ID: 920632467

View in Genome Browser
Species Human (GRCh38)
Location 1:207665944-207665966
Sequence GTGTTGGACCATGTATACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920632464_920632467 -7 Left 920632464 1:207665928-207665950 CCTGAGTGATACACGTGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 920632467 1:207665944-207665966 GTGTTGGACCATGTATACATGGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920632467 Original CRISPR GTGTTGGACCATGTATACAT GGG Intronic
901461672 1:9395689-9395711 GTGCTGGACCCTGTGTGCATAGG - Intergenic
906248822 1:44295830-44295852 GTGTGGGACCATGGGAACATAGG + Intronic
916607464 1:166357553-166357575 GAGTTGGCCCATTTATAGATGGG + Intergenic
919557597 1:199078796-199078818 GTGTTGTAACATGTATTAATAGG - Intergenic
920632467 1:207665944-207665966 GTGTTGGACCATGTATACATGGG + Intronic
1067897192 10:50196114-50196136 GTTTTGAAATATGTATACATGGG - Intronic
1067951779 10:50745910-50745932 GTTTTGAAATATGTATACATGGG + Intronic
1069441957 10:68437135-68437157 GTATGGCACCATGTTTACATTGG + Exonic
1071671622 10:87614330-87614352 GTGGTGTACCATGTTCACATTGG - Intergenic
1077932330 11:6746615-6746637 GAACTGGACCATGTTTACATTGG + Intergenic
1078125077 11:8553496-8553518 GTGATGGATCACGTATACAGTGG - Intronic
1080216523 11:29848605-29848627 TTGGTTGACCATGTATACATGGG - Intergenic
1081301869 11:41462453-41462475 ATGTGGGACCATGGATACAGAGG - Intergenic
1082614833 11:55346984-55347006 GTCTTAAAACATGTATACATTGG + Intergenic
1089971565 11:122697771-122697793 GCGTTGCACCATAGATACATGGG + Intronic
1093242404 12:16694093-16694115 TTGGTTGACCATATATACATGGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1098421964 12:70307504-70307526 ATGATGGACCATATATACAACGG - Intronic
1098505723 12:71248466-71248488 ATGTTGGACCACATATACAATGG - Intronic
1099885219 12:88521158-88521180 TTGTTTAACCATGTATATATTGG + Intronic
1100035049 12:90240309-90240331 GACATGGAACATGTATACATAGG - Intergenic
1104203332 12:126613586-126613608 GTGTTATACCATGCATCCATGGG - Intergenic
1105583070 13:21719118-21719140 GTTTTGAAAAATGTATACATAGG - Intergenic
1117383549 14:55189503-55189525 GTGAAGGACCATGTACACAAGGG + Intronic
1123126524 14:105950674-105950696 GTTTTGTAACATGTCTACATAGG + Intergenic
1123407038 15:20026777-20026799 GTTTTGTAACATGTCTACATAGG + Intergenic
1123516369 15:21033433-21033455 GTTTTGTAACATGTCTACATAGG + Intergenic
1125592580 15:40864091-40864113 GTGCTGGCCCGTGTTTACATGGG - Intergenic
1127550710 15:60035423-60035445 GTGTTGGATCACGTAGACAGTGG + Intronic
1130114603 15:80995955-80995977 GTGCTGGACCAGTTATACCTTGG - Intergenic
1130675691 15:85950049-85950071 GGGTTGTACCATGAATACCTTGG - Intergenic
1130796854 15:87218710-87218732 GTGTTGGATCATGCAAACCTTGG - Intergenic
1131670349 15:94613117-94613139 ATGACGGACCATGTATACAATGG + Intergenic
1131736870 15:95342138-95342160 GGGATGGACTATGTATACAATGG - Intergenic
1137345854 16:47658524-47658546 ATGATGGACCACGTATACAATGG + Intronic
1139807601 16:69581828-69581850 GTTTTGAAATATGTATACATTGG + Intronic
1141251219 16:82360695-82360717 GTGTTGGTCCAAGGATAAATGGG - Intergenic
1145820455 17:27829900-27829922 GTGTTTAACCTTGTATACAAAGG - Intronic
1145821486 17:27839923-27839945 GTGTTTAACCTTGTATACAAAGG + Intronic
1151072385 17:71230492-71230514 ATGATGGACCATATATACAATGG + Intergenic
1154971986 18:21418929-21418951 GTGATGGACCTCGTATACAAAGG + Intronic
928164500 2:28960095-28960117 ATGTTGGACCACATATACAACGG - Intronic
931494642 2:62789664-62789686 GGGTTGGAAGATGTATGCATTGG - Intronic
938232351 2:129672119-129672141 GTCTTGGACAATGTAGATATTGG - Intergenic
1169642706 20:7772483-7772505 ATGTTGGAGAATGAATACATAGG + Intergenic
1170560718 20:17556004-17556026 ATGTTGGTCCATTTCTACATGGG + Intronic
