ID: 920627396

View in Genome Browser
Species Human (GRCh38)
Location 1:207615913-207615935
Sequence TTCTAGTTTGATATGAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 1, 2: 6, 3: 102, 4: 793}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920627396_920627399 0 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627399 1:207615936-207615958 GCATCAATTGCTTTTAGGGAAGG 0: 1
1: 1
2: 0
3: 10
4: 129
920627396_920627397 -5 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627397 1:207615931-207615953 TAGAAGCATCAATTGCTTTTAGG 0: 1
1: 1
2: 1
3: 20
4: 199
920627396_920627400 24 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627400 1:207615960-207615982 ACTGTTCTAAGCAGACTAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 174
920627396_920627401 27 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 108
920627396_920627398 -4 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627398 1:207615932-207615954 AGAAGCATCAATTGCTTTTAGGG 0: 1
1: 2
2: 2
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920627396 Original CRISPR TTCTAGTTTGATATGAATTT AGG (reversed) Intronic
900281990 1:1875846-1875868 TTCCAGGTAGACATGAATTTTGG - Intronic
900731086 1:4260806-4260828 TTATAATTTGATATGAGATTTGG - Intergenic
900840284 1:5043156-5043178 TTCTAGGTTCAGATGACTTTGGG + Intergenic
901128996 1:6950450-6950472 GTCTATTCTGATATGAGTTTTGG - Intronic
901442481 1:9286992-9287014 TTCCAGGTGGACATGAATTTTGG + Intergenic
901827933 1:11874668-11874690 TTCTGGGTGGACATGAATTTTGG - Intergenic
902205548 1:14865688-14865710 TTCCAGGTAGACATGAATTTGGG - Intronic
902253902 1:15174945-15174967 TTAGAGCTTCATATGAATTTTGG + Intronic
904849905 1:33450369-33450391 TTTTGGTTCTATATGAATTTTGG - Intergenic
907787955 1:57632378-57632400 TTCCAGTTTAACATGAAATTGGG + Intronic
908066395 1:60410129-60410151 TCCTAGTGTAATATGAAGTTGGG + Intergenic
908372836 1:63500786-63500808 TTGTAATTCCATATGAATTTTGG - Intronic
908736216 1:67279557-67279579 TTCTGGTTTAATATAAATTAAGG + Intergenic
909364879 1:74807941-74807963 TTGTAGTTTTGTATGAATTTTGG + Intergenic
909838569 1:80288938-80288960 TTGTAGTTTGATTTGCATTGTGG - Intergenic
909870039 1:80727992-80728014 TTCTAATTTGATATGATTGGTGG - Intergenic
909907226 1:81212322-81212344 TTCTAGTTTTGTGTGAATTCTGG - Intergenic
910357750 1:86378877-86378899 TTACAGTTTGACATGAAATTTGG - Intronic
910946450 1:92596871-92596893 TTCTAGTTTGGTTGTAATTTTGG + Intronic
911273748 1:95835698-95835720 TTGTTGTTTCTTATGAATTTTGG + Intergenic
911399219 1:97353656-97353678 TTCTCTTTAGAAATGAATTTTGG + Intronic
911748521 1:101468229-101468251 TTCCAAGTAGATATGAATTTGGG + Intergenic
912200317 1:107450227-107450249 TTCTAATTCTATAAGAATTTAGG - Intronic
912318658 1:108690052-108690074 TTCTAGTTACTTATAAATTTTGG + Intergenic
912464583 1:109862814-109862836 TTCCAGGTAGATATGAATTTGGG + Intergenic
912526905 1:110290247-110290269 TTCTGGGTAGACATGAATTTTGG - Intergenic
912749212 1:112271691-112271713 TTCTGGGTGGGTATGAATTTTGG + Intergenic
913037252 1:114982179-114982201 CCCTAGTTAGATATGAATGTAGG - Intronic
913431304 1:118795130-118795152 TTGTGGTTTTATATGATTTTAGG - Intergenic
913461703 1:119093388-119093410 TTCTAGGTAGACATGAATTTTGG - Intronic
913720804 1:121592361-121592383 ATCCAGTTTGAGATGATTTTTGG - Intergenic
914952303 1:152127021-152127043 CTCTAGTTTTATCTAAATTTGGG + Intergenic
915763881 1:158343150-158343172 TTTTGGTTCCATATGAATTTTGG + Intergenic
916597241 1:166256491-166256513 TTGTATTTTGGTATGCATTTTGG + Intergenic
917093060 1:171373461-171373483 TTCTAGTGTTATGTGACTTTTGG - Intergenic
917275680 1:173328821-173328843 TTCTAATTTGATTTAAATTGAGG - Intergenic
918388465 1:184035329-184035351 TACTAGTTTGATATGTGATTTGG - Intronic
918436978 1:184525177-184525199 TTTTATTTTTATATAAATTTTGG + Intronic
918909774 1:190552064-190552086 TTTTAGTTTGAAATAATTTTAGG + Intergenic
919359384 1:196571644-196571666 CTCTAGTTTGATATGCATTAGGG - Intronic
919514638 1:198507958-198507980 TTTTGGTTCCATATGAATTTTGG + Intergenic
919585653 1:199436392-199436414 TTCTAGGCAGATGTGAATTTGGG - Intergenic
920107825 1:203566924-203566946 TGCCAGTTGGATATAAATTTGGG - Intergenic
920267982 1:204740117-204740139 TTTTATTTCCATATGAATTTTGG + Intergenic
920520955 1:206625805-206625827 TTCTAGGTGGACGTGAATTTTGG - Intergenic
920624529 1:207583916-207583938 TTCTAATTTGCTTTGAATTTGGG - Intronic
920627396 1:207615913-207615935 TTCTAGTTTGATATGAATTTAGG - Intronic
920637336 1:207716795-207716817 TTCTAATTTGATATGAATTTAGG - Intronic
920936092 1:210436454-210436476 TTGTAGTTCCATATGAGTTTTGG + Intronic
921195996 1:212758782-212758804 TTCAAATTCCATATGAATTTTGG - Intronic
921618216 1:217297011-217297033 TTCCAGGTGGATATGAATATTGG - Intergenic
922343030 1:224672729-224672751 TTCCAGGTAGATATGAATTTTGG + Intronic
922778061 1:228226533-228226555 TTCTAGGTGGATGTGAATTTGGG - Intronic
924478378 1:244402619-244402641 TTTGCGTTTGATATAAATTTTGG - Intergenic
924717673 1:246592826-246592848 TTCTTGTTTGGTATGCAGTTTGG + Intronic
924744889 1:246822583-246822605 TTCTAGATGGACGTGAATTTTGG + Intergenic
1063540988 10:6933691-6933713 TTCTTTGTTGATATAAATTTAGG - Intergenic
1064066182 10:12183821-12183843 TTCTACTTTGTTATCAACTTAGG + Intronic
1064432453 10:15282965-15282987 CTTTAGTTTGAAATGAACTTGGG - Intronic
1064667094 10:17665623-17665645 TTCTAGTTTAACATTAATTTTGG + Intronic
1064703626 10:18047881-18047903 TTCCAGCTGGACATGAATTTTGG - Intergenic
1065140040 10:22711799-22711821 TTCTGGTTTGATTTCATTTTAGG - Intronic
1065565538 10:27004147-27004169 TTCTAGATGAATATGAATATAGG - Intronic
1065677331 10:28191626-28191648 TTTTAGATTGTTTTGAATTTTGG - Intronic
1065929112 10:30463456-30463478 ATCTAGGGTGATATGAAATTAGG - Intergenic
1066319635 10:34288939-34288961 TTCTATTTTAATATGACTTAAGG - Intronic
1066386791 10:34948072-34948094 TTCTAGATGGACATGAATTTTGG - Intergenic
1066748575 10:38628991-38629013 TTGTGGTTTCACATGAATTTGGG - Intergenic
1066968101 10:42288782-42288804 TTGTGGTTTCACATGAATTTGGG + Intergenic
1067914709 10:50384754-50384776 TTCTATTTTGAAATAATTTTAGG + Intronic
1068099328 10:52532404-52532426 TTTTAGTTCCATATCAATTTTGG - Intergenic
1068188743 10:53621836-53621858 GTCTAGTTTGATGTAAATTTCGG + Intergenic
1069209369 10:65736746-65736768 TTAAAATTTCATATGAATTTGGG - Intergenic
1069296336 10:66849460-66849482 TTCCAGGTTGACATGAATTTTGG - Intronic
1069487131 10:68830905-68830927 TTCTCTTTTGATATGAACCTAGG - Intronic
1069586137 10:69603915-69603937 TTCCAGATGGACATGAATTTTGG + Intergenic
1069840441 10:71336309-71336331 TTCTGGGTAGACATGAATTTTGG + Intronic
1070237825 10:74648830-74648852 AACTAGATTGTTATGAATTTAGG + Intronic
1070343819 10:75522744-75522766 TTTTAGTTTAATATCAATTCAGG - Intronic
1071209521 10:83322719-83322741 TTGTTGTTTCATATTAATTTGGG - Intergenic
1071947572 10:90663701-90663723 TTGTAGTTTTATATAAATTCTGG - Intergenic
1072058133 10:91781372-91781394 TTCCAGGTGGATATGAATTTGGG + Intergenic
1072133375 10:92518826-92518848 TTATAGTTTTATATGTTTTTAGG - Intronic
1072773208 10:98161518-98161540 TTTTTGTTTTATCTGAATTTTGG + Intronic
1073198501 10:101715380-101715402 TTGTGGTTCCATATGAATTTCGG + Intergenic
1073648880 10:105337607-105337629 TTATAATTTGAGATGAATTTTGG + Intergenic
1073836290 10:107447199-107447221 TTTTAGTGTAATTTGAATTTGGG - Intergenic
1074050317 10:109875707-109875729 TTCTATTTTGATATAATTTCAGG - Intronic
1074343633 10:112658801-112658823 TTCTAGTTTCTTTTGAAATTTGG - Intronic
1074356271 10:112786827-112786849 ATTCAGTTTGATAAGAATTTTGG + Intronic
1074624778 10:115169603-115169625 TTGCAATTTCATATGAATTTTGG + Intronic
1075680974 10:124330903-124330925 TTCCAGGTGGACATGAATTTTGG - Intergenic
1075986666 10:126793343-126793365 TTTTGGTTTCATATGAATTTTGG - Intergenic
1076411642 10:130255560-130255582 TTCCAGGTGGACATGAATTTTGG + Intergenic
1076484246 10:130805603-130805625 TTGTAGATAGACATGAATTTTGG - Intergenic
1077276174 11:1709992-1710014 TTTTAGTTTGAAATAATTTTGGG - Intergenic
1077996788 11:7459613-7459635 TTCTAGGTAGATGTAAATTTTGG - Intronic
1078520252 11:12057264-12057286 TTACAATTTGATATGAAATTTGG - Intergenic
1079022514 11:16921275-16921297 TGCTAGTTTGATTTGAGTTTAGG - Intronic
