTATCCAACAACAGATGAATGG + Intergenic
1169651633 20:7874662-7874684 AGTGTCCATCAGCAGATGAATGG + Intergenic
1170257822 20:14364848-14364870 AGTGTCCAGCAGCAGATGAATGG - Intronic
1170994121 20:21335684-21335706 AGTATGTAGCAGCAGATCAAGGG - Intronic
1171512671 20:25698211-25698233 AGTGTCTATCAACAGATGAATGG - Intergenic
1171765318 20:29263629-29263651 AGTATCTGCTAGCAGATAATTGG + Intergenic
1171938414 20:31299435-31299457 AGTATCCATCAACAGATGAATGG + Intergenic
1171944247 20:31362045-31362067 AGTGTCCAACAGCAGATGAATGG + Intergenic
1172738704 20:37149070-37149092 AGTGTCCACCAACAGATGAATGG - Intronic
1173065977 20:39712003-39712025 AGTGCCTATCAGCAGATGAATGG - Intergenic
1173566755 20:44044864-44044886 ACTGCCTACCAGCAGATGAATGG + Intronic
1173566876 20:44046546-44046568 ACTGCCTACCAGCAGATGAATGG + Intronic
1174691324 20:52509329-52509351 AGTGTCCATCAGCAGATGAATGG + Intergenic
1174838834 20:53882641-53882663 AGTGTCCATCAGCAGATGAATGG - Intergenic
1175065557 20:56283935-56283957 AGTGTCTAACAGCAGATGGATGG + Intergenic
1176898077 21:14406775-14406797 AGTGTCTATCAACAGATGAATGG - Intergenic
1176918298 21:14653245-14653267 AGTGTCTATCAACAGATGAATGG + Intronic
1177068947 21:16477728-16477750 AGTGTCTATCAACAGATGAATGG - Intergenic
1177161891 21:17556783-17556805 TGTAAGTAGGAGCAGATGAAGGG + Intronic
1177556558 21:22696606-22696628 AGTGTCCACCAGTAGATGAATGG - Intergenic
1178021642 21:28415020-28415042 AGTGTCCATAAGCAGATGAACGG + Intergenic
1178794846 21:35734414-35734436 AGTGTCTATCAACAGATGAATGG + Intronic
1178986725 21:37311131-37311153 AGTGTCTACCAACAGCTGAATGG - Intergenic
1179653143 21:42827821-42827843 AGTATCTATCAACAGAGGAATGG - Intergenic
1179948128 21:44693932-44693954 AGTATCTACCAACAGATGAATGG + Intronic
1180685956 22:17667027-17667049 AGTGTCCATGAACAGATGAATGG - Intronic
1181101397 22:20542322-20542344 AATGTCTACCAGCTGATGAATGG + Intronic
1182170704 22:28226031-28226053 AATATCCACTAGCAGGTGAATGG - Intronic
1183399078 22:37590696-37590718 AGCATCTACCAACAGATGAAAGG + Intergenic
1185321854 22:50204850-50204872 AGTGTCTATCAGCAGGTGAATGG + Intronic
949144358 3:678978-679000 AGTGTCTATCAACAGATGAATGG - Intergenic
949147832 3:724534-724556 AGTATCCATCAACAGATGAATGG + Intergenic
949296391 3:2529342-2529364 AGTATCCATCAACAGATGAATGG - Intronic
949648405 3:6126079-6126101 AGTATCTGACAACAGATGAATGG + Intergenic
950208914 3:11103136-11103158 AGTGTCTATCAACAGATGAATGG - Intergenic
950349158 3:12330030-12330052 AGTATCCATCAGTAGATGAATGG - Intronic
950737235 3:15019520-15019542 AGTATCCAACAGCGGATGAATGG + Intronic
950955649 3:17050897-17050919 AGCATCTACCAACAGTTGAATGG + Intronic
951069869 3:18314843-18314865 AGTGTCTATCAACAGATGAATGG - Intronic
951177360 3:19617559-19617581 AGTGTCTATCAACAGATGAATGG - Intergenic
951233702 3:20210187-20210209 AGTATCCATCATCAGATGAATGG + Intergenic
951378885 3:21957856-21957878 TGTATTTACTAGTAGATGAATGG - Intronic
951672349 3:25199043-25199065 AGTGTCCATCAGCAGATGAATGG + Intronic
951777814 3:26328930-26328952 AGTGTCCATCAGCAGATGAATGG + Intergenic
951853875 3:27172543-27172565 AGTATCCCTCAGCAGATGAATGG + Intronic
951973317 3:28473632-28473654 AGTATCTATCAGTATATGAATGG + Intronic
952021459 3:29026262-29026284 AGTATCCATTGGCAGATGAATGG + Intergenic
952120512 3:30237733-30237755 AGTATTCATCAGCAGATGAATGG - Intergenic
952640115 3:35583570-35583592 AGTGTCTATCAACAGATGAATGG + Intergenic
952727593 3:36604187-36604209 AGTGTCTGCCAACAGATGAATGG + Intergenic
953104886 3:39867899-39867921 AGTATCCATCAGCAGATGAATGG + Intronic
953205554 3:40824607-40824629 AGTCTGTACGAACAGATCAATGG + Intergenic
953549287 3:43888571-43888593 AGTGTCTATCAACAGATGAATGG + Intergenic
953629941 3:44605601-44605623 AGTGTCCATCAGCAGATGAATGG + Intronic
953864240 3:46570637-46570659 AGTGTCCATCAGCAGATGAATGG + Intronic
