ID: 920631621

View in Genome Browser
Species Human (GRCh38)
Location 1:207658713-207658735
Sequence CCCGCCACACAGGAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920631614_920631621 -4 Left 920631614 1:207658694-207658716 CCTGTGCCAGTGCCCTGTGCCCG No data
Right 920631621 1:207658713-207658735 CCCGCCACACAGGAGCCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 307
920631615_920631621 -10 Left 920631615 1:207658700-207658722 CCAGTGCCCTGTGCCCGCCACAC 0: 1
1: 0
2: 2
3: 36
4: 418
Right 920631621 1:207658713-207658735 CCCGCCACACAGGAGCCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 307
920631613_920631621 14 Left 920631613 1:207658676-207658698 CCTGGTTTCTGCAGAGATCCTGT 0: 2
1: 0
2: 1
3: 19
4: 209
Right 920631621 1:207658713-207658735 CCCGCCACACAGGAGCCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 307
920631612_920631621 20 Left 920631612 1:207658670-207658692 CCACTGCCTGGTTTCTGCAGAGA 0: 2
1: 0
2: 4
3: 38
4: 330
Right 920631621 1:207658713-207658735 CCCGCCACACAGGAGCCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920631621 Original CRISPR CCCGCCACACAGGAGCCAGA GGG Intronic