1079793795 11:24772996-24773018 TTCTAGGTAGACATGAATTTTGG + Intronic
1079855492 11:25598027-25598049 TTCAAGTTAGAACTGAATTTTGG + Intergenic
1079973909 11:27069068-27069090 TTTTGGTTCCATATGAATTTTGG + Intronic
1080208858 11:29761871-29761893 TTTCAGGTGGATATGAATTTTGG - Intergenic
1080229990 11:30010072-30010094 TTATATTTTGTTATTAATTTTGG - Exonic
1080821851 11:35814937-35814959 TTCAAGTATGATGTGAATCTGGG - Exonic
1081027880 11:38037934-38037956 TTCTAGGTAGACATGAATTTTGG - Intergenic
1081144601 11:39547203-39547225 TTATAGTTTGAGATGAGATTTGG - Intergenic
1081467753 11:43338763-43338785 TTCAATTTTAATATGAATTCAGG - Intronic
1081741449 11:45443878-45443900 TTCTGGGTTGACATGAATTTGGG + Intergenic
1084104229 11:66970485-66970507 TTATAGTTCGACATGAGTTTTGG - Intergenic
1084532516 11:69736451-69736473 TTCTGGTTTAATATAAATTAAGG - Intergenic
1085437424 11:76520716-76520738 TTCTAGTTATATGTTAATTTTGG - Intronic
1085849553 11:80103939-80103961 AACTTGTATGATATGAATTTTGG - Intergenic
1086520800 11:87665781-87665803 TTATAATTTGACATGAAATTTGG + Intergenic
1086546705 11:88004316-88004338 TGCAAGTTTGATATAACTTTTGG + Intergenic
1086614788 11:88803565-88803587 TTCTAGGTTGTTATGGTTTTAGG - Intronic
1087371068 11:97284770-97284792 TTGTTGTTTCATATAAATTTTGG - Intergenic
1087467572 11:98527761-98527783 CTATAGTTTGATATTTATTTTGG - Intergenic
1087649189 11:100845036-100845058 TTGTTGATTGATAGGAATTTGGG - Intronic
1087781834 11:102309623-102309645 TTTCAGCTAGATATGAATTTAGG + Intergenic
1087901071 11:103641746-103641768 TTCCAGGTGGACATGAATTTTGG - Intergenic
1088164463 11:106916651-106916673 TTCTTCTTTGATGTAAATTTTGG - Intronic
1088483168 11:110315359-110315381 TTCCATTTTTATATGAATTTTGG + Intergenic
1088646706 11:111923310-111923332 TTCTGTTTTGATGTGATTTTTGG - Intronic
1088745778 11:112803058-112803080 TTCTGGTTTCCTATAAATTTTGG - Intergenic
1089244148 11:117106086-117106108 TTCTAGTTTGAGAAAAATTGTGG - Intergenic
1089699016 11:120233193-120233215 TGCTAGTTTGTTAGGATTTTGGG - Intergenic
1089717032 11:120370459-120370481 TTCTTTTTCCATATGAATTTTGG + Intronic
1090005842 11:123001671-123001693 TTATAGTTTGACATGAGATTTGG - Intergenic
1090559126 11:127911013-127911035 TTTTGGTTTCATATGAATTTTGG + Intergenic
1090561782 11:127940439-127940461 TTCTGGTTTAATATAAATTAAGG - Intergenic
1090656671 11:128851107-128851129 TTCTAGTTTCTAGTGAATTTAGG + Intronic
1091702405 12:2672770-2672792 TTCTAGGCAGACATGAATTTTGG + Intronic
1091870713 12:3888667-3888689 TTTTATTTTGAAATGCATTTTGG + Intergenic
1092960206 12:13589860-13589882 TTCAAGTTAGATGTGAGTTTGGG - Intronic
1093105060 12:15076267-15076289 TTCTATTTTGATATGTTTCTAGG - Intergenic
1093287552 12:17283504-17283526 TTTTGGTTCCATATGAATTTTGG - Intergenic
1093467971 12:19469858-19469880 TTCTATTTTAAAATGAATTAAGG - Intronic
1093592895 12:20927337-20927359 TTTTGGTTGCATATGAATTTTGG + Intergenic
1093596155 12:20961890-20961912 TTCTATATTGATAAGCATTTAGG - Intergenic
1094157554 12:27353081-27353103 TTTTGGTTCCATATGAATTTTGG - Intronic
1094216418 12:27947561-27947583 TACTATTTTGATAAGCATTTTGG + Intergenic
1094262647 12:28519034-28519056 TTTTGGTTCCATATGAATTTGGG + Intronic
1095220089 12:39601062-39601084 TTATATTTTGATATTAATATTGG + Intronic
1095231384 12:39743948-39743970 GTTTTGTTTGATATTAATTTAGG - Intronic
1095402810 12:41834569-41834591 TACTATTTTAATATGGATTTAGG - Intergenic
1095669171 12:44837923-44837945 TTCTACTTTAAGATGATTTTAGG - Intronic
1095816453 12:46427783-46427805 TTTTGGTTCCATATGAATTTTGG - Intergenic
1097407253 12:59204459-59204481 TTTTTGTTTGACATGAATATAGG - Intergenic
1097660945 12:62430501-62430523 TTATAGTTCTATATGAATTTTGG - Intergenic
1097800449 12:63908194-63908216 TTATATTTCCATATGAATTTTGG + Intronic
1097831346 12:64227213-64227235 TTGTGGTTCCATATGAATTTTGG + Intergenic
1098232172 12:68383022-68383044 TTCTAGTTGGAAATGAGTGTGGG - Intergenic
1098648348 12:72933797-72933819 TTGTAGTTCTATATAAATTTTGG + Intergenic
1098911667 12:76215281-76215303 TTATACTTTAATATGAGTTTGGG + Intergenic
1099158261 12:79207365-79207387 TTTTAATTTGATTTGATTTTAGG + Intronic
1099244379 12:80177967-80177989 TTCTAGCCTTATATGAGTTTTGG + Intergenic
1099257407 12:80331109-80331131 TTGTACTTCCATATGAATTTAGG - Intronic
1099314875 12:81071616-81071638 TTCTGGTTCCATACGAATTTTGG - Intronic
1099378944 12:81932236-81932258 TGCTAGTTTCATATACATTTTGG - Intergenic
1100374282 12:93998441-93998463 TTTTAGCTCCATATGAATTTTGG - Intergenic
1100383316 12:94082793-94082815 TTCCAGTTTGAGATGAGATTTGG - Intergenic
1100968196 12:100036545-100036567 TTCTATTTTGTTAGGAATTAAGG - Intronic
1101448085 12:104752406-104752428 TTCTGGGTGGACATGAATTTGGG + Intronic
1101475433 12:105042380-105042402 TTAGAGTTTAATATGTATTTGGG + Intronic
1101571132 12:105954817-105954839 TTCTGGATGGACATGAATTTTGG + Intergenic
1101818876 12:108167714-108167736 TTCTAGATTCTTATGGATTTGGG - Intronic
1102217041 12:111169016-111169038 TTCTAGGTGGACATGAATTTTGG - Intronic
1102780076 12:115556687-115556709 TTCTAGGTGAATGTGAATTTTGG + Intergenic
1102916361 12:116756053-116756075 TTCTGGTTCCATATGAATTTTGG + Intronic
1103737029 12:123067007-123067029 CTCTAGTTAGATGTGAATTTGGG - Intronic
1103859109 12:123997717-123997739 TTCTGGATGGATATGAATTCTGG + Intronic
1104220971 12:126784891-126784913 TTCCAGATTGATTTGAATTGGGG - Intergenic
1104369571 12:128211791-128211813 TTCTAGGTGGACATAAATTTTGG + Intergenic
1104372771 12:128237928-128237950 TTCTGGGTAGACATGAATTTTGG - Intergenic
1104395124 12:128425950-128425972 TCCCCGTTTGATGTGAATTTGGG + Intronic
1104431480 12:128719940-128719962 TTCTGGGTGGACATGAATTTAGG + Intergenic
1105285992 13:19004547-19004569 TTCTAGTTTTATTTGCATTGAGG + Intergenic
1105336906 13:19480022-19480044 TTCAACTTTGATATTAATATTGG - Intronic
1105516125 13:21092346-21092368 TTCTCTTTTGTTATGAATGTAGG - Intergenic
1105560120 13:21482597-21482619 TTCTAATTGGATAGGATTTTTGG - Intergenic
1105678291 13:22699324-22699346 TTCCAGGTAGATGTGAATTTGGG + Intergenic
1106650668 13:31686794-31686816 TTCTAGGTAGACATAAATTTTGG + Intergenic
1107150838 13:37108798-37108820 TTTTAGTCTCATATGAATTTTGG + Intergenic
1107267310 13:38571537-38571559 TTTTGGTTTCATATAAATTTTGG - Intergenic
1107355825 13:39565553-39565575 TTGTAGTTTGAATGGAATTTTGG + Intronic
1108498315 13:51045972-51045994 TTCTGGGTGGACATGAATTTGGG - Intergenic
1108632143 13:52295159-52295181 TTCCACTTTGATATTAATATTGG - Intergenic
1108654557 13:52517436-52517458 TTCCACTTTGATATTAATATTGG + Intergenic
1108860962 13:54858281-54858303 TTACAGTTCGATATGAAATTTGG - Intergenic
1109015490 13:57007077-57007099 TTGTGGTTTCATATGAACTTGGG - Intergenic
1109050146 13:57469886-57469908 TTCTAGTGTGATTAGGATTTAGG + Intergenic
1109078965 13:57873656-57873678 TTCCAGTTAGAAATGAATTTAGG - Intergenic
1109693994 13:65929598-65929620 TTCTGGGTGGATGTGAATTTGGG + Intergenic
1109921673 13:69071729-69071751 TCATAGTTTTATATGAATATGGG + Intergenic
1110159069 13:72353458-72353480 TTCTCATTTGATATGATCTTGGG + Intergenic
1110279203 13:73673079-73673101 TCATGGTTTTATATGAATTTAGG + Intergenic
1110440397 13:75519976-75519998 TTATAATTTGATATGAGATTTGG - Intergenic
1111318519 13:86592912-86592934 TTATAATTTGAGATGAAATTTGG + Intergenic
1111823199 13:93238054-93238076 TTGTGGTTCCATATGAATTTTGG + Intronic
1112555046 13:100459274-100459296 TTCTGAGTAGATATGAATTTTGG + Intronic
1112838801 13:103549982-103550004 TTCCAGGTGGATATGAATTTTGG + Intergenic
1113002605 13:105660020-105660042 TTTTGGTATGATTTGAATTTAGG + Intergenic
1113088910 13:106596917-106596939 TTTTATTTTGAAATGATTTTAGG + Intergenic
1113203234 13:107889384-107889406 TTAGAATTTGATATGAAATTTGG + Intergenic
1113538828 13:111090693-111090715 TTCTACTTATATATGCATTTTGG + Intergenic
1114150009 14:20027442-20027464 TTTTTGTTAGATGTGAATTTTGG + Intergenic
1114877944 14:26746406-26746428 TTCTAGTATAATTTGAAGTTAGG - Intergenic
1115835914 14:37402341-37402363 ATCTAATTTTATATGCATTTTGG - Intronic
1115930619 14:38488405-38488427 TTGTAGTTCCATATGATTTTAGG + Intergenic
1116018947 14:39438740-39438762 TTTTGGTTCCATATGAATTTTGG + Intergenic
1116080534 14:40164940-40164962 TTGTAGTTCCATATAAATTTTGG - Intergenic