954478436 3:50772043-50772065 AGCATCCATGAACAGATGAATGG + Intronic
956237427 3:67089777-67089799 AGTGTCCATCAGCAGATGAATGG + Intergenic
956573545 3:70725156-70725178 AGTGTCTATCAACAGATGAATGG + Intergenic
956656843 3:71560655-71560677 AGTGTCCACCAACAGATGAATGG + Intronic
957018610 3:75098245-75098267 AATATCCACGAACAGATGAATGG - Intergenic
957779230 3:84797218-84797240 AGTATCTACCAACAGATATATGG + Intergenic
958677024 3:97278059-97278081 AGTATCTATCAACAGATAAACGG - Intronic
958703457 3:97622486-97622508 AATATCCACCAGGAGATGAATGG - Intronic
959280423 3:104330679-104330701 AGTGTCTATCAACAGATGAATGG + Intergenic
959365002 3:105446570-105446592 AGTATCTACCAATGGATGAATGG + Intronic
959594919 3:108119535-108119557 AGTGTCCACCAACAGATGAATGG + Intergenic
959655833 3:108803894-108803916 AGTGTCTATCAGCAGATGAATGG + Intergenic
959868111 3:111294291-111294313 AGTGTCCATCAGCAGATGAATGG - Intronic
959971601 3:112416240-112416262 AGTGTCCACCAACAGATGAATGG - Intergenic
960067655 3:113392150-113392172 AGTATCCATCAACAGATGAATGG + Intronic
960242092 3:115356321-115356343 AGTGTCCATGAGCAAATGAATGG + Intergenic
960415982 3:117385773-117385795 AGTATCCACCAGCAGATGAATGG + Intergenic
960460312 3:117926088-117926110 AGTGTCTATGGACAGATGAATGG + Intergenic
960477609 3:118148038-118148060 AGTATCCATCAACAGATGAATGG - Intergenic
960505699 3:118490712-118490734 AGTATCCATCAACAGATGAATGG + Intergenic
960741348 3:120836970-120836992 AGTATCTATGAACAGATGAATGG + Intergenic
960791980 3:121442679-121442701 AGTGTCCATCAGCAGATGAATGG - Intronic
961500956 3:127335544-127335566 AGTATCCATCAACAGATGAATGG + Intergenic
961624336 3:128249825-128249847 AGTGTCTACCAACAGAAGAATGG - Intronic
962182054 3:133216824-133216846 AGTATCTGTCAACAGATGAATGG - Intronic
962698763 3:137976630-137976652 AGTGTCCATCAGCAGATGAATGG - Intergenic
963142384 3:141957565-141957587 AATATCTACCAACTGATGAATGG + Intronic
963444860 3:145391930-145391952 AGTGTCTATCATCAGATGAATGG + Intergenic
963495570 3:146055940-146055962 AGTGTCCATCAGCAGATGAATGG + Intergenic
963500252 3:146116588-146116610 AGTATGTATCAACAGATGAATGG + Intronic
963520240 3:146354482-146354504 TGTCTCTACGAGAAAATGAAAGG - Intergenic
963580562 3:147121805-147121827 AGTAGCTAAGAGAAGATGAGGGG + Intergenic
964038724 3:152231643-152231665 AGTGTCCATCAGCAGATGAATGG + Intergenic
964200134 3:154109559-154109581 ATTATCTACCATCAGAAGAAGGG - Intergenic
964207077 3:154186320-154186342 AGTCTCCATCAGCAGATGAATGG + Intronic
964262804 3:154858767-154858789 AGTGTCCATCAGCAGATGAATGG - Intergenic
964431153 3:156607182-156607204 AATGTCTACCAACAGATGAATGG - Intergenic
964527209 3:157627969-157627991 AGTGTCCACCAGCTGATGAATGG - Intronic
965010225 3:163078202-163078224 AGTGTCCACCAACAGATGAATGG + Intergenic
965037851 3:163465742-163465764 AGTGTCCATCAGCAGATGAATGG - Intergenic
965057636 3:163742975-163742997 AGTGTCCACCAGCATATGAATGG + Intergenic
965236455 3:166130318-166130340 AGTGTCCATCAGCAGATGAATGG - Intergenic
965311844 3:167137919-167137941 AGTATATATCAACAGATGAATGG + Intergenic
965527593 3:169737934-169737956 AGTGTCTATCAGCAGATCAATGG + Intergenic
965794239 3:172422331-172422353 AGTATCCATCAACAGATGAATGG - Intergenic
966172040 3:177092884-177092906 AATGTCTACCAACAGATGAATGG + Intronic
966518828 3:180850460-180850482 AGTGTCCATCAGCAGATGAATGG - Intronic
967132414 3:186484755-186484777 AGTATCCATCAACAGATGAATGG + Intergenic
968334824 3:197904545-197904567 AGTGTCTACCAACAGACGAACGG + Intronic
968378699 4:69144-69166 AGTGTCTATCAACAGATGAATGG - Intronic
968414073 4:413789-413811 AGTGTCTATCAACAGATGAATGG - Intergenic
968587130 4:1424492-1424514 AGTGTCCACCAGGAGATGAATGG - Intergenic
970069121 4:12136039-12136061 AGTCTCTATGGACAGATGAATGG + Intergenic
970129799 4:12854862-12854884 AGTATCTCTCAGCAGGTGAATGG - Intergenic
