ID: 920627401

View in Genome Browser
Species Human (GRCh38)
Location 1:207615963-207615985
Sequence GTTCTAAGCAGACTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920627396_920627401 27 Left 920627396 1:207615913-207615935 CCTAAATTCATATCAAACTAGAA 0: 1
1: 1
2: 6
3: 102
4: 793
Right 920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920627401 Original CRISPR GTTCTAAGCAGACTAAAAGG AGG Intronic
909358788 1:74738441-74738463 CTTCAAAGCACACTAATAGGTGG + Intronic
911661174 1:100503043-100503065 TTTCTAAGCAAAGTTAAAGGGGG - Intronic
912585256 1:110757975-110757997 GTTTTAAGGAGACTCAGAGGTGG - Intergenic
915797183 1:158748207-158748229 TATATAAGCAGACTAAAAAGAGG - Intergenic
917230172 1:172828004-172828026 GTTCTAAGAAAACTAAACTGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG + Intronic
921130816 1:212218080-212218102 TTTCTAAGCACACTAGAAGCTGG - Intergenic
922690884 1:227689488-227689510 TTTCTCAGCAAAATAAAAGGTGG + Intergenic
923012960 1:230103645-230103667 GTTCTAAGGAGACAAGTAGGTGG + Intronic
924560023 1:245150595-245150617 GTGCTCAGCAGACTGGAAGGAGG - Intergenic
1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG + Intergenic
1070498906 10:77051930-77051952 GTTCTAACCATACTAAGAGATGG + Intronic
1071730459 10:88243526-88243548 GTGCTGAGCAGACAGAAAGGAGG - Intergenic
1075661322 10:124198698-124198720 GTTGTAAACAGACTAAAATCAGG - Intergenic
1077286623 11:1768896-1768918 GCTCTAATCAGACTTGAAGGAGG + Intergenic
1079321154 11:19452634-19452656 GTTCTAAGCACATTTAAAGTAGG - Intronic
1079847024 11:25485699-25485721 GTTGTAATCAAACTAAAAAGGGG + Intergenic
1083661951 11:64255553-64255575 GTTCTCAGCAGACAAGAAGCGGG + Exonic
1084144368 11:67256278-67256300 GTTCAATGCAAAGTAAAAGGGGG - Exonic
1087194075 11:95287141-95287163 GTTCTAAGAAGTTTAAAAAGTGG - Intergenic
1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG + Intronic
1107490752 13:40878175-40878197 GTTCCAGGCAGACTGACAGGGGG + Intergenic
1107740355 13:43444165-43444187 GTTTTAAGCAGACTGAAAAGGGG - Intronic
1107965326 13:45592694-45592716 GTACTAAAAAAACTAAAAGGGGG + Intronic
1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG + Intergenic
1112870690 13:103967554-103967576 ACTCTAAGCAGAAGAAAAGGTGG + Intergenic
1120908482 14:89642972-89642994 TTTCTCACCAGACTATAAGGAGG - Intergenic
1123986647 15:25652436-25652458 GTTGTCAGCAGAATCAAAGGAGG - Intergenic
1124952378 15:34336144-34336166 TTTCTAAGAAGACAAAAATGAGG + Intronic
1125770672 15:42163580-42163602 CTCCTAAGCAGTCTAAAAGCAGG - Intronic
1126217877 15:46177381-46177403 GTTCTAAGCAGAGGAAAGGAAGG - Intergenic
1126665499 15:51072867-51072889 TTTCTAAGCAGAATAAAGTGAGG - Intronic
1127852307 15:62924541-62924563 GTCCTAAGTAGACTATTAGGGGG - Intergenic
1129196387 15:73969725-73969747 GTTCTAAGCAGAGGAACATGAGG - Intergenic
1130441480 15:83958903-83958925 GTAATAAGCAAAATAAAAGGAGG + Intronic
1130776462 15:86989498-86989520 CATCTTAGCAGATTAAAAGGGGG - Intronic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1135255031 16:20934434-20934456 GTTCTAAGCACATTTAAGGGAGG - Intronic
1146135469 17:30317061-30317083 GTTCAAAGGAGAATAGAAGGTGG - Intronic
1148697357 17:49568561-49568583 GTTCTCAGCAGTCTAAAATGTGG + Intergenic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1159096606 18:63909020-63909042 TTTCTTAGCAGACAAAATGGGGG + Intronic
1161729264 19:5949014-5949036 GTTCTGACGAGACTAAAAGATGG + Intronic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
1168493434 19:56830419-56830441 ATTCTTAGCAGAGTAAAAGCAGG + Intronic
927639476 2:24837742-24837764 TTTCTAATCAGACTGACAGGAGG + Intronic
928393312 2:30925780-30925802 GTTCTAAGCAGGGCAAGAGGTGG + Intronic
931773403 2:65518680-65518702 GTTTTAAGCAGAAAGAAAGGAGG - Intergenic
931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG + Intergenic
934776913 2:96945031-96945053 GTTCTCAGGAGGCTAATAGGTGG - Intronic
939589321 2:144044001-144044023 GATCTAAGTAGCCAAAAAGGAGG - Intronic
939643499 2:144668795-144668817 GTTCTAAGAAGAATAAATTGTGG + Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