1116354595 14:43913021-43913043 TTCTAGTTTGTTAACAATTCCGG + Intergenic
1116646420 14:47534660-47534682 TTATAGTTTGAGATGAGATTTGG + Intronic
1117237703 14:53796075-53796097 TTCTATATTGATATCCATTTAGG + Intergenic
1118657100 14:67964331-67964353 TTTTAGTTTTATTTTAATTTTGG - Intronic
1119251031 14:73154271-73154293 GTGTAGTTGAATATGAATTTAGG - Intronic
1119670251 14:76512935-76512957 TTCTGGGTGGATGTGAATTTTGG - Intergenic
1119685904 14:76631007-76631029 TTCTAGGTGGATGTGAATTTTGG - Intergenic
1120144288 14:80962591-80962613 TTCCAGGTAGATATGAATTTTGG + Intronic
1120424889 14:84334716-84334738 TTCTGGGTAAATATGAATTTTGG + Intergenic
1120487540 14:85132989-85133011 TTCTACATTGATATTATTTTTGG - Intergenic
1120717710 14:87857866-87857888 TTCTATTTAGATGTGATTTTTGG + Intronic
1121484323 14:94303048-94303070 TTATAATTTGAGATGAAATTTGG + Intergenic
1121814113 14:96915957-96915979 TTCTGGGTGGACATGAATTTTGG + Intronic
1122394550 14:101414267-101414289 TTCCAGATAGACATGAATTTTGG - Intergenic
1122475358 14:102004376-102004398 TTCTGATGTGATCTGAATTTGGG + Intronic
1122595014 14:102884388-102884410 TTCCAGATAGACATGAATTTTGG + Intronic
1122966536 14:105130611-105130633 TTTTAGTTTTACATGAGTTTAGG - Intergenic
1123099740 14:105788939-105788961 TTGTAGTATAGTATGAATTTGGG - Intergenic
1123758594 15:23415858-23415880 TTCCAGGTGGATGTGAATTTTGG - Intergenic
1124010197 15:25831915-25831937 TTCCAGATGGACATGAATTTTGG - Intronic
1125061022 15:35424050-35424072 TTGTGGTTCCATATGAATTTTGG + Intronic
1125494172 15:40174982-40175004 TGCTATTTTTATGTGAATTTAGG + Intronic
1126457003 15:48874117-48874139 TTATTCTTTCATATGAATTTAGG - Intronic
1126568993 15:50129634-50129656 TTCCAGGTAGACATGAATTTTGG + Intronic
1126700661 15:51364113-51364135 TTATAGTTTTAATTGAATTTTGG + Intronic
1126877764 15:53062560-53062582 TTCTGGATGGATATGAATTTTGG + Intergenic
1126914540 15:53451312-53451334 TTCTATTTTATTATGGATTTGGG - Intergenic
1127474502 15:59320323-59320345 TTTTGGTTTCATAGGAATTTTGG - Intronic
1128932296 15:71716346-71716368 TTCCAGGTGGATATGAATTTTGG + Intronic
1129690131 15:77708477-77708499 TTCCAGATGGACATGAATTTGGG - Intronic
1129900211 15:79142009-79142031 TTACAATTTGATATGAAATTTGG + Intergenic
1130700402 15:86173932-86173954 TTGTGGTTTCATATGAATTTTGG + Intronic
1130750427 15:86705850-86705872 ATCTAGTTTGATTTTCATTTTGG + Intronic
1131351990 15:91709402-91709424 TTCAAATTCCATATGAATTTGGG - Intergenic
1131626915 15:94130178-94130200 TTTTGGTTCCATATGAATTTAGG + Intergenic
1131708217 15:95021773-95021795 TATTAGTTAGATATGCATTTAGG + Intergenic
1132600640 16:771084-771106 TTCTGGGTGGATGTGAATTTGGG - Intronic
1132658725 16:1052333-1052355 TTCTGGGTGGATATGAATCTGGG + Intergenic
1133332781 16:4986526-4986548 TTGTATTTCCATATGAATTTTGG + Intronic
1133336452 16:5009681-5009703 TTCTGGCTGGACATGAATTTTGG + Intronic
1133338061 16:5019407-5019429 TTCTAGGTGGACATGAATTTGGG - Intergenic
1133456697 16:5948427-5948449 TTCCAGGTAGACATGAATTTTGG - Intergenic
1133809969 16:9154363-9154385 TTCTAGGTGGACATGAATTTTGG + Intergenic
1133952703 16:10410063-10410085 TTTTGGTTCCATATGAATTTAGG + Intronic
1134797187 16:17051807-17051829 TTTTGGTTCCATATGAATTTTGG + Intergenic
1135733747 16:24914897-24914919 TTCTACTTGTATTTGAATTTGGG - Intergenic
1135787438 16:25362786-25362808 TTTTAAATTGTTATGAATTTAGG + Intergenic
1136734180 16:32448311-32448333 TTGTGGTTTCACATGAATTTGGG + Intergenic
1137474376 16:48794327-48794349 TTCCAGTTGGATATGAATTTTGG + Intergenic
1138325893 16:56167396-56167418 TTCTCGTAAGATATGTATTTTGG - Intergenic
1138416795 16:56876316-56876338 TTCTGGGTGGATGTGAATTTTGG + Intronic
1138563789 16:57817743-57817765 TTCCAGGTGGATATAAATTTGGG + Intronic
1138997744 16:62475066-62475088 TTATAATTTGATATGAGATTTGG - Intergenic
1139024009 16:62791236-62791258 TTTTGGTTCCATATGAATTTAGG + Intergenic
1139244089 16:65423915-65423937 TTTTAGTTTGAAATTAATGTTGG - Intergenic
1139367241 16:66441014-66441036 TTCTAGATTGATCTGAAGTGGGG - Intronic
1139814088 16:69652813-69652835 TTATAGCTTTATATAAATTTTGG + Intronic
1140142064 16:72267505-72267527 TTCTGGTTCTATATGAATTGTGG + Intergenic
1140282495 16:73567301-73567323 TTCTAGGTAGACATGAATTCTGG + Intergenic
1140637792 16:76936987-76937009 TTCTAAGTAGATGTGAATTTGGG - Intergenic
1140985933 16:80157958-80157980 TTCTAGGTAAACATGAATTTGGG + Intergenic
1141374136 16:83514233-83514255 TTCTGGGTAGACATGAATTTGGG - Intronic
1141437969 16:84011584-84011606 TTCCAGGTAGACATGAATTTTGG - Intronic
1141671555 16:85494727-85494749 TTCTGGGTGGATATAAATTTGGG + Intergenic
1141716412 16:85729565-85729587 TTCTGGGTTGATGTGAATTTGGG - Intronic
1203018897 16_KI270728v1_random:381288-381310 TTGTGGTTTCACATGAATTTGGG - Intergenic
1203037232 16_KI270728v1_random:654446-654468 TTGTGGTTTCACATGAATTTGGG - Intergenic
1143740418 17:8948861-8948883 TTCTAGTTTGAGAGTTATTTTGG - Intronic
1143790289 17:9289524-9289546 TTTTAGTTTGGTAGTAATTTAGG + Intronic
1144384767 17:14738997-14739019 TACTACTTGGATATGACTTTAGG - Intergenic
1144510667 17:15872398-15872420 TTTTGGTTCCATATGAATTTTGG + Intergenic
1144616489 17:16779774-16779796 TTTTGGTTCCATATGAATTTTGG - Intronic
1144896207 17:18535885-18535907 TTTTGGTTCCATATGAATTTTGG + Intergenic
1145136008 17:20408335-20408357 TTTTGGTTCCATATGAATTTTGG - Intergenic
1145174823 17:20690121-20690143 TTTTGGTTCCATATGAATTTTGG + Intergenic
1147503336 17:40987644-40987666 TTATAATTTGAGATGAAGTTTGG - Intergenic
1147526622 17:41230752-41230774 TTCTATTTGAATATGAGTTTTGG - Intronic
1147528738 17:41253415-41253437 TTCTATTTGAACATGAATTTTGG - Intronic
1147645408 17:42030655-42030677 TTCCAGATAGATGTGAATTTTGG - Intronic
1149117587 17:53116543-53116565 TTTTGGTTCCATATGAATTTTGG + Intergenic
1149172577 17:53828879-53828901 TTCTAGTTGCATATACATTTGGG + Intergenic
1149531008 17:57395291-57395313 TTCTAGATGGACACGAATTTTGG + Intronic
1149965182 17:61155234-61155256 ACACAGTTTGATATGAATTTTGG + Intronic
1150186136 17:63183414-63183436 TTCTAGTTTAATATAAATAAAGG + Intronic
1150476989 17:65483177-65483199 TTCTAGATGGACATGAACTTTGG + Intergenic
1150804956 17:68311445-68311467 TTCTAGATGGACATGAATTTAGG - Intronic
1151193927 17:72418532-72418554 TTCTAGATGGACATGAATTTTGG + Intergenic
1151249635 17:72824100-72824122 TTACAGTTTGATATGAGATTTGG - Intronic
1151263929 17:72939134-72939156 TTCTGGCTAGACATGAATTTTGG - Intronic
1151363299 17:73601386-73601408 TTCTGGGTGGACATGAATTTGGG - Intronic
1151596527 17:75081470-75081492 TTCTATTTTGACAGTAATTTGGG - Intergenic
1151881591 17:76898851-76898873 TTCCAGCTGGATATGAATTTTGG + Intronic
1153596879 18:6735154-6735176 TTCTATTTTGATGTAATTTTGGG + Intronic
1154263920 18:12862825-12862847 TTCTCATGTGATATGAATTCTGG - Intronic
1155072213 18:22326587-22326609 TTCTAGGTGGACATGAATTTTGG - Intergenic
1155738457 18:29254854-29254876 TTCTAAGTTGACATGAATTTTGG - Intergenic
1155797336 18:30056897-30056919 TTCTAGATTACAATGAATTTAGG - Intergenic
1156508368 18:37613863-37613885 TTCTAGTTTAATAAAAATTAAGG - Intergenic
1156568039 18:38218657-38218679 TTATAATTTGATATGAGATTTGG - Intergenic
1156640096 18:39084361-39084383 TTCTAGGTTGGTAGGTATTTTGG + Intergenic
1156948286 18:42862109-42862131 TTGCAATTTGAGATGAATTTTGG - Intronic
1157400945 18:47386768-47386790 TTTTGGTTCCATATGAATTTTGG - Intergenic
1157507900 18:48243676-48243698 TTTTAGTTCCATATGAATTTTGG - Intronic
1157933330 18:51847145-51847167 TTTTGGTTCCATATGAATTTTGG + Intergenic
1157961209 18:52155211-52155233 TTCTGGGTGGATATGAATTTGGG + Intergenic
1158077936 18:53552966-53552988 TTCTGGGTAGACATGAATTTTGG - Intergenic
1158268981 18:55692108-55692130 TGAGAGTTTGATATGGATTTGGG + Intergenic
1158802560 18:60929906-60929928 TTCTGGGTGGACATGAATTTTGG - Intergenic
1159319543 18:66829681-66829703 TTCTAGTTCTATATGAGATTTGG + Intergenic
1159419656 18:68201329-68201351 TTATTGTTTTATATGTATTTGGG + Intergenic
1159765476 18:72482845-72482867 TTATAATTTGACATGAAATTTGG + Intergenic
1159871218 18:73761366-73761388 GTCTAAATTGATATGATTTTGGG + Intergenic
1159876539 18:73817734-73817756 TTGTAATTTTGTATGAATTTTGG - Intergenic
1159881056 18:73858968-73858990 TTCTGGGTGGACATGAATTTTGG - Intergenic
1160180122 18:76626716-76626738 TTCTGGGTAGACATGAATTTTGG - Intergenic