970529818 4:16970149-16970171 AGTGTCCACTAGCAGGTGAACGG + Intergenic
971637090 4:29074636-29074658 AGTATCCATGGACAGATGAACGG + Intergenic
971655642 4:29340795-29340817 AGTATTCACTAACAGATGAATGG - Intergenic
972043362 4:34632612-34632634 AGTGTCCACCAACAGATGAATGG + Intergenic
972468090 4:39377212-39377234 AGTATCCATCAACAGATGAATGG - Intergenic
973114808 4:46442378-46442400 AGTATCCATCAACAGATGAATGG - Intronic
973869472 4:55150748-55150770 AGTGTCCATCAGCAGATGAATGG - Intergenic
973922162 4:55698416-55698438 AGTATCCAGCAACAGATGAATGG + Intergenic
973922417 4:55701548-55701570 AGTATCTATCAGCAGATGAATGG + Intergenic
974123799 4:57670992-57671014 AGTATCTATAAGCAAAAGAAAGG - Intergenic
974290552 4:59924293-59924315 AGTATCCACCAGCAGGTGAATGG + Intergenic
975080006 4:70265796-70265818 AGTGTCCATGAACAGATGAATGG + Intergenic
975095054 4:70448176-70448198 AATGTCTACCAACAGATGAATGG - Intronic
975603559 4:76128665-76128687 AGTGTCCATGAACAGATGAATGG + Intronic
975763964 4:77647770-77647792 AGTGTCCATCAGCAGATGAATGG + Intergenic
975962314 4:79926828-79926850 AGTATCCATCAGCAGATAAATGG + Intronic
976073158 4:81265204-81265226 AGTGTCTATCAGCAGATGAATGG - Intergenic
976138560 4:81965279-81965301 AGTGTCCATGAACAGATGAATGG - Intronic
976574067 4:86648618-86648640 AGTATCTACCAACAGATGAATGG - Intronic
976722766 4:88186113-88186135 AGTGTCCATCAGCAGATGAATGG + Intronic
976776504 4:88712086-88712108 AGTATCCATCAACAGATGAATGG - Intergenic
977046495 4:92074044-92074066 AGTGTCTACTGGTAGATGAATGG + Intergenic
977628703 4:99217608-99217630 AGTATCCATCAACAGATGAATGG - Intronic
977641658 4:99364314-99364336 AGTATCTATCAACAGATGAATGG - Intergenic
978321510 4:107501061-107501083 AGTTGCTAAGAGGAGATGAAAGG + Intergenic
978908093 4:114033033-114033055 AGTGTCTATCAGCAGATGAATGG - Intergenic
979812081 4:125048916-125048938 AGTGTCTATCAACAGATGAATGG + Intergenic
979851460 4:125575411-125575433 AGTGTCTATCAACAGATGAATGG + Intergenic
980025053 4:127756194-127756216 AGTGTCCATGAGCAGATGAATGG + Intronic
980741918 4:136962282-136962304 AGTGTCCATCAGCAGATGAATGG - Intergenic
981896072 4:149801492-149801514 AGTATCTATCAACAGTTGAATGG + Intergenic
981905095 4:149913712-149913734 AGTGTCTATCAACAGATGAATGG - Intergenic
982729770 4:158943824-158943846 AGTAACTAGAGGCAGATGAAGGG - Intronic
983452062 4:167923565-167923587 TGTCTCTACGAGAAAATGAAAGG - Intergenic
983846361 4:172524539-172524561 AGTGTCTATGAACAGAAGAAAGG - Intronic
984887173 4:184460094-184460116 AGTATCTACCAACAGATGAATGG + Intronic
985751226 5:1677377-1677399 AGTATCTATTAGCAGATGAATGG - Intergenic
986149360 5:5112912-5112934 AGTGTCTATCAACAGATGAATGG - Intergenic
986411294 5:7482731-7482753 AGTGTCTATCAGCTGATGAATGG + Intronic
986475344 5:8124762-8124784 AGTGTCTACCAACAGATGAATGG + Intergenic
986772006 5:10982749-10982771 AGTGTCCACCAACAGATGAATGG + Intronic
986913206 5:12583593-12583615 AGTGTCCATCAGCAGATGAATGG - Intergenic
988235223 5:28535168-28535190 AGTTTCTATGAGTAGATAAATGG + Intergenic
989030322 5:37111844-37111866 AAAATCTACGAGCAGATGACAGG + Intronic
989313338 5:40047406-40047428 AGTATCCATCAACAGATGAATGG - Intergenic
989788787 5:45365579-45365601 AGTATCCACCAACAGTTGAATGG - Intronic
989974776 5:50571791-50571813 AATGTCTACCAACAGATGAATGG + Intergenic
990919695 5:60948693-60948715 AATATCTATGAACAGGTGAATGG - Intronic
991373752 5:65944036-65944058 AGTGTCTACCCACAGATGAATGG - Intronic
991545456 5:67777175-67777197 AGTGTCCACCAACAGATGAATGG - Intergenic
991735094 5:69624547-69624569 AATATCTACAAATAGATGAATGG - Intergenic
991779884 5:70122172-70122194 AATATCTACAAATAGATGAATGG + Intergenic
991811528 5:70479683-70479705 AATATCTACAAATAGATGAATGG - Intergenic
991859171 5:70997600-70997622 AATATCTACAAATAGATGAATGG + Intronic
991872331 5:71122493-71122515 AATATCTACAAATAGATGAATGG + Intergenic