1171751475 20:29054286-29054308 ATGTTGACCCATGGATACATAGG + Intergenic
1174509997 20:51043797-51043819 GTGATGGACCACATATACAATGG + Intergenic
1176313302 21:5216658-5216680 ATGTTGACCCATGGATACATAGG - Intergenic
1177428488 21:20957838-20957860 ATATTGGACAACGTATACATAGG - Intergenic
1178444902 21:32630832-32630854 GAGTTGGACTATGTGTATATTGG - Intronic
949391008 3:3562452-3562474 GAGATGGACAATCTATACATAGG + Intergenic
955793928 3:62615683-62615705 GTGGTTGACCTTGTATCCATCGG - Intronic
957128341 3:76191931-76191953 GAGTTTCACCCTGTATACATGGG - Intronic
958609511 3:96406615-96406637 GTGATGGACTATGTATACGAAGG - Intergenic
962035419 3:131646493-131646515 GTGTTGGACCTTAGAAACATGGG - Intronic
962548594 3:136464714-136464736 GTGATTCACCATGTATACATAGG + Intronic
962612545 3:137091919-137091941 GTATTTGAGCATGTGTACATGGG - Intergenic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
963147935 3:142014085-142014107 AAGTTGGACCCTGTATATATGGG - Intronic
964593956 3:158400129-158400151 GTGATGGACCATGTATACCATGG + Intronic
966584566 3:181607311-181607333 ATTTTGGACCTTGAATACATAGG + Intergenic
967494646 3:190129260-190129282 TTTTTTGACCATGTATATATGGG - Intergenic
973079451 4:45971543-45971565 ATGCTGGACCACGTATACAATGG + Intergenic
977873709 4:102124287-102124309 GTGTTGGACAATGTATGGAAAGG + Intergenic
979985035 4:127303432-127303454 ATGATGGACCATGTATACAATGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
985754942 5:1708055-1708077 CAGTTGTACCATGTACACATTGG - Intergenic
988834005 5:35013899-35013921 GTGTTGGAACTTGTGTAGATTGG - Intronic
992910417 5:81391143-81391165 ATCTTGAATCATGTATACATAGG - Intronic
993199644 5:84798036-84798058 AAGATGGACCATGTATACAATGG - Intergenic
998497020 5:142599731-142599753 AGGTTTGACCATGTATAGATAGG - Intronic
1000766977 5:165304046-165304068 GCGTTAGACCATGTATACCTTGG - Intergenic
1007884730 6:45214089-45214111 GTGTTTGCTCATTTATACATTGG - Intronic
1009726325 6:67540297-67540319 GATTTGGACAATGAATACATAGG - Intergenic
1010855619 6:80834849-80834871 GTGTTTGTCCATGTAGCCATTGG - Intergenic
1014413872 6:121159786-121159808 ATGATGGACCAAGTATACAAAGG - Intronic
1015047935 6:128800350-128800372 GTTTTGAAATATGTATACATTGG - Intergenic
1015431749 6:133139424-133139446 GTGTTGTGCCAGGTATAAATAGG + Intergenic
1019040061 6:169096304-169096326 GTGTTGTACCATGTATCAAGAGG + Intergenic
1020461112 7:8431271-8431293 AGGTTGGACCAGGTAGACATGGG + Intergenic
1022899830 7:34795771-34795793 GAGTTATTCCATGTATACATAGG + Intronic
1027415259 7:77967471-77967493 GTTTTGGAACATGTAAAAATGGG - Intergenic
1028062264 7:86337238-86337260 GTGTTGGCCCATATTTACATTGG + Intergenic
1031323721 7:120365438-120365460 CTGTAAGGCCATGTATACATAGG + Intronic
1035899379 8:3441558-3441580 ATGATGGATCATGTATACAATGG + Intronic
1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG + Intronic
1042437987 8:68790126-68790148 GTGCTGGGACATGTATACATTGG + Intronic
1044195080 8:89366526-89366548 GTTTTGAAACACGTATACATTGG - Intergenic
1051177252 9:14373236-14373258 TTGTTGGAACATGTACACCTGGG + Intronic
1052400833 9:27998156-27998178 CTGTTGGTCAATGTAGACATAGG - Intronic
1056944071 9:90978821-90978843 GTGCTGGACCATGTACATCTTGG - Intergenic
1061069465 9:128300145-128300167 GAGATAGACCATGTAGACATAGG + Intergenic
1186461221 X:9750096-9750118 ATCTTGGCCCATGTATACAATGG - Intronic
1186484019 X:9919120-9919142 GTGTTGGACCTGGAATACAGAGG + Intronic
1188775387 X:34211115-34211137 GTGATGGACTACGTATACAATGG + Intergenic
1190583745 X:51916231-51916253 ATATTGAAACATGTATACATTGG + Intergenic
1195840331 X:109169125-109169147 CTTTTTGATCATGTATACATGGG - Intergenic
1200117587 X:153776148-153776170 GTGTTGGACCAAGTCTACAAGGG + Exonic
1201907025 Y:19096153-19096175 GTTTTGGACCATATAAAAATAGG - Intergenic