1160689545 19:455108-455130 TTCCAGGTTGGCATGAATTTCGG + Intronic
1160946273 19:1645391-1645413 GTCTAGTCTGATGTGCATTTGGG - Intronic
1161228690 19:3161320-3161342 TTCCAGGTGGACATGAATTTTGG + Intronic
1161692020 19:5741244-5741266 TTCCAGGTTGACATAAATTTTGG - Intronic
1161757295 19:6143539-6143561 TTCTGGGTGGACATGAATTTTGG + Intronic
1162658969 19:12154895-12154917 GTCTATTTTAATATGAATGTGGG - Intronic
1163095277 19:15052859-15052881 TTCTAGCTTGGTATGAACTTGGG - Intronic
1163749949 19:19070726-19070748 TTCCAGGTGGACATGAATTTGGG + Intronic
1164021249 19:21308252-21308274 TTATAGTTTCATGTAAATTTAGG - Intronic
1164214989 19:23136780-23136802 TTGTAGTTTCATGTAAATTTTGG + Intronic
1164426149 19:28143447-28143469 TTCTGCATTGCTATGAATTTTGG - Intergenic
1164531180 19:29049364-29049386 TTCGTGGTGGATATGAATTTTGG + Intergenic
1164791982 19:30994570-30994592 TTGTAGTAAGTTATGAATTTGGG + Intergenic
1165969574 19:39615237-39615259 TTGTAGTTTAATTTGAAGTTGGG + Intergenic
1167340309 19:48911802-48911824 TTCCAGGTGGACATGAATTTGGG + Intronic
925250424 2:2431515-2431537 TTCTGGTTCCATAAGAATTTTGG - Intergenic
925788799 2:7460613-7460635 TTGTAGTTCCATATAAATTTTGG + Intergenic
925848609 2:8057517-8057539 TTGTGGTTTGATACAAATTTTGG + Intergenic
926167242 2:10528952-10528974 TTTGATTTTGATATGTATTTGGG + Intergenic
926455070 2:13056951-13056973 TTTTATTTTGATGTTAATTTAGG - Intergenic
926477168 2:13338112-13338134 TTTTGGTTTCATATGAATTTTGG + Intergenic
926752114 2:16206197-16206219 TTCTGGGTGGACATGAATTTAGG - Intergenic
927189957 2:20510764-20510786 TTCTGGGTAGATGTGAATTTGGG + Intergenic
927300598 2:21508207-21508229 TTTTAGTTTCAAATGAGTTTAGG - Intergenic
928282166 2:29957335-29957357 GTCCAGTTTGATATGTATTTTGG + Intergenic
928783182 2:34849603-34849625 TTCTAAATGGATATGAATTTTGG - Intergenic
928798186 2:35051806-35051828 TTCATGTTTGAAATGATTTTGGG + Intergenic
930117214 2:47728574-47728596 TTCTAGTTATTTATAAATTTTGG + Intronic
930346147 2:50184135-50184157 TTTTTGTTTAATATGAATTATGG - Intronic
930611293 2:53546916-53546938 TTATAGTTTACCATGAATTTTGG - Intronic
930813853 2:55571432-55571454 TTATATTTTTATATTAATTTTGG - Intronic
930841395 2:55850921-55850943 TTTTAGTTTCAGATGAGTTTAGG + Intergenic
930996106 2:57720732-57720754 TTCTAGAATGATAGGTATTTGGG - Intergenic
931509574 2:62975982-62976004 TTCCAGTGGGAAATGAATTTTGG - Intronic
931562915 2:63582525-63582547 TTATAGTTTTCAATGAATTTGGG - Intronic
932062488 2:68520806-68520828 TTTTGGTTTCATATGAATTTTGG + Intronic
932293294 2:70602456-70602478 TTCTGGTTTGATTTCAATTGTGG + Intergenic
932956795 2:76360510-76360532 TTCTATTTTTATATATATTTTGG + Intergenic
933092565 2:78138632-78138654 TTATAATTTGAGATGAAATTTGG - Intergenic
933173393 2:79150507-79150529 TTCTAGTATAATTTGAAGTTGGG + Intergenic
933209625 2:79551923-79551945 TTATAATTTGACATGAAATTTGG + Intronic
933458164 2:82543619-82543641 TTCTAATTTGAGATGAGATTTGG - Intergenic
933475674 2:82787256-82787278 TTCTGGTTTCATATGAATTTAGG - Intergenic
933844146 2:86311742-86311764 TTCCAGGTGGACATGAATTTTGG + Intronic
934311553 2:91871135-91871157 TTGTGGTTTCACATGAATTTGGG - Intergenic
935007483 2:99093904-99093926 TTTTGGTTCCATATGAATTTTGG - Intronic
935050372 2:99520107-99520129 TCCTAGTTTAATTTGGATTTTGG + Intergenic
935446548 2:103162747-103162769 TTCAAGTTTGATACTCATTTTGG - Intergenic
935855663 2:107270235-107270257 ATCTAATGTGATATGCATTTGGG + Intergenic
936968224 2:118148137-118148159 TTCTGGGTGGACATGAATTTTGG + Intergenic
937286426 2:120756059-120756081 TTGCATTTTCATATGAATTTTGG + Intronic
937447054 2:121967296-121967318 TTATAATTTGACATGAGTTTTGG + Intergenic
937449269 2:121987837-121987859 TTGTTGTTTCATATAAATTTGGG - Intergenic
938172607 2:129092991-129093013 TTATAGTTTGCTAAGAATTATGG + Intergenic
939272068 2:139952139-139952161 TTGTTTTTTGATTTGAATTTTGG - Intergenic
939311426 2:140482500-140482522 TTCTAATTTATTATTAATTTAGG - Intronic
939535980 2:143429236-143429258 TGCTTGTTTGAAATAAATTTTGG + Intronic
939598698 2:144161456-144161478 TTCTGGTAAGATATGAAATTTGG - Intronic
939835755 2:147127127-147127149 TTTTGGTTCCATATGAATTTTGG + Intergenic
939852770 2:147320211-147320233 TTAAAGTTTGAGATGAAATTTGG - Intergenic
939886265 2:147685206-147685228 TTCCAGCTGGATATGAATCTTGG - Intergenic
939954167 2:148511538-148511560 TTCTAGTTTTATATGAAAAATGG - Intronic
940016024 2:149105293-149105315 TTGCATTTTGATATGGATTTTGG + Intronic
940101150 2:150040054-150040076 TTGTGGTTCCATATGAATTTTGG - Intergenic
940112840 2:150172939-150172961 TTTTTGTTTGATATGATTTTTGG - Intergenic
940687445 2:156871126-156871148 TTTTAATTTTATATGAAATTTGG - Intergenic
940889000 2:159016425-159016447 TTAGACTTTGACATGAATTTTGG + Intronic
941018457 2:160383435-160383457 TTCTGGTTAGACATGAATTGGGG + Intronic
941081619 2:161067783-161067805 CTCAAGTTTGATATGTATTAGGG - Intergenic
941266093 2:163365157-163365179 TTGTTGTGTGATATGAATTTGGG + Intergenic
941669734 2:168280179-168280201 TTCTAGTTTGATAATAATAATGG + Intergenic
941997366 2:171613144-171613166 TTTTAGTTCCATATGAACTTTGG - Intergenic
942931076 2:181493227-181493249 TTCTTATGTGATATGAATTAAGG + Intronic
943202943 2:184852932-184852954 TTTTGGTTTCATATAAATTTAGG + Intronic
943443822 2:187957186-187957208 TTCTAGTTAGTTATTTATTTGGG - Intergenic
943475538 2:188350187-188350209 TTGTATTTCTATATGAATTTTGG + Intronic
943826205 2:192397013-192397035 TTCTGGTTTCAAATCAATTTTGG + Intergenic
943862941 2:192892128-192892150 TTCTAGGTAGGCATGAATTTGGG + Intergenic
944470100 2:200044059-200044081 TTGTAGTTTCATAAGAATTTTGG - Intergenic
944545882 2:200798470-200798492 TTCCAGGTAGACATGAATTTGGG + Intergenic
944596916 2:201269308-201269330 TTCCAGATAGACATGAATTTTGG + Intronic
944677730 2:202048230-202048252 TTCTAGAAGGACATGAATTTTGG - Intergenic
944794897 2:203173507-203173529 TTATAGATTGATATGAAAGTAGG + Intronic
944889723 2:204104888-204104910 TTCTAAGTTGATATTCATTTGGG + Intergenic
945286109 2:208083816-208083838 TTTTGGTTCCATATGAATTTAGG - Intergenic
945743127 2:213687753-213687775 TTGAAGTTTGATATGATTCTCGG + Intronic
945964405 2:216170608-216170630 CTCTAATTTGATATGAGATTTGG + Intronic
946064583 2:216975605-216975627 TTCTAGGTGGATATAGATTTTGG + Intergenic
947120101 2:226805096-226805118 TTCTTGTTTGATAAGAATCAGGG + Intergenic
947858281 2:233339480-233339502 TTCTACTTTGTTAGAAATTTGGG - Intronic
947895003 2:233662828-233662850 TTTTTGTCAGATATGAATTTTGG + Intronic
948649195 2:239429125-239429147 TTTTAGTTAGAGATGACTTTAGG + Intergenic
1168735142 20:128450-128472 TTGATGTTTGATATTAATTTGGG - Intergenic
1168823213 20:791182-791204 TTCTAGTTACTTATAAATTTGGG - Intergenic
1169334795 20:4747346-4747368 TTCTAGGTGGATGTGAGTTTTGG - Intergenic
1169623769 20:7539725-7539747 TTTTAGTTAGGTATGATTTTTGG - Intergenic
1170670425 20:18427782-18427804 TTCATGTTAAATATGAATTTAGG + Intronic
1170714370 20:18819136-18819158 TTCCAGTTTGACATGAGATTTGG + Intronic
1170750871 20:19143599-19143621 TTCTAAATGGACATGAATTTGGG - Intergenic
1173428526 20:42964354-42964376 TTTTACTTTGATATGGATATTGG - Intronic
1173572187 20:44084547-44084569 TTCTGGGCAGATATGAATTTTGG - Intergenic
1173778624 20:45734833-45734855 TTGTGGTTCCATATGAATTTGGG - Intergenic
1174822529 20:53739343-53739365 TTCTAGTGAGCTATAAATTTTGG + Intergenic
1175512812 20:59545253-59545275 ATATATTTTGATATGTATTTGGG - Intergenic
1175649954 20:60711880-60711902 TTGTATGTGGATATGAATTTTGG + Intergenic
1175780420 20:61678916-61678938 TTCTAGGAGGACATGAATTTGGG + Intronic
1176888526 21:14285640-14285662 TTTTTGTTAGATATGAATTGTGG + Intergenic
1177084286 21:16682512-16682534 TTATAATTTGAGATGAGTTTTGG + Intergenic
1177086431 21:16710960-16710982 TTGTAGTATTATATGAGTTTTGG + Intergenic
1177205472 21:18005738-18005760 TTCTAGGTGGATATGGATTCTGG - Intronic
1177383466 21:20376435-20376457 TTAAATTTTGATATGAGTTTTGG - Intergenic
1177532073 21:22373554-22373576 TTGCAGTTTCATATAAATTTTGG - Intergenic
1177621095 21:23594259-23594281 TTGGTGTCTGATATGAATTTAGG - Intergenic
1177800009 21:25819473-25819495 TTCTGGCTAGACATGAATTTTGG - Intergenic
1177851764 21:26357655-26357677 TTATAGGTAGACATGAATTTTGG - Intergenic