992268863 5:75045520-75045542 AATATCTACTGACAGATGAATGG - Intergenic
993266857 5:85737556-85737578 AGTGTCTAACAACAGATGAATGG - Intergenic
993400048 5:87438382-87438404 AGTGTCCATGAACAGATGAATGG - Intergenic
993931784 5:93950102-93950124 AGTGTCCATCAGCAGATGAATGG - Intronic
994064702 5:95525397-95525419 ACTATCTACAAGCAGAAAAATGG - Exonic
994213618 5:97112725-97112747 ATAATCTACCAGCAAATGAAAGG - Intronic
994492848 5:100470267-100470289 AGTGTCCAAGAACAGATGAATGG + Intergenic
994688498 5:102987148-102987170 AGAATATATCAGCAGATGAATGG + Intronic
995169715 5:109092858-109092880 AATATCCACGGACAGATGAATGG + Intronic
995626477 5:114082672-114082694 AGTAACCATCAGCAGATGAATGG + Intergenic
995963012 5:117867388-117867410 AGTGTCTATGAACAGATGAATGG + Intergenic
996259044 5:121442977-121442999 AGTGTCTATTAACAGATGAATGG + Intergenic
996659405 5:125982881-125982903 AGTGTCTATCAACAGATGAATGG - Intergenic
997789697 5:136747051-136747073 AGTGTCCACCAACAGATGAATGG + Intergenic
997942863 5:138174205-138174227 AGTATCCATTAACAGATGAATGG - Intronic
998116065 5:139538379-139538401 AGTGTCCATCAGCAGATGAAGGG + Intronic
998116635 5:139542716-139542738 AGTGTCCATCAGCAGATGAAGGG + Intronic
998546662 5:143034348-143034370 AATATCTATCAGCCGATGAATGG + Intronic
998778146 5:145626775-145626797 AGTATCCATCAACAGATGAATGG + Intronic
999706764 5:154280009-154280031 AGTATCCATCAGCAGATAAATGG + Intronic
999785829 5:154889859-154889881 AGTATCCACTGACAGATGAATGG - Intronic
1000400534 5:160822612-160822634 AGTATCTAGCAACAGGTGAATGG + Intronic
1000598344 5:163242401-163242423 AGTGTCCATCAGCAGATGAACGG + Intergenic
1000949440 5:167462717-167462739 AGGCTCCACAAGCAGATGAACGG - Intronic
1001156591 5:169277645-169277667 AGTGTCTATAAACAGATGAATGG - Intronic
1001523208 5:172410035-172410057 AGTACCCATCAGCAGATGAATGG - Intronic
1001620250 5:173077955-173077977 AGTGTCCACAAACAGATGAATGG - Intronic
1002769343 6:277509-277531 AATGTCTATCAGCAGATGAATGG - Intergenic
1003270007 6:4600200-4600222 AGTATCCACCAACAGATGAATGG - Intergenic
1003485391 6:6571745-6571767 AATATCTATCAACAGATGAATGG - Intergenic
1003507921 6:6754943-6754965 AGTGTCTAACAACAGATGAATGG - Intergenic
1003711317 6:8593937-8593959 AGTGTCCATCAGCAGATGAATGG + Intergenic
1004246469 6:13982284-13982306 GGTATCTAAGAACAGATGAATGG - Intergenic
1004356844 6:14936883-14936905 AGTGTCCACCAACAGATGAATGG - Intergenic
1004361908 6:14978739-14978761 AGTATCCATCAACAGATGAATGG - Intergenic
1004538432 6:16525272-16525294 AATGTCTACCAACAGATGAATGG + Intronic
1004998117 6:21213927-21213949 AGTATCTATCAACAGATGAATGG + Intronic
1005435813 6:25810854-25810876 AGTGTCCATCAGCAGATGAATGG + Intronic
1005519838 6:26589626-26589648 AGTATCTATCAGCTGGTGAATGG - Intergenic
1005530212 6:26696926-26696948 AGCGTCTATCAGCAGATGAATGG + Intergenic
1005540584 6:26804721-26804743 AGCGTCTATCAGCAGATGAATGG - Intergenic
1005907589 6:30278008-30278030 AATGTCTAACAGCAGATGAATGG - Intergenic
1006247589 6:32753089-32753111 ACTATCCATCAGCAGATGAATGG + Intergenic
1006974642 6:38088117-38088139 AGTATCTACCAACAGATGAATGG + Intronic
1007362079 6:41365943-41365965 AATATCCACCAACAGATGAATGG - Intergenic
1008245515 6:49166963-49166985 AGCATCCACAAGCCGATGAATGG - Intergenic
1008614374 6:53211990-53212012 AGTGTCCATGAGCGGATGAATGG - Intergenic
1008977326 6:57443139-57443161 AGTATCTATCAACAGGTGAAAGG - Intronic
1009165462 6:60336092-60336114 AGTAACTATCAACAGATGAAAGG - Intergenic
1010018892 6:71137301-71137323 AGTATCCATCAACAGATGAATGG + Intergenic
1010199094 6:73267773-73267795 AGAATTGATGAGCAGATGAATGG + Intronic
1011385485 6:86793184-86793206 AGTGTCTATCAACAGATGAATGG - Intergenic
1012315535 6:97780208-97780230 TGTCTCTACCAGAAGATGAAAGG - Intergenic
1012714908 6:102656303-102656325 AGTGTCTGTCAGCAGATGAATGG + Intergenic
1012892811 6:104916225-104916247 AGTATCCATCAGCAGATGAATGG + Intergenic
