ID: 920629951

View in Genome Browser
Species Human (GRCh38)
Location 1:207642411-207642433
Sequence TGGACCCGGTTTAGAACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920629951_920629956 18 Left 920629951 1:207642411-207642433 CCCATAGTTCTAAACCGGGTCCA 0: 1
1: 0
2: 0
3: 1
4: 26
Right 920629956 1:207642452-207642474 TTCTCTCCTTTTCTTCTCTTTGG 0: 2
1: 0
2: 15
3: 174
4: 1496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920629951 Original CRISPR TGGACCCGGTTTAGAACTAT GGG (reversed) Intergenic
916149932 1:161777167-161777189 TGGAGCAGGTTTAGAACGAATGG + Intronic
920629951 1:207642411-207642433 TGGACCCGGTTTAGAACTATGGG - Intergenic
1068798765 10:61115172-61115194 TGGAGCCTGTTTAGTTCTATTGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1090219382 11:125004291-125004313 TGGCCAGGGTTAAGAACTATCGG - Intronic
1093036741 12:14338980-14339002 TGGACACTGTTTGGAACTTTTGG + Intergenic
1095370757 12:41464747-41464769 TAGAGCCTGTTTAGAACCATTGG + Intronic
1166275803 19:41753062-41753084 TGGGCCAGGTGGAGAACTATTGG - Intronic
940236948 2:151521914-151521936 TGTACCAGGTTTAGGACTCTAGG + Intronic
1183045335 22:35214994-35215016 TGGACCCCATTCAGACCTATGGG - Intergenic
954152209 3:48663181-48663203 GGGACACGGTTCAGAACTAGTGG - Intergenic
956084133 3:65591700-65591722 TGAACAAGGGTTAGAACTATGGG - Intronic
964710323 3:159665162-159665184 AGGACCAGGTTTAGAACTACTGG + Intronic
976892186 4:90063264-90063286 TGCACGTGGTTTAGAACTTTTGG - Intergenic
996035244 5:118751342-118751364 TTGACCTGGTTTGGAACCATGGG - Intergenic
1021248606 7:18295725-18295747 TGCCCCCGGTTGAGAACTACTGG - Intronic
1024051694 7:45627816-45627838 TGGAGCCTGTTTACAGCTATGGG - Intronic
1026283401 7:68942097-68942119 TGGTCCTGATTTAGAACTTTTGG + Intergenic
1028567695 7:92250536-92250558 TGGTCCCGTTGTAGAACTAGAGG - Intronic
1029410409 7:100406172-100406194 TCTACCCGGTTGAGAACCATTGG - Intronic
1031361750 7:120857008-120857030 TGAAGCCGGTTTGGAACTTTTGG - Intronic
1042435614 8:68761225-68761247 TGGCCCAGCTTTAGAACTTTAGG + Intronic
1043600173 8:81928197-81928219 TGTACCTGGTTGAGAACCATTGG + Intergenic
1044009353 8:86973096-86973118 TGGATCTGGTTTAGCACTCTAGG - Intronic
1050244243 9:3671363-3671385 TGGGCCCTGCTTAGAACTAAAGG - Intergenic
1055958316 9:81794954-81794976 TGGCCACGTTTTAGAAATATGGG + Intergenic
1189065834 X:37807801-37807823 TTGTCCCAGTTGAGAACTATTGG - Intronic
1196021757 X:110998137-110998159 TGGACTCGGGTCAGAACTTTGGG + Intronic