1177867616 21:26531390-26531412 TTATAGTTTGACATGAGATTTGG - Intronic
1177995042 21:28086613-28086635 TTTTGGTTCTATATGAATTTTGG + Intergenic
1178080775 21:29062477-29062499 TCCTAGATTGGTATGTATTTTGG - Exonic
1178139727 21:29669088-29669110 TTCAAATTTCAAATGAATTTTGG + Intronic
1179143190 21:38745339-38745361 TTCAAGGTTTATATAAATTTAGG - Intergenic
1179936188 21:44605455-44605477 TTATGGTTTCATATGAATTTTGG - Intronic
1179938670 21:44623199-44623221 TTCTGGGTGGATATGACTTTTGG + Intronic
1182199148 22:28552382-28552404 TTTTGGTTCCATATGAATTTTGG - Intronic
1182670788 22:31994094-31994116 TTCTGGGTGGACATGAATTTTGG + Intergenic
1182943559 22:34301068-34301090 TTCTGGATGGATATGAATTTGGG - Intergenic
1183013905 22:34970332-34970354 TTCTGGGTAGACATGAATTTTGG - Intergenic
1183532483 22:38367529-38367551 TTCAACTTTGATATTAATATTGG - Intronic
1184484685 22:44769443-44769465 TTTTAGTTTCAGATAAATTTTGG + Intronic
1184748882 22:46472992-46473014 TTCCAGGTGGATGTGAATTTTGG + Intronic
1184909325 22:47516018-47516040 TTCTTCTTTGATATTAATATTGG - Intergenic
949171315 3:1000751-1000773 TTGTATTTCTATATGAATTTGGG + Intergenic
949376489 3:3395955-3395977 TTTTATTTTCTTATGAATTTTGG + Intergenic
950724117 3:14905304-14905326 TTCTCTTTTGATTTGATTTTGGG + Intronic
950801879 3:15559014-15559036 TTCTAAATTAATCTGAATTTTGG - Intergenic
951094501 3:18612698-18612720 TTTTGGTTTCATATGATTTTAGG - Intergenic
951267112 3:20580999-20581021 TTGTGGTTTCATATGAATTTGGG - Intergenic
951482437 3:23175758-23175780 TTCCAGATTGACATGAGTTTGGG - Intergenic
951757565 3:26108185-26108207 TTTTGGTTTCATATGAATTTAGG + Intergenic
952528299 3:34236947-34236969 TTCTGGTTTGAAGTGACTTTTGG - Intergenic
952659386 3:35826595-35826617 TTCTGGATGGATATGAATTTTGG - Intergenic
952921586 3:38288856-38288878 TCTTAGTTTGAAATGATTTTAGG + Intronic
954478850 3:50778100-50778122 TTGTATTCTTATATGAATTTTGG + Intronic
955083768 3:55682115-55682137 TTCTCATTTCATATGACTTTAGG + Intronic
955455615 3:59117930-59117952 TTCAAATTTAATAAGAATTTAGG - Intergenic
955665591 3:61346126-61346148 TTCTGGGTAGACATGAATTTGGG - Intergenic
955957124 3:64302418-64302440 TTCTATGGTGAAATGAATTTGGG - Intronic
956959140 3:74377042-74377064 TTGTAGTTTGATATCTCTTTTGG - Intronic
957067325 3:75535891-75535913 TTTTAGTTCCAAATGAATTTTGG + Intergenic
957578248 3:82036348-82036370 TTATATTTTAATATGAAATTTGG + Intergenic
957760066 3:84544022-84544044 TTTTTGTTCCATATGAATTTTGG + Intergenic
958009624 3:87859928-87859950 TTCTAATAAGATATCAATTTAGG - Intergenic
958762731 3:98328306-98328328 TCCTTGTGTGATATGACTTTGGG - Intergenic
958811951 3:98870427-98870449 TTTTGGTTTTATTTGAATTTAGG + Intronic
959551143 3:107659497-107659519 TTATATTTTGATAGGTATTTGGG - Intronic
959999184 3:112713174-112713196 TTATAATTTGACATGAAATTTGG - Intergenic
960542081 3:118872157-118872179 TTCTAATTTGACATGAGATTTGG - Intergenic
960627573 3:119696090-119696112 TTGGAGTTTGTTCTGAATTTTGG - Intergenic
960724617 3:120658026-120658048 TTATAATTTGATATGAAATTTGG + Intronic
961190373 3:124955858-124955880 TTTTGGTTCCATATGAATTTTGG + Intergenic
961285824 3:125802077-125802099 TTTTAGTTCTAAATGAATTTTGG - Intergenic
963096488 3:141547188-141547210 TTGTGGTTTCATATAAATTTTGG + Intronic
963272267 3:143297524-143297546 TTGTGGTTCCATATGAATTTTGG + Intronic
963694620 3:148550094-148550116 TTGTAGTTTTAGATGAATTTTGG - Intergenic
964481253 3:157140731-157140753 TTCTAGGTGGACATCAATTTTGG - Intergenic
964991149 3:162814101-162814123 TTTTGGTTCCATATGAATTTTGG + Intergenic
965260923 3:166483685-166483707 TTCGAGTTTCATATATATTTGGG - Intergenic
965329697 3:167356278-167356300 TTCTTATTTGATATGATGTTTGG - Intronic
965652091 3:170945090-170945112 TTTTGGTTCCATATGAATTTAGG + Intergenic
965969407 3:174535309-174535331 TTCTAGTTTTATGTAAATATAGG + Intronic
966116814 3:176473675-176473697 TTTTGGTTCCATATGAATTTAGG + Intergenic
966513748 3:180793937-180793959 TTGTAGTTTCATATAAATTTTGG + Intronic
967455274 3:189678573-189678595 TTTCAGTTTCATATAAATTTCGG + Intronic
967729014 3:192889691-192889713 TTCTTGTTTGTTAGGTATTTTGG - Intronic
968898855 4:3421268-3421290 ATGTTGTTTGATAGGAATTTTGG + Intronic
969011913 4:4072454-4072476 TTTTAGTTCCAAATGAATTTTGG + Intergenic
969382232 4:6810079-6810101 TTTTGATTTCATATGAATTTAGG - Intronic
969742177 4:9037266-9037288 TTTTAGTTCCAAATGAATTTTGG - Intergenic
969763105 4:9205084-9205106 TTCTAGTATGGTTTGAAGTTAGG - Intergenic
970053437 4:11943250-11943272 TTGCATTTTTATATGAATTTTGG + Intergenic
970569007 4:17361248-17361270 TTCTGGGTAGATGTGAATTTTGG + Intergenic
970907207 4:21229965-21229987 TTCCAGGTAGATATGAATGTTGG - Intronic
970994952 4:22255930-22255952 TTCTAGTATAATTTGAAGTTGGG + Intergenic
971127457 4:23770112-23770134 TTCTAGTTTCATAAGGATCTGGG - Intronic
971642739 4:29156794-29156816 CTCTAGTTGTACATGAATTTAGG - Intergenic
971899319 4:32638126-32638148 TGTTAGTTTGACATGAATGTTGG - Intergenic
972018414 4:34276213-34276235 TTTCAGTTCCATATGAATTTTGG + Intergenic
972057268 4:34818994-34819016 TTCAAGGTTGATGAGAATTTAGG - Intergenic
972159069 4:36200082-36200104 TTCAATGTTTATATGAATTTAGG - Intronic
972796264 4:42423325-42423347 TTTTACTTTTATATGAGTTTTGG + Intronic
972859999 4:43156152-43156174 TTTTGGTTACATATGAATTTTGG + Intergenic
973222375 4:47743345-47743367 TTATAGTTTTGTATGAATTCTGG - Intronic
973585293 4:52384373-52384395 TTCCAGATAGATGTGAATTTGGG + Intergenic
973766194 4:54165157-54165179 TTACATTTTGACATGAATTTTGG + Intronic
973847136 4:54924343-54924365 TTCTGGGTTAACATGAATTTGGG + Intergenic
974192350 4:58522382-58522404 TATTATTTTGAAATGAATTTGGG - Intergenic
974343179 4:60640396-60640418 TTCTAGGTGCATATGAATTTTGG + Intergenic
974411627 4:61548765-61548787 TTTTGGTTTCATATGAATTTAGG + Intronic
974414217 4:61583597-61583619 TGTATGTTTGATATGAATTTTGG + Intronic
974535449 4:63168146-63168168 TTCTAGGTGGACATGAAATTTGG - Intergenic
974551195 4:63377431-63377453 TTTTAGTTTTATATCATTTTTGG + Intergenic
974746416 4:66084031-66084053 TTCTAGTTACTTATAAATTTTGG + Intergenic
975373530 4:73615291-73615313 TTTTAGTTTGCTATGAATCATGG - Intronic
976561726 4:86509650-86509672 TTCCAGTTTTAAATGAGTTTAGG - Intronic
977351559 4:95894925-95894947 ATCTAGAATAATATGAATTTTGG - Intergenic
977804233 4:101277663-101277685 TTATAGATTGATTTAAATTTTGG - Intronic
978596583 4:110384037-110384059 TTCTAGTCTGATGGGCATTTAGG - Intronic
978661520 4:111132675-111132697 TTCTAGTATAATTTGAAGTTAGG + Intergenic
978688478 4:111478703-111478725 TTACAGTTTGAGATGAAATTTGG + Intergenic
978937529 4:114396213-114396235 TTCTAGATGGACATGAATTTGGG + Intergenic
979353262 4:119670984-119671006 TATCACTTTGATATGAATTTAGG - Intergenic
979420911 4:120503783-120503805 TTATAATTTGATATGAGATTTGG + Intergenic
979506134 4:121499444-121499466 TTGTGGTTCCATATGAATTTTGG + Intergenic
979782705 4:124673863-124673885 TTCTATTTTTATATAGATTTAGG - Intronic
979794557 4:124830558-124830580 TTTTGGTTTCATATGAATTTAGG + Intergenic
979838590 4:125406485-125406507 TTGTGGTTTCGTATGAATTTTGG + Intronic
980672186 4:136024636-136024658 TTTTGGTTCCATATGAATTTTGG - Intergenic
980983777 4:139675912-139675934 GTCTAGTTACATATAAATTTTGG + Intronic
981256667 4:142669316-142669338 TTGTGGTGTCATATGAATTTTGG - Intronic
981351568 4:143735791-143735813 TTTTGGTTTAATATAAATTTAGG + Intergenic
981486433 4:145291467-145291489 TTACAGTTTGAGATGAAATTTGG - Intergenic
982478654 4:155882221-155882243 TTCTGGATGGACATGAATTTTGG - Intronic
982478665 4:155882335-155882357 TTCTAGATGGACATGGATTTTGG - Intronic
982804098 4:159741672-159741694 TTTTGGTTCCATATGAATTTTGG + Intergenic
983017626 4:162633692-162633714 TTGTGGTTCCATATGAATTTCGG - Intergenic
983468517 4:168125879-168125901 TTCTAGTTACATAAGAATTTAGG - Intronic
983668080 4:170205004-170205026 TTCTAGTCTACTTTGAATTTAGG - Intergenic
983714974 4:170770680-170770702 TTCTAGGTAGACATGAATTTGGG - Intergenic
983763634 4:171447995-171448017 TTTTATTTTGAAATAAATTTAGG + Intergenic
983853193 4:172608627-172608649 TTTTGGTTTTATATGAATTTTGG + Intronic
984098384 4:175459388-175459410 TTCTAAGTAGATATGAGTTTAGG - Intergenic
984221781 4:176987060-176987082 TATTACTTTGAAATGAATTTTGG - Intergenic