1013060835 6:106632200-106632222 AGTATCTACCAACAGATGAATGG - Intronic
1013687789 6:112605593-112605615 AGTGTCTATCAACAGATGAATGG + Intergenic
1013723594 6:113063585-113063607 AGTATCCACCAACAGATGAATGG - Intergenic
1014060520 6:117066302-117066324 AGTGTCTATAAACAGATGAATGG - Intergenic
1014254028 6:119143560-119143582 AGTATCCCACAGCAGATGAATGG + Intronic
1014355198 6:120399838-120399860 AGTGTCTACCAACAGATGAATGG - Intergenic
1014386733 6:120812643-120812665 AGTATCCACCAACAGATGATTGG + Intergenic
1014724532 6:124959276-124959298 AGTGTCTATCAACAGATGAATGG + Intergenic
1014769766 6:125447414-125447436 AGTATGCATGAACAGATGAATGG + Intergenic
1014782680 6:125582894-125582916 AGTATCCATGGACAGATGAATGG - Intergenic
1014926609 6:127278571-127278593 AGTATCTACCAACAGATGAATGG - Intronic
1015029802 6:128580793-128580815 AAATTCTACAAGCAGATGAATGG - Intergenic
1015103509 6:129508758-129508780 AGTGTCCATCAGCAGATGAACGG - Intronic
1015289531 6:131522838-131522860 AGTATCCATTAACAGATGAATGG - Intergenic
1015752209 6:136571642-136571664 AGTATCTAGCAACAGATGAATGG - Intronic
1016148817 6:140710088-140710110 AATGTCCACCAGCAGATGAAGGG - Intergenic
1016303031 6:142652888-142652910 AGTGTCCATCAGCAGATGAATGG + Intergenic
1016378267 6:143446705-143446727 AGTATTTAACAGCAGATGACAGG + Intronic
1017196730 6:151709372-151709394 AGTATCCATCAACAGATGAATGG - Intronic
1017294680 6:152779787-152779809 AGTGTCCATGAGCAGATGAAAGG - Intergenic
1017812370 6:157992833-157992855 AGTGTCCACCAACAGATGAATGG - Intronic
1018602049 6:165554767-165554789 AGTATCCATCAACAGATGAATGG + Intronic
1019863059 7:3678369-3678391 AGTGTCCATCAGCAGATGAATGG + Intronic
1020394158 7:7694776-7694798 AGTATCTATCAAAAGATGAATGG - Intronic
1020804876 7:12776770-12776792 ACTATCTAGGAGCAGAAGAAAGG + Intergenic
1022132584 7:27417860-27417882 AGTGTCCATCAGCAGATGAATGG - Intergenic
1022194677 7:28053210-28053232 AGTATCCATCAGCAGATGAGTGG - Intronic
1022431713 7:30329695-30329717 AGTATCCATCAACAGATGAATGG - Intronic
1022853387 7:34290025-34290047 AGTGTCCATCAGCAGATGAATGG - Intergenic
1022982949 7:35621795-35621817 AGTATCCATCAACAGATGAATGG + Intergenic
1023052676 7:36266963-36266985 AATGTCCACCAGCAGATGAATGG - Intronic
1023055907 7:36289864-36289886 AGTGTCTATCAGAAGATGAATGG - Intronic
1023077101 7:36495284-36495306 AGTGTCTATCAACAGATGAATGG - Intergenic
1023265248 7:38398292-38398314 AGTATCCATCAACAGATGAATGG + Intronic
1024050499 7:45618963-45618985 AGTGTCCAACAGCAGATGAATGG + Intronic
1024622043 7:51168859-51168881 AGTGTCCATCAGCAGATGAATGG + Intronic
1024815435 7:53263512-53263534 AGAATCAATGTGCAGATGAATGG + Intergenic
1026072947 7:67138866-67138888 AGTATCCAATGGCAGATGAATGG - Intronic
1026419080 7:70214260-70214282 AGTATCTCTGAGCAAATAAAGGG + Intronic
1026501919 7:70950197-70950219 AGTGTCTACCAGCAGATGTTTGG - Intergenic
1026703935 7:72673350-72673372 AGTATCCAATGGCAGATGAATGG + Intronic
1028064791 7:86370000-86370022 AGTATCCAACAACAGATGAATGG - Intergenic
1028161466 7:87490883-87490905 AGTGTCCATCAGCAGATGAATGG + Intergenic
1028560818 7:92173928-92173950 AGTATCTATCAACAGATGAATGG + Intronic
1028576744 7:92360484-92360506 AGTGTCTATCAACAGATGAATGG - Intronic
1029009817 7:97247517-97247539 AGTATCCAGCAACAGATGAATGG + Intergenic
1029796640 7:102901823-102901845 AGTGTCTATCAGCAGATGACTGG - Intronic
1030291978 7:107881742-107881764 AGTGTCCACGAATAGATGAAAGG - Intergenic
1030370021 7:108688582-108688604 AGTGTCCACCAGCAGATAAATGG - Intergenic
1030407779 7:109136393-109136415 AGTGTCCATCAGCAGATGAAAGG - Intergenic
1031287036 7:119883604-119883626 AGTATCCATCAACAGATGAATGG - Intergenic
1031518302 7:122729257-122729279 AGTGTCTATCAACAGATGAATGG - Intronic
1031733230 7:125323515-125323537 AGTATCCATTAACAGATGAATGG - Intergenic
1033222155 7:139535131-139535153 AATGTCTACCAACAGATGAATGG + Intronic