946158623 2:217822670-217822692 GTTCAAAACAGCCTAAGAGGGGG + Intronic
947919640 2:233857955-233857977 TTTCTTAGCAGCCTAATAGGTGG - Intergenic
1175417613 20:58812030-58812052 GGTCTAAGCAGCCTGGAAGGTGG - Intergenic
1175709164 20:61205561-61205583 TGTCTAACCAGAATAAAAGGAGG - Intergenic
1178096441 21:29220789-29220811 TTTCTAGGAAGACCAAAAGGAGG - Intronic
1178986807 21:37311902-37311924 ATTCTAATCTGATTAAAAGGTGG - Intergenic
1183402677 22:37613875-37613897 GTTCTCAGCAGAATCAGAGGAGG + Intronic
949968365 3:9379513-9379535 GTTCTATGCAGATTAACAGAAGG - Intronic
951424530 3:22528330-22528352 ATTCTCAGCAGACTAACAGAAGG - Intergenic
954851016 3:53600612-53600634 ATAATAAGCAGATTAAAAGGTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960836128 3:121908597-121908619 GTTCTGATCAGACAAAAAAGAGG - Intronic
961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG + Intronic
962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG + Intronic
963575035 3:147049635-147049657 GTTGTAAGGAGAATAAAATGAGG + Intergenic
963765641 3:149333377-149333399 GTTCTAAGCAGGGCAAAATGGGG - Exonic
965697121 3:171420815-171420837 CTACTAAGTAGACTAAAGGGAGG + Intronic
967119042 3:186366282-186366304 TTTCTAAGAAAACTAAAATGAGG - Intergenic
967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG + Intergenic
968003016 3:195220596-195220618 GGTCTGAGCAGGCTGAAAGGGGG - Intronic
971061124 4:22971097-22971119 GATTTAAGCAGACTTGAAGGAGG - Intergenic
976380818 4:84396318-84396340 TTTTTAAACAGACTAAAAGTTGG + Intergenic
976676448 4:87708831-87708853 AGTCTAAGCAGACTAAATGGAGG - Intergenic
978103601 4:104873953-104873975 TTTCTAAGCAGAGTAAATGACGG - Intergenic
978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG + Intronic
979429568 4:120612382-120612404 GTTCAAAGCAGAAAAAAAGATGG - Intergenic
981156665 4:141445299-141445321 ATTATAAGCACTCTAAAAGGCGG + Intergenic
982181505 4:152752090-152752112 GTTCTCAGGAGACTCAAAGTGGG - Intronic
982645297 4:158016548-158016570 GTTATAAGTAAACTAAAAAGTGG - Intergenic
989606865 5:43252739-43252761 TTTCTAATCAGCCTAAAAGGGGG - Intronic
991144212 5:63282262-63282284 ATTCTGAGCAGACTATAACGAGG - Intergenic
993392708 5:87340615-87340637 GTTCAAAACATAGTAAAAGGGGG + Intronic
996376111 5:122809416-122809438 CCTTGAAGCAGACTAAAAGGGGG + Intronic
997982630 5:138478437-138478459 GTTCTAATGAGATTCAAAGGTGG - Intergenic
1001178926 5:169500198-169500220 GTCCTAAGCAGGCTAAAGGAAGG - Intergenic
1001475630 5:172048757-172048779 GTTCTGAGCAGAGGACAAGGTGG - Intronic
1001886954 5:175301290-175301312 GTCCTAAGCAGAGAAAAAGCAGG + Intergenic
1011897026 6:92240964-92240986 GTTCTAAAAAGACTAATAGGAGG + Intergenic
1012226526 6:96710040-96710062 GTGCTAAGCAGACCAAAATTGGG + Intergenic
1013659515 6:112280691-112280713 CTTCTAAGCAGCCTTCAAGGAGG + Intergenic
1016644295 6:146387478-146387500 GTTTTAAGCAAAATAAAAGCCGG - Intronic
1021385905 7:20029678-20029700 ATTCAAAGCAGAGTAAAAAGAGG - Intergenic
1027981648 7:85231878-85231900 GTTTTAGGCAGAGTAAAAAGAGG + Intergenic
1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG + Intronic
1042126700 8:65545185-65545207 GATCTAAGCAGACTTGGAGGAGG + Intergenic
1045538983 8:103063258-103063280 GTACTAAGCAGAAGAAAAAGTGG + Intronic
1045573697 8:103396185-103396207 CTTCTAAACACACTAAAAGAGGG - Intergenic
1051877567 9:21807714-21807736 CTGCTCAGCAGAGTAAAAGGAGG + Intronic
1052045740 9:23792201-23792223 GTTCTAAGCAGATTTAAGGCAGG + Intronic
1055506478 9:76954729-76954751 GTTGGAAGCAGACAAAATGGGGG - Intergenic
1059602845 9:115800160-115800182 GTTCTAGGCACTCTAAAAGTAGG - Intergenic
1060702781 9:125773370-125773392 GTTATCAGCAGACTCAGAGGTGG - Intronic
1185674691 X:1839745-1839767 TTCCTAAGAAGACTAAAAGATGG + Intergenic
1186566309 X:10666630-10666652 GTTCTGAGCACAATTAAAGGGGG + Intronic
1191078023 X:56476589-56476611 ATACTAAGCAAACTAAAATGTGG - Intergenic
1197899806 X:131358494-131358516 GAAGTAAGCAGACAAAAAGGTGG - Intronic
1198582758 X:138084637-138084659 GTTCTAAGCACAGAAAAAAGTGG - Intergenic
1198630411 X:138630872-138630894 GTTCTAAGCACATTTAAAGTAGG - Intergenic
1200762539 Y:7053477-7053499 GTGCTAAGTATGCTAAAAGGTGG - Intronic