984368324 4:178827885-178827907 CTTTAGTTAGATATGTATTTAGG + Intergenic
984671944 4:182499651-182499673 TTTTAATTTGCTATGAGTTTAGG - Intronic
984890148 4:184484631-184484653 TACAAGTTTGAAATGAATGTTGG - Intergenic
985093286 4:186386088-186386110 TTATGGTTCCATATGAATTTTGG - Intergenic
986383846 5:7211662-7211684 TTCCAGGCTGATATGAATTTTGG + Intergenic
986387992 5:7256347-7256369 TTAAACTTTAATATGAATTTTGG + Intergenic
986709560 5:10478731-10478753 TTCTGGGTGGACATGAATTTTGG + Intergenic
987496763 5:18655236-18655258 TTATAGTTAGATATAAATCTCGG - Intergenic
987808023 5:22795804-22795826 TACTATTTTGATACCAATTTTGG - Intronic
987849521 5:23332587-23332609 TTCTTGGTAGATATAAATTTGGG - Intergenic
987913864 5:24186336-24186358 TTCTAGTATGGTTTGAAGTTAGG + Intergenic
988052520 5:26049366-26049388 TTAAATTTTAATATGAATTTTGG + Intergenic
988259456 5:28865550-28865572 TTCTATTTTTATATAAATTTTGG - Intergenic
988596923 5:32603004-32603026 TCCTAGGTTTATGTGAATTTAGG + Exonic
989048932 5:37299584-37299606 CTCTAGTTGGATGTTAATTTTGG - Intronic
989394583 5:40940529-40940551 TTTTAATTTGATATGCATTTAGG - Intronic
989507216 5:42240728-42240750 TTTTATTTTGATATCAACTTTGG - Intergenic
990004262 5:50926831-50926853 TTGTGGTTCTATATGAATTTTGG - Intergenic
990011611 5:51005635-51005657 CTCTAGTTTGGTATTACTTTGGG + Intergenic
990027537 5:51213028-51213050 TTTTAGTTTAATATTATTTTAGG + Intergenic
990182725 5:53180553-53180575 TTACAATTTGATATGAAATTTGG - Intergenic
990726847 5:58765791-58765813 TTATAATTTGACATGAAATTTGG - Intronic
990918239 5:60933978-60934000 TTGTTGATTGATATGCATTTGGG + Intronic
992464182 5:76987609-76987631 TTCTGGGTGGACATGAATTTTGG - Intergenic
992537906 5:77730140-77730162 TTCTGGGTTGACATGAATTTTGG - Intronic
992599386 5:78382841-78382863 TCGTTGATTGATATGAATTTAGG + Intronic
992879735 5:81095602-81095624 TTCAAGCTCCATATGAATTTTGG + Intronic
992942471 5:81775805-81775827 TTCTAGTTTTAAATGGATTATGG - Intergenic
992968615 5:82031190-82031212 TTCAAATTTGATATGATTTCTGG - Intronic
992969957 5:82046216-82046238 TTCCAGGTGGACATGAATTTGGG - Intronic
993644538 5:90446336-90446358 TTGTGGTTCCATATGAATTTTGG - Intergenic
993742052 5:91553648-91553670 TTCCAGGTGGACATGAATTTTGG - Intergenic
993774802 5:91979623-91979645 TTCTAAAGTGCTATGAATTTTGG - Intergenic
993847938 5:92968825-92968847 TTCTTTTTTAAAATGAATTTAGG - Intergenic
993904311 5:93605702-93605724 TTCTTGGTTGAAATGTATTTGGG - Intergenic
994031162 5:95144884-95144906 TTTTGGTTCCATATGAATTTTGG + Intronic
994426368 5:99593081-99593103 CTCTAGGTTGATATAAGTTTGGG - Intergenic
994637130 5:102357524-102357546 TTAAAATTTCATATGAATTTTGG - Intergenic
995023660 5:107394940-107394962 ATATAGTTTGATATCTATTTAGG + Intronic
995468571 5:112476366-112476388 TTAAAGTTTAATTTGAATTTTGG - Intergenic
995608294 5:113881692-113881714 TTCTAATTTGAGATGAGATTTGG - Intergenic
995636528 5:114199582-114199604 TGATTGTTTTATATGAATTTTGG + Intergenic
995680278 5:114709843-114709865 TTCTAGTTTTAACTGCATTTTGG - Intergenic
995770972 5:115669577-115669599 TTTTAATTTCATATAAATTTTGG - Intergenic
996142961 5:119936695-119936717 TTTTAGTTTTAATTGAATTTTGG - Intergenic
996242901 5:121224722-121224744 TTCTAGGTTGTTATGGCTTTAGG - Intergenic
996324370 5:122255952-122255974 TTATAATTTGACATGAAATTTGG + Intergenic
998929840 5:147169224-147169246 TTCTACTATGATTTCAATTTGGG - Intergenic
999011837 5:148050678-148050700 TTATAGTTTGAAACAAATTTTGG + Intronic
999343377 5:150793323-150793345 TTTTGGTTCCATATGAATTTTGG - Intronic
1000024399 5:157346306-157346328 TTCTGGATGGATATGTATTTTGG - Intronic
1000769247 5:165331556-165331578 TTGTAGTTTAATTTTAATTTGGG + Intergenic
1000873707 5:166608891-166608913 TTTTTGTTTCATATGAATATTGG - Intergenic
1001083352 5:168682863-168682885 TGGTAGTTTGACATGATTTTAGG + Intronic
1001850704 5:174962465-174962487 TTCTATCTTGCAATGAATTTTGG + Intergenic
1002008543 5:176257163-176257185 TTATAGTTTGATATATCTTTCGG + Intronic
1002111767 5:176919948-176919970 TTGTATTTTGGTATGAATTTTGG + Intronic
1002218180 5:177655088-177655110 TTATAGTTTGATATATCTTTCGG - Intergenic
1002545281 5:179938707-179938729 TTCTGGTTTAATATAAATTAAGG - Intronic
1002845870 6:943674-943696 TGCTAGTCTAATATAAATTTAGG - Intergenic
1003380749 6:5622447-5622469 TTCCTGTTTGACATGAATTTTGG - Intronic
1003822079 6:9909810-9909832 TACTAGGCTGATATGAATCTTGG + Intronic
1003954185 6:11146831-11146853 TTCCAGGTAGATGTGAATTTTGG - Intergenic
1004460855 6:15834531-15834553 TTTTAGTTTAAAATGATTTTAGG - Intergenic
1004841381 6:19589160-19589182 TTACAATTTGATATGACTTTTGG + Intergenic
1005128963 6:22481028-22481050 TTCTTGCTTGACATTAATTTAGG - Intergenic
1005635480 6:27749300-27749322 TTGTAGTTTCATATAATTTTAGG + Intergenic
1008226507 6:48924776-48924798 TTCTATTTTAATATAAATTCAGG - Intergenic
1008766840 6:54927426-54927448 TTCTATCATGATATGGATTTTGG + Intronic
1008908852 6:56711405-56711427 TTCTGGTTTGGTTTGAGTTTAGG + Intronic
1009194423 6:60666878-60666900 TTATAATTTGAGATGAAATTTGG + Intergenic
1009661323 6:66614857-66614879 TTCCAGTTTCATAAGAATTCAGG - Intergenic
1009685853 6:66955888-66955910 TTACAATTTGATATGAAATTTGG + Intergenic
1009729691 6:67584447-67584469 TTTTAATTCTATATGAATTTTGG + Intergenic
1010018798 6:71136211-71136233 CTGTAGTTTCATATTAATTTTGG - Intergenic
1010272550 6:73930595-73930617 TTGCAGTTTTCTATGAATTTGGG + Intergenic
1010531568 6:76974185-76974207 TTTTAATATGATATGAATTCTGG + Intergenic
1010674542 6:78726219-78726241 TTCTAGCTTCATAGGTATTTTGG + Intergenic
1010817168 6:80371971-80371993 TTTTGGTTCCATATGAATTTTGG + Intergenic
1010860061 6:80899589-80899611 TTATAATTTGACATGAAGTTTGG + Intergenic
1011327512 6:86166058-86166080 TTTTGGTTCCATATGAATTTTGG - Intergenic
1011789348 6:90881298-90881320 TTTTGGTTCCATATGAATTTTGG + Intergenic
1011891405 6:92165355-92165377 TTTTGGTTTCATATAAATTTTGG + Intergenic
1011977556 6:93323750-93323772 TTTCAGTTTGATATCATTTTTGG + Intronic
1012324556 6:97899903-97899925 TTCAATTTTGATATGAATTTTGG - Intergenic
1012438934 6:99244192-99244214 TTCTAGTTTGGTATGAGTTGGGG - Intergenic
1012470128 6:99562932-99562954 TTCTAGTTTGCAATGGATTTTGG - Exonic
1012578366 6:100830819-100830841 TTTTAGTTTTATATGAGTATAGG - Intronic
1012704007 6:102498419-102498441 TTTTAGTTCCATATGAATTTTGG + Intergenic
1013190074 6:107795081-107795103 TTCTAGGTGGACATGAATGTTGG + Intronic
1013318761 6:108966543-108966565 TGCTAGGTTGATGTGAAATTTGG + Intronic
1013343644 6:109238740-109238762 TTCCAGGTAGACATGAATTTTGG + Intergenic
1013438202 6:110134859-110134881 TTTTGGTTCCATATGAATTTTGG + Intronic
1014040936 6:116824017-116824039 TTATAATTTGATATGAGATTTGG + Intronic
1014328638 6:120031447-120031469 TTCAAAATTGATATTAATTTAGG - Intergenic
1014622504 6:123686098-123686120 TTCTAGTGTGATCTGCATTTGGG - Intergenic
1014653505 6:124070760-124070782 TTTTGGTTCCATATGAATTTTGG - Intronic
1014975914 6:127883948-127883970 TTCTTTTTTTATATAAATTTGGG - Intronic
1015138605 6:129903129-129903151 TTCTGGATGGATATTAATTTTGG + Intergenic
1015211073 6:130699711-130699733 TTCAAGTTTGCTTTGACTTTGGG - Intergenic
1015281408 6:131438469-131438491 TTGTTGTTCCATATGAATTTTGG - Intergenic
1015735739 6:136398194-136398216 TTCTGGCTTCATATGAACTTGGG + Intronic
1015885551 6:137914289-137914311 TTTTGGTTACATATGAATTTAGG + Intergenic
1016038316 6:139405962-139405984 TTCTTGATTGACAAGAATTTTGG + Intergenic
1016075684 6:139793033-139793055 TTTTATTTTGTTATTAATTTTGG + Intergenic
1016508150 6:144808465-144808487 TTCTAATTTGAATTAAATTTTGG - Intronic
1016602326 6:145876566-145876588 TTATCGTTTGATAGGCATTTGGG + Intronic
1017804032 6:157927298-157927320 GTCTAGTCTGATTTGAGTTTCGG - Intronic
1018088204 6:160323257-160323279 TCATAGTTTGACATGAAATTTGG - Intergenic
1018100926 6:160439010-160439032 TTCCAGGTAGACATGAATTTTGG + Intronic
1018162739 6:161063124-161063146 TTCTAGTTTGTTTTTGATTTGGG + Intronic
1018353330 6:162986213-162986235 TTTTGGTTCTATATGAATTTTGG - Intronic
1018564250 6:165135264-165135286 TTATAATCTGATATGAAATTTGG - Intergenic
1018568658 6:165184298-165184320 TTCCAGGTGGACATGAATTTTGG + Intergenic
1018591263 6:165425294-165425316 TTCAAGTTTTCTATAAATTTAGG + Intronic
1018970707 6:168526791-168526813 TTTTAGTTTGATTTTAATTATGG + Intronic