1033922441 7:146411000-146411022 AGTGTCTTTCAGCAGATGAATGG - Intronic
1034713976 7:153222186-153222208 AGTGTCCATCAGCAGATGAATGG + Intergenic
1034757482 7:153636127-153636149 AGTGTCCATCAGCAGATGAATGG - Intergenic
1035147856 7:156838607-156838629 AGTGTCTGCCAGCAGATGAGTGG - Intronic
1035461994 7:159046314-159046336 AATGTCCATGAGCAGATGAACGG + Intronic
1036141227 8:6210655-6210677 AGTGTCTATCAGCAGATGAATGG - Intergenic
1036513915 8:9425894-9425916 AGTGTCTATCAGCAGATGAATGG - Intergenic
1036583619 8:10101777-10101799 AGTTTCCACTGGCAGATGAATGG - Intronic
1036718416 8:11148776-11148798 AGTATCCATTAGCAGATGAATGG + Intronic
1036775642 8:11610937-11610959 AGTGTCCACCAACAGATGAATGG + Intergenic
1037384445 8:18322609-18322631 AGTATCCATTAACAGATGAATGG - Intergenic
1037868586 8:22469085-22469107 AGTATCTATTAGTGGATGAATGG + Intronic
1037872849 8:22515362-22515384 AGTGTCTATTAACAGATGAAAGG - Intronic
1038082424 8:24154096-24154118 GGTATCCACCAACAGATGAATGG + Intergenic
1038082742 8:24158429-24158451 TGTGTCTACCAACAGATGAATGG - Intergenic
1038273951 8:26103696-26103718 AGTATCCATCAACAGATGAATGG + Intergenic
1038449536 8:27630946-27630968 AGTGTCCATCAGCAGATGAATGG - Intergenic
1038783381 8:30588322-30588344 AGTGTCTATCAACAGATGAACGG + Intronic
1039928321 8:41959591-41959613 AGTATCCACTGACAGATGAATGG + Intronic
1040602354 8:48897343-48897365 AGTAGCTCTCAGCAGATGAATGG + Intergenic
1040628466 8:49179725-49179747 AGTGTCTATCAGCAGATTAATGG + Intergenic
1040728331 8:50410893-50410915 AGTGTCTATCAACAGATGAATGG - Intronic
1040969861 8:53124129-53124151 AATATCTATTAACAGATGAATGG - Intergenic
1041364578 8:57088088-57088110 AGTGTCTATCAACAGATGAATGG + Intergenic
1041482704 8:58341370-58341392 AGTGTCCATCAGCAGATGAATGG - Intergenic
1041519163 8:58736152-58736174 AGTGTCCATCAGCAGATGAATGG + Intergenic
1041882842 8:62772298-62772320 AGTGTCTATCAACAGATGAATGG - Intronic
1042608530 8:70572202-70572224 AATGTCTATCAGCAGATGAATGG + Intergenic
1042726317 8:71881451-71881473 AGTGTCTATCAACAGATGAATGG - Intronic
1043224261 8:77702698-77702720 AGTGTCTATCAGCAGGTGAATGG - Intergenic
1043339450 8:79219645-79219667 AGTGTCCATGAACAGATGAATGG - Intergenic
1043754599 8:83987041-83987063 AGTGTCCATCAGCAGATGAATGG + Intergenic
1043819798 8:84848248-84848270 AGTGTCTATCAACAGATGAATGG + Intronic
1044171909 8:89063947-89063969 AGTATCCATCAACAGATGAATGG - Intergenic
1044850865 8:96426106-96426128 AGTATCCATCAACAGATGAATGG - Intergenic
1044957522 8:97496718-97496740 AGTGTCTATCAGCAGATGAATGG + Intergenic
1045717770 8:105068350-105068372 GGTATCTAACAACAGATGAATGG - Intronic
1045833834 8:106496664-106496686 AGTAACTACAAGGAGAGGAAGGG + Intronic
1046010809 8:108544568-108544590 AGTGTCCACCAACAGATGAATGG + Intergenic
1046346275 8:112932194-112932216 AGTGTCTATCAGCAGATGAATGG + Intronic
1046518844 8:115298943-115298965 AGTGTCCACTGGCAGATGAATGG - Intergenic
1049618436 8:143586754-143586776 AGATTCTACGAGCAGATGAACGG - Exonic
1049869087 8:144959306-144959328 TGTCTCTACCAGAAGATGAAAGG + Intergenic
1049914907 9:307816-307838 AGTATCCATCAGCAGAAGAATGG + Intronic
1050499774 9:6284490-6284512 AGTGTCCATGAACAGATGAATGG - Intergenic
1050866058 9:10500928-10500950 AGTGTCCATTAGCAGATGAACGG - Intronic
1051829551 9:21260106-21260128 AGTGTCCACTAACAGATGAATGG - Intergenic
1052097261 9:24398076-24398098 AGTGTCCATGAACAGATGAATGG - Intergenic
1052120153 9:24704821-24704843 AATATCTATCAACAGATGAATGG + Intergenic
1052208588 9:25872884-25872906 AGTGTTTACTAACAGATGAATGG - Intergenic
1052396867 9:27949397-27949419 AGCATCTGCTAGTAGATGAAGGG - Exonic
1052656599 9:31370751-31370773 AGTGTCCATCAGCAGATGAACGG - Intergenic
1053046189 9:34919942-34919964 AGTGTCCACCAACAGATGAATGG - Intergenic
1055176139 9:73319728-73319750 AGTATCAATTAACAGATGAAAGG + Intergenic
1055180712 9:73382629-73382651 AGTGTCCATCAGCAGATGAATGG - Intergenic
1055531011 9:77183832-77183854 AGTATCCACCAACAGGTGAATGG + Intronic
1055682747 9:78734721-78734743 AACATCTACGAACAGGTGAAAGG - Intergenic
1055895999 9:81176614-81176636 AGTATCTAGGAACACATTAATGG - Intergenic
1056175686 9:84032947-84032969 AGTGTCTATCAACAGATGAATGG - Intergenic
1056493716 9:87134546-87134568 AGTATTCACCAACAGATGAATGG + Intergenic
1056529109 9:87471195-87471217 AGTAACTACCAGGAGATAAAGGG - Intergenic
1056678124 9:88693999-88694021 AGTATCTGTCAACAGATGAATGG + Intergenic
1057110322 9:92463660-92463682 GTTATCTTCCAGCAGATGAAAGG + Intronic
1057155772 9:92837577-92837599 AGATTCTACGAGCAGATGAATGG - Intergenic
1057246255 9:93457126-93457148 AGTATCCACCAGTGGATGAATGG - Intronic
1057258795 9:93572505-93572527 AGTATCCACTGGCAGATGAATGG + Intergenic
1057323394 9:94035570-94035592 AGTGTCTATCAACAGATGAATGG - Intronic
1057365096 9:94412575-94412597 AGTGTCTATGAACTGATGAATGG + Intronic
1057658228 9:96975515-96975537 AGTGTCTATGAACTGATGAATGG - Intronic
1057673402 9:97116242-97116264 AGTGTCCACAAGCAAATGAATGG + Intergenic
1057970079 9:99546464-99546486 AGTGTCTATCAGCAGATGAATGG - Intergenic
1058188311 9:101882439-101882461 AGTATCCATCAACAGATGAATGG - Intergenic
1058198252 9:102006329-102006351 AGTATCCATCAACAGATGAATGG - Intergenic
1058317771 9:103589727-103589749 AGTGTCTATTAACAGATGAATGG + Intergenic
1059255171 9:112923806-112923828 AGTGTCCATGAACAGATGAATGG - Intergenic
1059975779 9:119715506-119715528 TGTGTCTACCAACAGATGAATGG + Intergenic
1060331023 9:122670494-122670516 AGTATCTAACAACAGATGAAGGG + Intergenic
1061530487 9:131208327-131208349 AGTGTCAAACAGCAGATGAATGG + Intronic
1185895042 X:3850620-3850642 AGTGTCTATCAGCAGAGGAATGG + Intergenic
1185900160 X:3889045-3889067 AGTGTCTATCAGCAGAGGAATGG + Intergenic
1185905276 X:3927473-3927495 AGTGTCTATCAGCAGAGGAATGG + Intergenic
1186066732 X:5774567-5774589 AGTGCCTGCCAGCAGATGAATGG - Intergenic
1186782305 X:12925202-12925224 AGTGTCTATCAACAGATGAATGG + Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187793078 X:22971885-22971907 AGTATCCATCAACAGATGAATGG + Intergenic
1187843953 X:23516875-23516897 AGCATCTACCAACAGATGAATGG - Intergenic
1187845386 X:23531168-23531190 AGCAACTACCAACAGATGAATGG + Intergenic
1188089605 X:25947476-25947498 AGTGTCCACCAACAGATGAATGG + Intergenic
1188158575 X:26773291-26773313 AGTGTCCACCAGCAGTTGAAAGG + Intergenic
1188332407 X:28891666-28891688 AATGTCTACCAGCTGATGAAAGG - Intronic
1188961725 X:36501154-36501176 AGTGTCTATGTACAGATGAATGG - Intergenic
1188963003 X:36516605-36516627 AGTATCCATCAACAGATGAATGG + Intergenic
1188979117 X:36710811-36710833 AGTGTCTATCAACAGATGAATGG + Intergenic
1189013822 X:37075174-37075196 AGTGTCTATCAACAGATGAATGG + Intergenic
1189217482 X:39338984-39339006 AGTGTCTATCAACAGATGAATGG - Intergenic
1189362184 X:40361446-40361468 AGTGTCTATCAGCAGATGAACGG - Intergenic
1189538886 X:41965715-41965737 AGTATCCAACAACAGATGAATGG + Intergenic
1189844585 X:45122354-45122376 AGTATCTGTCAACAGATGAATGG - Intergenic
1189898372 X:45680322-45680344 AATATCCACCAGCAGATGCATGG + Intergenic
1190532309 X:51391819-51391841 AGTGTCCATGAACAGATGAATGG + Intergenic
1190583189 X:51908609-51908631 AGTATCTATTGACAGATGAATGG - Intergenic
1190804978 X:53826637-53826659 AGTATCCATCAACAGATGAATGG + Intergenic
1191131418 X:57015640-57015662 AGCATCTATCAACAGATGAATGG - Intergenic
1191683635 X:63866583-63866605 AGTGTCCATCAGCAGATGAATGG - Intergenic
1191967068 X:66770460-66770482 AGTGTCTATCAGCAGATGAATGG - Intergenic
1192029801 X:67497392-67497414 TGTATCCATAAGCAGATGAATGG + Intergenic
1192091871 X:68167836-68167858 AGTATCCATCAACAGATGAATGG + Intronic
1192303724 X:69935180-69935202 AGTATCTATCAACAGATGAATGG - Intronic
1192394704 X:70767725-70767747 AGTATCCACGGATAGATGAATGG + Intronic