1019065978 6:169298137-169298159 TTTTAGGTGGACATGAATTTTGG - Intergenic
1019444406 7:1063800-1063822 TCCTGGTTTGATCTGAATGTGGG + Intronic
1019818986 7:3225925-3225947 TTTTTGTTCCATATGAATTTTGG - Intergenic
1020646085 7:10815981-10816003 TTCCGGGTTGATATGAATTTTGG - Intergenic
1020651106 7:10877502-10877524 TTTTGGTTCCATATGAATTTTGG + Intergenic
1021140213 7:17014794-17014816 TTATAGTTCAAGATGAATTTGGG + Intergenic
1021663981 7:22954980-22955002 TTCTATTTTTATATTAACTTGGG + Intronic
1021685085 7:23177084-23177106 TTCTGGATAGACATGAATTTGGG + Exonic
1022621160 7:31986011-31986033 TTCCAGGTAGATGTGAATTTTGG - Intronic
1022621205 7:31986438-31986460 TTCTGGGTTGATATGAATTTTGG + Intronic
1022805800 7:33821210-33821232 CTCTACTTTGATAGGTATTTAGG + Intergenic
1022900768 7:34808436-34808458 TTCAATTTTGTTATGTATTTTGG - Intronic
1023633675 7:42187578-42187600 TCCTTGGTGGATATGAATTTTGG - Intronic
1023839777 7:44090173-44090195 TTCTGGGTGGAAATGAATTTGGG + Intergenic
1024014590 7:45300650-45300672 TTGTGGTCTCATATGAATTTGGG - Intergenic
1024129095 7:46331874-46331896 TTTTTGTTCCATATGAATTTAGG + Intergenic
1024151301 7:46574232-46574254 TTTGAGTTCTATATGAATTTTGG - Intergenic
1024789382 7:52946830-52946852 TTTAAGTTTGTTATGTATTTTGG - Intergenic
1025617103 7:63130033-63130055 TTCTAGTTTTGTATAATTTTAGG + Intergenic
1026320386 7:69262896-69262918 GTCATATTTGATATGAATTTTGG - Intergenic
1026713060 7:72760231-72760253 TTGTAGTTTCAGATGAATTTAGG - Intronic
1027401994 7:77818738-77818760 TTGTAGTTCCATATGTATTTTGG + Intronic
1027565276 7:79784149-79784171 TTTTGGTTTCATATGAATTCTGG + Intergenic
1027699182 7:81448461-81448483 TTATCTTTTGATTTGAATTTGGG - Intergenic
1028255773 7:88595891-88595913 TTTTGATTTCATATGAATTTTGG - Intergenic
1028703212 7:93807897-93807919 TTTTGGTTTCATATGAATTTTGG - Intronic
1028704968 7:93831579-93831601 TTCTAGTATTACATGAATCTTGG + Intronic
1028927789 7:96378365-96378387 TTATAGTTTAATATGAGATTTGG + Intergenic
1028972333 7:96872710-96872732 TTCCAGGTGGACATGAATTTTGG + Intergenic
1029195197 7:98800863-98800885 TTCCAGGTGGACATGAATTTTGG - Intergenic
1029913927 7:104186512-104186534 TACTACTTTGATATTCATTTAGG - Intronic
1030223836 7:107126863-107126885 ATCTAGTTTGAGATGAATATTGG + Intronic
1030579250 7:111332823-111332845 TTCTAGTTTTATTTTAATTTTGG - Intronic
1030593877 7:111512611-111512633 TTGTGGTTCCATATGAATTTAGG - Intronic
1030990778 7:116297297-116297319 TTGTGGTTTTATATAAATTTTGG - Intronic
1030996875 7:116370387-116370409 TTCTAGGTGGATGTGAATTTTGG - Intronic
1031029125 7:116715561-116715583 TTCCAGGTGGACATGAATTTTGG + Intronic
1031376076 7:121027181-121027203 TTCTAGCTTGAGAAGAATTGAGG - Intronic
1031479832 7:122265411-122265433 CTCTAGTTCGACATGAAATTTGG - Intergenic
1031547046 7:123063674-123063696 TTTTGGTTTCATATGTATTTTGG + Intergenic
1031677766 7:124632807-124632829 TTATAATTTGATATGAGATTTGG + Intergenic
1031730151 7:125290097-125290119 TTCCAGATGGATATGAATTTTGG - Intergenic
1032561102 7:132893609-132893631 TTACAGTTTGAGATGAAATTTGG - Intronic
1032948142 7:136875346-136875368 TTCTAGTTTGCCATGTATTTAGG - Intronic
1032984452 7:137321593-137321615 TTTTTGTTTGATATGAAGATTGG + Intronic
1033289653 7:140072472-140072494 TTCTGGATGGACATGAATTTTGG - Intergenic
1033812714 7:145035183-145035205 TTTTGGTTCCATATGAATTTCGG + Intergenic
1034052863 7:148001153-148001175 TTCTGGGTGGACATGAATTTGGG + Intronic
1034058570 7:148064219-148064241 TTTTAGTTCTGTATGAATTTAGG + Intronic
1034070211 7:148177165-148177187 TCCTAGGTGGACATGAATTTTGG - Intronic
1034226436 7:149487912-149487934 TTGTTCTTTTATATGAATTTTGG - Intronic
1034229115 7:149506623-149506645 TTCTGGATGGACATGAATTTTGG + Intergenic
1034247102 7:149654289-149654311 TTTTAGTTTCTTATAAATTTTGG - Intergenic
1034511039 7:151534882-151534904 TTACATTTTCATATGAATTTTGG + Intergenic
1034679567 7:152918477-152918499 TTCTGGTTTTAAATTAATTTGGG - Intergenic
1035069673 7:156133291-156133313 TTTTGGTTCCATATGAATTTAGG - Intergenic
1035172542 7:157026195-157026217 TTGTGGTTCCATATGAATTTTGG + Intergenic
1035218111 7:157386115-157386137 TTCTGGTTTAATATAAATTAAGG + Intronic
1036091125 8:5666876-5666898 TGCTAATTAGATATGTATTTTGG + Intergenic
1036253426 8:7184546-7184568 TTTTAGTTCCAAATGAATTTTGG + Intergenic
1036273261 8:7327015-7327037 TTCTAGTGTGGTTTGAAGTTAGG - Intergenic
1036348087 8:7983337-7983359 TTCTAGTGTGGTTTGAAGTTAGG + Intergenic
1036364068 8:8102932-8102954 TTTTAGTTCCAAATGAATTTTGG - Intergenic
1036626630 8:10478140-10478162 TTCTGGGTCGACATGAATTTTGG - Intergenic
1036801025 8:11792194-11792216 TCCTAGGTTTATATGAATTTAGG + Intergenic
1036886886 8:12564142-12564164 TTTTAGTTCCAAATGAATTTTGG + Intergenic
1037464693 8:19148740-19148762 TTCCAGGTAGACATGAATTTTGG - Intergenic
1037484823 8:19337379-19337401 TTCTAGGTGGACATAAATTTCGG - Intronic
1037525883 8:19723823-19723845 TTATATTTTCATTTGAATTTGGG - Intronic
1037555040 8:20013963-20013985 TTCTAGTTAGACATATATTTGGG - Intergenic
1038598902 8:28917719-28917741 TTCTAGTTTGCTCCGAGTTTTGG + Intronic
1039082709 8:33748684-33748706 CTTTAGTTTTATATGAAATTAGG + Intergenic
1039138056 8:34349850-34349872 TTCCACTTTTATTTGAATTTTGG + Intergenic
1039181049 8:34866656-34866678 TTTTAGATTAATATGAATTCTGG - Intergenic
1039348722 8:36737318-36737340 TTCTAGTTTCTTATGATTATGGG - Intergenic
1039354597 8:36801154-36801176 TTCTAGTTACTTATAAATTTGGG + Intronic
1039827795 8:41189666-41189688 TTCTAGGCAGATATGAATTCTGG + Intergenic
1040011192 8:42662431-42662453 CTCTGGGTAGATATGAATTTGGG + Intergenic
1040040073 8:42906911-42906933 TCCTAGTTTAATATGCATTGTGG + Intronic
1041136330 8:54763040-54763062 TTCTAGGTGGCCATGAATTTTGG + Intergenic
1041248355 8:55910635-55910657 TTTTGGTTCCATATGAATTTTGG + Intronic
1041449614 8:57993374-57993396 TTCTATTGTTATATGACTTTTGG + Intergenic
1041509422 8:58638890-58638912 TTCGAGTTTTTTATGTATTTTGG - Intronic
1041524823 8:58793505-58793527 TTTTGGTTCCATATGAATTTTGG - Intergenic
1042188513 8:66161516-66161538 TTTTGGTTCTATATGAATTTTGG + Intronic
1042641026 8:70934349-70934371 TTTTAATTTGATAAGAAATTTGG + Intergenic
1043149206 8:76692435-76692457 CTCTAGGTTGGTATAAATTTTGG - Intronic
1043551842 8:81382529-81382551 TTTTGGTTCCATATGAATTTAGG + Intergenic
1043704830 8:83335268-83335290 TTACAATTTGATATGAATTTGGG - Intergenic
1044086524 8:87949135-87949157 TTTTGGTTCCATATGAATTTCGG - Intergenic
1044463668 8:92478997-92479019 TTCTATTTTGATCTCAACTTAGG + Intergenic
1044521742 8:93206539-93206561 TTCCAGGTGGATATGAATTTTGG - Intergenic
1045161693 8:99554751-99554773 TTCTAGTTTCATTTAAATATTGG - Intronic
1045175179 8:99715067-99715089 TTCTATTTTGAAATAACTTTGGG - Intronic
1045176888 8:99735275-99735297 TTCCAGGTAGAAATGAATTTGGG - Intronic
1045206251 8:100044177-100044199 TTCTAATTTTGTAAGAATTTGGG - Intronic
1045596791 8:103665852-103665874 TTTTAGTTTTATAAGCATTTGGG - Intronic
1046010396 8:108539441-108539463 TTCCAGGTGGACATGAATTTGGG - Intergenic
1046469071 8:114644511-114644533 TTGTATTCTGATATGCATTTGGG + Intergenic
1046706399 8:117457335-117457357 TTGTTGTTTCATATAAATTTTGG - Intergenic
1047278318 8:123423052-123423074 TTCTAGTATAATTTGAAGTTGGG + Intronic
1047669344 8:127127559-127127581 TTCAAGGTAGATGTGAATTTTGG - Intergenic
1047750964 8:127880192-127880214 TTCATGTTTGATATGATTTCTGG + Intergenic
1047932286 8:129741333-129741355 TTCTGGTTGTATATGAATTTGGG + Intergenic
1048124238 8:131615176-131615198 TTCTATTTTGAAATGCATTTAGG + Intergenic
1048124605 8:131619707-131619729 TTTTTGTTCTATATGAATTTTGG - Intergenic
1048491777 8:134900962-134900984 TTCCAGGTGGACATGAATTTTGG + Intergenic
1048767536 8:137861138-137861160 TTCTAGATAGACATGACTTTTGG - Intergenic
1048825537 8:138421787-138421809 TTTCAGTTTCATATTAATTTTGG - Intronic
1049320949 8:141996046-141996068 TTCTAGGTGGACATGAATTTTGG + Intergenic
1050133267 9:2435145-2435167 TCTTTGTTTCATATGAATTTTGG + Intergenic
1050188960 9:3005090-3005112 TTCTGGATAGACATGAATTTTGG - Intergenic
1050750793 9:8934278-8934300 TTCAAGTTGGAACTGAATTTAGG - Intronic
1051054662 9:12970766-12970788 TTGTGGGTGGATATGAATTTTGG + Intergenic
1051060143 9:13036260-13036282 TTCCAGTTAGACATGAAGTTGGG + Intergenic