1192655988 X:72995412-72995434 AGTGTCTATCAACAGATGAATGG + Intergenic
1192700343 X:73462819-73462841 AGTGTCCATCAGCAGATGAATGG - Intergenic
1192838598 X:74829442-74829464 AGTGTCTATCAACAGATGAATGG - Intronic
1193245708 X:79226375-79226397 AGTGTCCATCAGCAGATGAATGG - Intergenic
1193498753 X:82245387-82245409 AGTGTCCATCAGCAGATGAATGG + Intergenic
1193679033 X:84494943-84494965 AGTGTCTATCAACAGATGAATGG + Intronic
1193692496 X:84663811-84663833 AATATCCACCAACAGATGAATGG - Intergenic
1193738021 X:85184175-85184197 AGTGTCCATCAGCAGATGAATGG - Intergenic
1193869839 X:86783515-86783537 AGTATCCACCAACAGAAGAATGG + Intronic
1193982097 X:88194281-88194303 AGTGTCCATGAACAGATGAATGG + Intergenic
1194219096 X:91169282-91169304 AGTGTCCACCAGCAGATGAATGG - Intergenic
1194419470 X:93655685-93655707 AGTGTCCACCAACAGATGAATGG + Intergenic
1194537769 X:95127745-95127767 AGTGTCCATCAGCAGATGAATGG + Intergenic
1194563261 X:95448750-95448772 AGTGTCTGTCAGCAGATGAATGG - Intergenic
1194669900 X:96718670-96718692 AGTATCCATAAACAGATGAATGG - Intronic
1194899373 X:99489735-99489757 AGTTTCCATCAGCAGATGAATGG - Intergenic
1195136943 X:101917787-101917809 AGTGTCCACCAACAGATGAATGG + Intronic
1195444771 X:104939695-104939717 AGTGTCTATCAACAGATGAATGG + Intronic
1195480029 X:105334117-105334139 AGTATCTATCAACAGATGAATGG + Intronic
1195488970 X:105443732-105443754 AGTGTCCATCAGCAGATGAATGG - Intronic
1195495735 X:105530975-105530997 AGTATCCATCAACAGATGAATGG - Intronic
1195585065 X:106555729-106555751 AGTATCCACCAACAGATGAATGG + Intergenic
1195956614 X:110337815-110337837 AGTGTCTATCAACAGATGAATGG + Intronic
1196119103 X:112029384-112029406 AGTGTCCATCAGCAGATGAATGG - Intronic
1196460909 X:115929438-115929460 AGTGTCTATCACCAGATGAATGG - Intergenic
1196509198 X:116486021-116486043 TGTATCTATCAACAGATGAATGG + Intergenic
1196605235 X:117650066-117650088 AGCATCTATCAACAGATGAATGG + Intergenic
1197005557 X:121492479-121492501 AGTATCCACTGACAGATGAATGG - Intergenic
1197044857 X:121983387-121983409 AGTGTCCATTAGCAGATGAATGG - Intergenic
1197045189 X:121988136-121988158 AGTATCCATCAACAGATGAATGG - Intergenic
1197079147 X:122391221-122391243 AGTGTCTATTAACAGATGAATGG + Intergenic
1197113358 X:122802100-122802122 AGTGTCCACTAACAGATGAATGG + Intergenic
1197165365 X:123371273-123371295 AGGGTCCACAAGCAGATGAATGG - Intronic
1197310558 X:124900143-124900165 AGTATCTATGAACACATGAATGG + Intronic
1197362720 X:125526465-125526487 AGTGTCCATCAGCAGATGAATGG - Intergenic
1197367116 X:125577660-125577682 AGTGTCCATCAGCAGATGAATGG + Intergenic
1197731896 X:129817856-129817878 AGTGTCTATCAACAGATGAATGG - Intronic
1197915866 X:131534382-131534404 AGTATCCATCAACAGATGAATGG + Intergenic
1198193775 X:134338841-134338863 AGTATCCATCAACAGATGAATGG + Intergenic
1198342802 X:135731679-135731701 AGTGTCCTCCAGCAGATGAATGG - Intergenic
1198345187 X:135751616-135751638 AGTGTCCTCCAGCAGATGAATGG + Intergenic
1198516758 X:137416397-137416419 AGTATCTAAAAGCAGAAGTAGGG + Intergenic
1198926968 X:141808477-141808499 AATATCCACCAACAGATGAATGG - Intergenic
1198956907 X:142142870-142142892 AGTGTCCATCAGCAGATGAACGG + Intergenic
1199019556 X:142861441-142861463 AGTGTCCATCAGCAGATGAATGG - Intergenic
1199048767 X:143210207-143210229 AGTGTCTATTAGTAGATGAATGG + Intergenic
1199108503 X:143901649-143901671 AGTATCCATGGACAGATGAATGG + Intergenic
1199189955 X:144959558-144959580 AGTGTCTATCAACAGATGAATGG + Intergenic
1199739540 X:150720519-150720541 AATATCCACCAACAGATGAATGG - Intronic
1200555609 Y:4633038-4633060 AGTGTCCACCAGCAGATGAATGG - Intergenic
1201309525 Y:12583738-12583760 AGTGTCCATCAGCAGATGAATGG + Intergenic
1201915665 Y:19179149-19179171 AGTGTGTACTACCAGATGAAAGG + Intergenic
1202018537 Y:20437611-20437633 AGTATCCATCAGTAGATGAATGG + Intergenic