1051131266 9:13863633-13863655 TTCCAATTTGACAGGAATTTAGG + Intergenic
1051201152 9:14626125-14626147 TTATACTTTGATAAGATTTTTGG + Intronic
1051389321 9:16546884-16546906 TTGAAGTTTGATTTGAATTCAGG - Intronic
1051456175 9:17261163-17261185 TTTTGGTTTCATATAAATTTTGG + Intronic
1051461848 9:17327651-17327673 TTCTATTTTGAAAAGCATTTAGG + Intronic
1051468737 9:17411062-17411084 TTCTTGTTTTATATTAATTTAGG - Intronic
1051518482 9:17957623-17957645 TTCTAAGTGGACATGAATTTGGG - Intergenic
1051541591 9:18226038-18226060 TCCTAGGTTAATATTAATTTAGG + Intergenic
1051946040 9:22571305-22571327 TTTTGGTTCCATATGAATTTTGG + Intergenic
1052053580 9:23877901-23877923 TTGTAGTTCTATATGAATTCTGG + Intergenic
1054285858 9:63169489-63169511 TTAAATTTTGACATGAATTTTGG + Intergenic
1054388965 9:64595539-64595561 TTAAATTTTGACATGAATTTTGG - Intergenic
1054869023 9:70032114-70032136 TTGTAGTTTTATATGATTTCTGG + Intergenic
1055570102 9:77608016-77608038 TTCAAGATGGACATGAATTTTGG - Intronic
1055830116 9:80368261-80368283 TTCCAGGTGAATATGAATTTGGG - Intergenic
1055951811 9:81736240-81736262 TTACAGTTTGACATGAAATTTGG + Intergenic
1056133368 9:83607197-83607219 TTTTGGTTCCATATGAATTTTGG - Intergenic
1056360510 9:85853035-85853057 TTGTAGTATGGTTTGAATTTGGG - Intergenic
1056366035 9:85906056-85906078 TTCTCGTTTGATTTTAAGTTGGG + Intergenic
1056529185 9:87471783-87471805 TTCTAATTTGAAATGAATCAGGG + Intergenic
1056884906 9:90432453-90432475 TACTAGTATTATATTAATTTGGG - Intergenic
1057326904 9:94073919-94073941 TTCTAGTTTGATTTCATTGTGGG + Intronic
1058165232 9:101611480-101611502 TTCTAGGTAGACATTAATTTTGG + Intronic
1058274964 9:103028318-103028340 TTCTAGTTTCATATCAATATGGG - Intergenic
1058397040 9:104566146-104566168 TTATTCTTTCATATGAATTTAGG + Intergenic
1058408147 9:104700458-104700480 TTCTAGTTATTTATTAATTTGGG - Intergenic
1058588992 9:106541098-106541120 TTCTAGTTTGATTTGCACTGTGG + Intergenic
1058833272 9:108838147-108838169 TTCTAGTTACTTATAAATTTTGG - Intergenic
1058896285 9:109403530-109403552 TTCTACTTTTAAATAAATTTGGG + Intronic
1058911229 9:109521670-109521692 ATATAGTTTGATAAGTATTTTGG - Intergenic
1059129922 9:111736217-111736239 TTTTGGTTTTATATGAACTTTGG - Intronic
1059591369 9:115666291-115666313 TTCCAGGTGGATTTGAATTTTGG + Intergenic
1059592836 9:115680566-115680588 TTCTAATTTGGCATGAATATTGG - Intergenic
1059607705 9:115853108-115853130 TTATGGTTTTATATGAATTTTGG - Intergenic
1059630785 9:116119486-116119508 TTCTAGTATAATTTGAAGTTAGG + Intergenic
1059720657 9:116957087-116957109 TTGTATTTTCATATGAATTTTGG - Intronic
1059867349 9:118530537-118530559 TTCTCATTTGATATTAATTTTGG + Intergenic
1061596320 9:131631795-131631817 TTCTTGTTTGATATTTTTTTCGG - Intronic
1062635901 9:137491589-137491611 TTCTGGGTAGACATGAATTTGGG - Intronic
1062672295 9:137718328-137718350 TCTCAGTTTGATGTGAATTTGGG + Intronic
1185923903 X:4125224-4125246 TTCTAGGTGGATGTGAATTTTGG - Intergenic
1186347215 X:8706278-8706300 CACTAGTTTGGTATGTATTTTGG - Intronic
1186748523 X:12596409-12596431 TTGTATTTTGAAATGAATATAGG + Intronic
1186961741 X:14744032-14744054 TTCTAGGTGAACATGAATTTTGG + Intergenic
1186976066 X:14906089-14906111 TTGCATTTTCATATGAATTTTGG - Intronic
1187034084 X:15519368-15519390 TTCTACATGGATATGAAATTTGG - Intronic
1187088923 X:16073331-16073353 TTCCAGGTGGATATAAATTTTGG - Intergenic
1187608306 X:20911222-20911244 TTATAGTTTAATAGGAGTTTAGG - Intergenic
1188111766 X:26202483-26202505 TTCTGGTTTCATATGAATGTTGG - Intergenic
1188177373 X:27008181-27008203 TTCTAGTTAGAAATTACTTTGGG - Intergenic
1188385999 X:29559017-29559039 TTGTAGTTACATATGAATTTGGG + Intronic
1188709070 X:33371841-33371863 ATGAAGGTTGATATGAATTTAGG + Intergenic
1188722156 X:33535715-33535737 TTCCAGTTTGATTTGAAGTGTGG + Intergenic
1189120498 X:38389210-38389232 TTCTAGGTAGACATGAATTTTGG + Intronic
1189156933 X:38767472-38767494 TCCTACTTTGATTTGAATATTGG - Intergenic
1189218810 X:39352422-39352444 TTTTTGTTCCATATGAATTTTGG + Intergenic
1189951090 X:46231716-46231738 TTTTGGTTCTATATGAATTTAGG - Intergenic
1191989907 X:67023626-67023648 TTGTCATTTCATATGAATTTTGG + Intergenic
1192066475 X:67890506-67890528 TTATAATTTGATATGAGATTTGG - Intergenic
1192531074 X:71886402-71886424 TTTTGGTTCCATATGAATTTTGG + Intergenic
1193179426 X:78436292-78436314 TTGTAGTTTGAAAAGAATTCAGG + Intergenic
1193219411 X:78905123-78905145 TCCTATTTTGATATGTAATTTGG + Intergenic
1193316129 X:80066794-80066816 TTCTGGTTCCATATAAATTTTGG + Intergenic
1193456796 X:81741511-81741533 TTGTAGTTTAGTTTGAATTTAGG + Intergenic
1193683266 X:84547881-84547903 TTGTGGTTTCATATAAATTTTGG + Intergenic
1193742120 X:85230075-85230097 TTGTGGTTCCATATGAATTTAGG - Intergenic
1193788331 X:85788197-85788219 TTCTGGTTTTATATGAATTTTGG - Intergenic
1193827869 X:86248696-86248718 TTTTGGTTTCATATGAATTCTGG - Intronic
1193926876 X:87498091-87498113 TTATAATTTGACATGAAATTTGG - Intergenic
1194040104 X:88930157-88930179 TGCTAGGTACATATGAATTTAGG + Intergenic
1194149708 X:90309151-90309173 CTCTAATTTGATATGAGATTTGG + Intergenic
1194449450 X:94026558-94026580 TTTTATTTTGTTATGAATGTAGG + Intergenic
1194647175 X:96471983-96472005 TTCCAGGTGGATATGAATTTTGG - Intergenic
1194801866 X:98283710-98283732 TTCTACTTTGATACAAAGTTGGG + Intergenic
1194844441 X:98787041-98787063 TTCTTCTTTCTTATGAATTTTGG + Intergenic
1195263772 X:103160497-103160519 TTACAGTTTGATGTGTATTTGGG + Intergenic
1195278218 X:103303517-103303539 TTCTGGGTGGATATGGATTTTGG - Intergenic
1195285777 X:103381911-103381933 TTCAATTTTGAAATGTATTTTGG + Intergenic
1195496344 X:105539182-105539204 TTTTGGTTCCATATGAATTTTGG - Intronic
1195634741 X:107101364-107101386 TTCTGGGTAGACATGAATTTTGG - Intronic
1195784473 X:108503895-108503917 TTTTGGTTCCATATGAATTTTGG - Intronic
1195913031 X:109907927-109907949 TTTTGGTTCCATATGAATTTTGG + Intergenic
1196091266 X:111746259-111746281 TTATACTTTGATAGGGATTTGGG - Intronic
1196333192 X:114496713-114496735 TTCCAGTCTAATATGAAGTTTGG - Intergenic
1196503605 X:116413659-116413681 TTCTATTTTTTTATGAATTAAGG + Intergenic
1196726171 X:118897634-118897656 TTCTATTTTGAGATGACTGTAGG + Intergenic
1197210671 X:123825783-123825805 TTCTGGGTTGACATGAGTTTTGG - Intergenic
1197250113 X:124206903-124206925 TTGTAATTTTATATGTATTTGGG - Intronic
1197442143 X:126505060-126505082 TTGTAGTTCCATATGAATTTTGG + Intergenic
1197521824 X:127508400-127508422 TGCTAGTTTGATTGGAATTCAGG + Intergenic
1197676214 X:129333747-129333769 TTTCAGTTCCATATGAATTTTGG - Intergenic
1197942104 X:131801345-131801367 TTCCAGTTTGATCTGTCTTTTGG - Intergenic
1197950412 X:131889941-131889963 TTCTATTTTGATATAAATGTAGG - Intergenic
1197988366 X:132291142-132291164 TTCTGGTTCTATATGAATTTAGG + Intergenic
1197993115 X:132339706-132339728 TTTTCGTTCCATATGAATTTTGG + Intergenic
1198463742 X:136886668-136886690 TTTTAATTGGATATGAAGTTTGG - Intergenic
1198623100 X:138535428-138535450 TTTTGGTTCCATATGAATTTTGG - Intergenic
1198677661 X:139147963-139147985 TTCTGGGTAGACATGAATTTTGG + Intronic
1198885391 X:141330123-141330145 TTATAGGTCCATATGAATTTTGG - Intergenic
1198894662 X:141439665-141439687 TTTTGGTTCCATATGAATTTTGG + Intergenic
1198982338 X:142413569-142413591 TTGTAGTTCCATATAAATTTTGG - Intergenic
1198993921 X:142550674-142550696 TTGTAGTTTGATATAATATTAGG - Intergenic
1199018269 X:142845906-142845928 TTCTAGGTTGATATGAAATTAGG - Intergenic
1199119191 X:144030445-144030467 TTTTAATTTGATATGACATTTGG - Intergenic
1199153677 X:144520428-144520450 TTGTGGTTTCATATAAATTTTGG + Intergenic
1199170630 X:144731322-144731344 TTATAATTTGACATGAAATTTGG + Intergenic
1199229521 X:145419957-145419979 TTGTGGTTGCATATGAATTTTGG + Intergenic
1199588526 X:149442030-149442052 TTCCAGGTAGAAATGAATTTTGG - Intergenic
1199755766 X:150863678-150863700 TTTTGGTTGGGTATGAATTTGGG - Intronic
1199935154 X:152566172-152566194 TTCTATTTTAACATGAATTGAGG + Intergenic
1200496084 Y:3885886-3885908 CTCTAATTTGATATGAGATTTGG + Intergenic
1201055643 Y:9987638-9987660 TTCTAGTTTTTTATGGGTTTAGG - Intergenic
1202345866 Y:23926024-23926046 TTGTGGTTTCATATTAATTTAGG - Intergenic
1202524905 Y:25744066-25744088 TTGTGGTTTCATATTAATTTAGG + Intergenic